microRNA information: hsa-miR-222-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-222-5p | miRbase |
| Accession: | MIMAT0004569 | miRbase |
| Precursor name: | hsa-mir-222 | miRbase |
| Precursor accession: | MI0000299 | miRbase |
| Symbol: | MIR222 | HGNC |
| RefSeq ID: | NR_029636 | GenBank |
| Sequence: | CUCAGUAGCCAGUGUAGAUCCU |
Reported expression in cancers: hsa-miR-222-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-222-5p | bladder cancer | upregulation | "Increased expression of miR 222 is associated with ......" | 25078265 | |
| hsa-miR-222-5p | breast cancer | upregulation | "Forty-nine primary triple-negative breast cancer c ......" | 21270527 | qPCR |
| hsa-miR-222-5p | breast cancer | upregulation | "Among methods for profiling levels of miRNAs next- ......" | 22387599 | RNA-Seq; qPCR; Northern blot |
| hsa-miR-222-5p | breast cancer | upregulation | "Then five up-regulated miRNAs miR-100 miR-29a miR- ......" | 23994196 | |
| hsa-miR-222-5p | breast cancer | upregulation | "miR 222 induces Adriamycin resistance in breast ca ......" | 27699665 | |
| hsa-miR-222-5p | breast cancer | upregulation | "The aim of this study was to investigate the role ......" | 27746365 | qPCR |
| hsa-miR-222-5p | breast cancer | upregulation | "Through pathway enrichment analyses for miR-222 we ......" | 27746366 | qPCR |
| hsa-miR-222-5p | cervical and endocervical cancer | upregulation | "This study aimed to investigate the role of small ......" | 24895988 | |
| hsa-miR-222-5p | chordoma | downregulation | "miRNAs are small RNA sequences that affect transcr ......" | 23912551 | RNA-Seq; qPCR |
| hsa-miR-222-5p | colon cancer | downregulation | "To present proof-of-principle application for empl ......" | 23741026 | qPCR; Microarray |
| hsa-miR-222-5p | colorectal cancer | upregulation | "The increased expression of miR-200c miR-221 and m ......" | 21873159 | |
| hsa-miR-222-5p | gastric cancer | upregulation | "Here we showed that microRNA-222 miR-222 was up-re ......" | 22321642 | |
| hsa-miR-222-5p | gastric cancer | upregulation | "The expression levels of miR-20a miR-21 miR-25 miR ......" | 22996433 | qPCR |
| hsa-miR-222-5p | gastric cancer | upregulation | "The miRNAs differentially expressed in gastric can ......" | 24473397 | qPCR; Microarray |
| hsa-miR-222-5p | gastric cancer | upregulation | "Circulating miR 222 in plasma and its potential di ......" | 25129310 | qPCR |
| hsa-miR-222-5p | glioblastoma | upregulation | "MicroRNA miR-221 and miR-222 are frequently upregu ......" | 20428775 | |
| hsa-miR-222-5p | glioblastoma | upregulation | "MiR-221 and miR-222 miR-221/222 are frequently up- ......" | 20813046 | |
| hsa-miR-222-5p | liver cancer | downregulation | "This study was divided into four phases: I Ten can ......" | 22174818 | qPCR |
| hsa-miR-222-5p | liver cancer | downregulation | "Expression of microRNAs miR 21 miR 31 miR 122 miR ......" | 22213236 | qPCR |
| hsa-miR-222-5p | lung squamous cell cancer | upregulation | "MicroRNA 222 expression and its prognostic potenti ......" | 24955421 | Reverse transcription PCR |
| hsa-miR-222-5p | ovarian cancer | upregulation | "In the present study miR-222 was observed to be fr ......" | 24137356 | |
| hsa-miR-222-5p | ovarian cancer | upregulation | "Real-time quantitative PCR was used to determine t ......" | 25744846 | qPCR |
| hsa-miR-222-5p | pancreatic cancer | upregulation | "Profiling of 95 microRNAs in pancreatic cancer cel ......" | 19030927 | qPCR |
| hsa-miR-222-5p | prostate cancer | upregulation | "The inhibition of the highly expressed miR 221 and ......" | 19107213 | |
| hsa-miR-222-5p | prostate cancer | upregulation | "Mir-221 and miR-222 two closely related miRNAs enc ......" | 21245048 | |
| hsa-miR-222-5p | thyroid cancer | upregulation | "The aim of this study was to assess miRNA expressi ......" | 23427895 | Microarray |
| hsa-miR-222-5p | thyroid cancer | upregulation | "Using laser microdissection followed by quantitati ......" | 23563786 | qPCR |
| hsa-miR-222-5p | thyroid cancer | upregulation | "To detect the levels of miRNA expression in fresh ......" | 23569392 | Microarray |
Reported cancer pathway affected by hsa-miR-222-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-222-5p | breast cancer | Apoptosis pathway | "Of the elevated miRNAs in ERalpha-negative cells m ......" | 18790736 | |
| hsa-miR-222-5p | breast cancer | Apoptosis pathway | "MiR 222 and miR 29a contribute to the drug resista ......" | 23994196 | Western blot |
| hsa-miR-222-5p | breast cancer | cell cycle pathway | "miRNA inhibitors specially targeting miR-221 or mi ......" | 24886939 | |
| hsa-miR-222-5p | breast cancer | Apoptosis pathway | "Exosomes from adriamycin resistant breast cancer c ......" | 26432333 | MTT assay |
| hsa-miR-222-5p | breast cancer | cell cycle pathway; Apoptosis pathway | "miR 222 confers the resistance of breast cancer ce ......" | 27282281 | Western blot; Flow cytometry |
| hsa-miR-222-5p | breast cancer | Apoptosis pathway | "miR 222 induces Adriamycin resistance in breast ca ......" | 27699665 | Western blot; Flow cytometry |
| hsa-miR-222-5p | chordoma | cell cycle pathway; Apoptosis pathway | "In this study miR-31 anti-miR-140-3p anti-miR148a ......" | 27016303 | Cell Proliferation Assay |
| hsa-miR-222-5p | colorectal cancer | Apoptosis pathway | "MiR 222 modulates multidrug resistance in human co ......" | 22677042 | Luciferase |
| hsa-miR-222-5p | endometrial cancer | cell cycle pathway | "The expression of miRNAs and related genes were de ......" | 23680357 | Western blot; Flow cytometry; Colony formation |
| hsa-miR-222-5p | gastric cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 221 and microRNA 222 regulate gastric car ......" | 20618998 | Western blot; Luciferase |
| hsa-miR-222-5p | glioblastoma | cell cycle pathway | "Northern blot analysis was conducted to detect the ......" | 19953484 | Flow cytometry; Western blot |
| hsa-miR-222-5p | liver cancer | PI3K/Akt signaling pathway | "MiR 222 overexpression confers cell migratory adva ......" | 20103675 | Luciferase |
| hsa-miR-222-5p | liver cancer | cell cycle pathway | "MiR 222 overexpression promotes proliferation of h ......" | 24955159 | Flow cytometry; Western blot |
| hsa-miR-222-5p | lung cancer | PI3K/Akt signaling pathway | "High mobility group A1 proteins enhance the expres ......" | 21656127 | |
| hsa-miR-222-5p | lung cancer | cell cycle pathway | "Metformin inhibits lung cancer cells proliferation ......" | 23974492 | |
| hsa-miR-222-5p | lung squamous cell cancer | cell cycle pathway; Apoptosis pathway | "Growth inhibitory effects of miR 221 and miR 222 i ......" | 25641933 | |
| hsa-miR-222-5p | melanoma | cell cycle pathway | "Exosome mediated transfer of miR 222 is sufficient ......" | 26912358 | Western blot |
| hsa-miR-222-5p | ovarian cancer | cell cycle pathway | "MiR 221 and MiR 222 alterations in sporadic ovaria ......" | 20461750 | |
| hsa-miR-222-5p | pancreatic cancer | cell cycle pathway | "MicroRNA 222 Controls Human Pancreatic Cancer Cell ......" | 26535064 | Flow cytometry; Western blot |
| hsa-miR-222-5p | prostate cancer | cell cycle pathway | "miR 221 and miR 222 expression affects the prolife ......" | 17569667 | Colony formation |
| hsa-miR-222-5p | prostate cancer | cell cycle pathway | "The inhibition of the highly expressed miR 221 and ......" | 19107213 | |
| hsa-miR-222-5p | prostate cancer | cell cycle pathway; Apoptosis pathway | "Down regulation of mir 221 and mir 222 restrain pr ......" | 24892674 |
Reported cancer prognosis affected by hsa-miR-222-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-222-5p | B cell lymphoma | poor survival; progression | "We measured the expression of each miRNA by quanti ......" | 21525173 | |
| hsa-miR-222-5p | bladder cancer | progression; poor survival; recurrence | "miR 143 miR 222 and miR 452 are useful as tumor st ......" | 22426337 | |
| hsa-miR-222-5p | bladder cancer | malignant trasformation | "We screened 723 miRNAs by microarray and selected ......" | 23945108 | |
| hsa-miR-222-5p | bladder cancer | worse prognosis; poor survival; staging | "Increased expression of miR 222 is associated with ......" | 25078265 | |
| hsa-miR-222-5p | bladder cancer | worse prognosis; drug resistance | "miR 222 attenuates cisplatin induced cell death by ......" | 26800397 | |
| hsa-miR-222-5p | breast cancer | drug resistance | "The drug resistance of MCF-7/ADR cells was evaluat ......" | 18971180 | Flow cytometry; MTT assay |
| hsa-miR-222-5p | breast cancer | poor survival | "Forty-nine primary triple-negative breast cancer c ......" | 21270527 | |
| hsa-miR-222-5p | breast cancer | cell migration | "We identified the microRNAs miRNAs miR-221 and miR ......" | 21673316 | |
| hsa-miR-222-5p | breast cancer | progression; drug resistance | "Here we find that nucleolin NCL a major nucleolar ......" | 23610125 | |
| hsa-miR-222-5p | breast cancer | drug resistance | "MiR 222 and miR 29a contribute to the drug resista ......" | 23994196 | Western blot |
| hsa-miR-222-5p | breast cancer | drug resistance | "MTT-cytotoxic miRNA microarray Real-time quantitat ......" | 25562151 | Western blot; Luciferase |
| hsa-miR-222-5p | breast cancer | drug resistance | "Exosomes from adriamycin resistant breast cancer c ......" | 26432333 | MTT assay |
| hsa-miR-222-5p | breast cancer | drug resistance | "miR 222 confers the resistance of breast cancer ce ......" | 27282281 | Western blot; Flow cytometry |
| hsa-miR-222-5p | breast cancer | poor survival | "In 5C 34 miRNAs of the DLK1-DIO3 locus and miR-31 ......" | 27659519 | |
| hsa-miR-222-5p | breast cancer | drug resistance; worse prognosis | "miR 222 induces Adriamycin resistance in breast ca ......" | 27699665 | Western blot; Flow cytometry |
| hsa-miR-222-5p | breast cancer | worse prognosis; drug resistance | "The aim of this study was to investigate the role ......" | 27746365 | |
| hsa-miR-222-5p | breast cancer | drug resistance; poor survival; worse prognosis | "MiR 222 promotes drug resistance of breast cancer ......" | 27746366 | Western blot |
| hsa-miR-222-5p | cervical and endocervical cancer | tumorigenesis | "MicroRNA 222 promotes the proliferation and migrat ......" | 24895988 | Western blot; Flow cytometry; Cell migration assay |
| hsa-miR-222-5p | colon cancer | staging | "To present proof-of-principle application for empl ......" | 23741026 | |
| hsa-miR-222-5p | colorectal cancer | drug resistance | "MiR 222 modulates multidrug resistance in human co ......" | 22677042 | Luciferase |
| hsa-miR-222-5p | colorectal cancer | drug resistance | "On the other hand miR-222 targeting ADAM-17 a disi ......" | 23173124 | |
| hsa-miR-222-5p | colorectal cancer | staging; drug resistance | "To explore the potential molecular biomarkers pred ......" | 24460313 | |
| hsa-miR-222-5p | endometrial cancer | progression; metastasis; tumorigenesis | "The expression of miRNAs and related genes were de ......" | 23680357 | Western blot; Flow cytometry; Colony formation |
| hsa-miR-222-5p | gastric cancer | drug resistance; progression; malignant trasformation | "MicroRNA 221 and microRNA 222 regulate gastric car ......" | 20618998 | Western blot; Luciferase |
| hsa-miR-222-5p | gastric cancer | progression; tumorigenesis | "Increased miR 222 in H pylori associated gastric c ......" | 22321642 | Colony formation; RNAi |
| hsa-miR-222-5p | gastric cancer | poor survival; metastasis | "The expression levels of miR-20a miR-21 miR-25 miR ......" | 22996433 | |
| hsa-miR-222-5p | gastric cancer | poor survival; worse prognosis | "Circulating miR 222 in plasma and its potential di ......" | 25129310 | |
| hsa-miR-222-5p | glioblastoma | poor survival | "MiR 221 and miR 222 target PUMA to induce cell sur ......" | 20813046 | |
| hsa-miR-222-5p | glioblastoma | poor survival | "Thirty-nine and six microRNAs including hsa-miR-22 ......" | 21737610 | |
| hsa-miR-222-5p | glioblastoma | cell migration | "Furthermore miR-222 and -221 induced an increase i ......" | 21743492 | Colony formation |
| hsa-miR-222-5p | glioblastoma | differentiation | "Using this in vitro system a microarray-based high ......" | 24155920 | |
| hsa-miR-222-5p | glioblastoma | drug resistance | "In our study we found that radiation induced c-jun ......" | 24295494 | RNAi |
| hsa-miR-222-5p | liver cancer | malignant trasformation | "Our study identified and validated miR-224 overexp ......" | 18433021 | |
| hsa-miR-222-5p | liver cancer | malignant trasformation; staging; poor survival; motility | "MiR 222 overexpression confers cell migratory adva ......" | 20103675 | Luciferase |
| hsa-miR-222-5p | liver cancer | metastasis; tumorigenesis; recurrence | "We examined expression patterns of 4 microRNAs mic ......" | 21458843 | |
| hsa-miR-222-5p | liver cancer | worse prognosis; staging; tumor size; poor survival | "Expression of serum microRNAs miR 222 miR 181 miR ......" | 24124720 | |
| hsa-miR-222-5p | liver cancer | progression | "MiR 222 overexpression promotes proliferation of h ......" | 24955159 | Flow cytometry; Western blot |
| hsa-miR-222-5p | liver cancer | cell migration | "GNAI3 inhibits tumor cell migration and invasion a ......" | 25444921 | Transwell assay |
| hsa-miR-222-5p | lung cancer | progression | "Metformin inhibits lung cancer cells proliferation ......" | 23974492 | |
| hsa-miR-222-5p | lung squamous cell cancer | staging | "There was statistical difference in the serum leve ......" | 22009180 | |
| hsa-miR-222-5p | lung squamous cell cancer | tumorigenesis; drug resistance | "It has been recently reported that epidermal growt ......" | 24286402 | |
| hsa-miR-222-5p | lung squamous cell cancer | worse prognosis; poor survival | "MicroRNA 222 expression and its prognostic potenti ......" | 24955421 | |
| hsa-miR-222-5p | melanoma | progression; differentiation | "We have identified the promyelocytic leukemia zinc ......" | 18417445 | |
| hsa-miR-222-5p | melanoma | staging | "Constitutive activation of the ETS 1 miR 222 circu ......" | 21711453 | |
| hsa-miR-222-5p | melanoma | tumorigenesis | "Exosome mediated transfer of miR 222 is sufficient ......" | 26912358 | Western blot |
| hsa-miR-222-5p | ovarian cancer | poor survival | "MiR 221 and MiR 222 alterations in sporadic ovaria ......" | 20461750 | |
| hsa-miR-222-5p | ovarian cancer | tumorigenesis | "miR 222 is upregulated in epithelial ovarian cance ......" | 24137356 | Luciferase |
| hsa-miR-222-5p | pancreatic cancer | poor survival | "We measured the levels of miR-155 miR-203 miR-210 ......" | 19551852 | |
| hsa-miR-222-5p | pancreatic cancer | tumorigenesis | "miR-122 let-7 family and miR-101 are down-regulate ......" | 22303361 | |
| hsa-miR-222-5p | pancreatic cancer | worse prognosis | "Elevated expression of tumor miR 222 in pancreatic ......" | 24026657 | |
| hsa-miR-222-5p | prostate cancer | drug resistance | "The role of microRNA 221 and microRNA 222 in andro ......" | 19351832 | |
| hsa-miR-222-5p | prostate cancer | recurrence | "miR 21 miR 221 and miR 222 expression and prostate ......" | 23353719 | |
| hsa-miR-222-5p | prostate cancer | staging; progression | "Microarray and Q-RT-PCR analyses identified 43 miR ......" | 24583788 | |
| hsa-miR-222-5p | prostate cancer | progression; poor survival; cell migration | "Our present study of the microRNA miRNA expression ......" | 26325107 | |
| hsa-miR-222-5p | thyroid cancer | tumorigenesis | "MicroRNA miRNA microarray analysis has consistentl ......" | 18587330 | |
| hsa-miR-222-5p | thyroid cancer | metastasis; recurrence | "In this study we evaluated miRNA expression as a m ......" | 21537871 | |
| hsa-miR-222-5p | thyroid cancer | staging; metastasis; tumor size | "Genome-wide serum miRNA expression profiles were d ......" | 22472564 | |
| hsa-miR-222-5p | thyroid cancer | malignant trasformation | "A limited set of miRNA have been assessed as part ......" | 22771635 | |
| hsa-miR-222-5p | thyroid cancer | motility | "HMGB1 induces the overexpression of miR 222 and mi ......" | 23023232 | |
| hsa-miR-222-5p | thyroid cancer | tumor size; staging; metastasis | "To detect the levels of miRNA expression in fresh ......" | 23569392 | |
| hsa-miR-222-5p | thyroid cancer | recurrence | "MicroRNA 222 and microRNA 146b are tissue and circ ......" | 24301304 | |
| hsa-miR-222-5p | thyroid cancer | tumorigenesis | "Upregulation of miRNAs such as miR-146b miR-221 an ......" | 25202329 | |
| hsa-miR-222-5p | thyroid cancer | tumor size | "The levels of miR-146b miR-221 miR-222 and miR-155 ......" | 25456009 | |
| hsa-miR-222-5p | thyroid cancer | tumor size | "All tumors were tested for the presence of the BRA ......" | 26950846 | |
| hsa-miR-222-5p | thyroid cancer | staging | "Likewise postoperative levels of miR-151-5p miR-22 ......" | 27162538 |
Reported gene related to hsa-miR-222-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-222-5p | breast cancer | PTEN | "Moreover upregulation of miR-222 expression in MCF ......" | 27746366 |
| hsa-miR-222-5p | breast cancer | PTEN | "Western blot results suggested that miR-222 and -2 ......" | 23994196 |
| hsa-miR-222-5p | breast cancer | PTEN | "The results showed that inhibition of miR-222 in M ......" | 27699665 |
| hsa-miR-222-5p | cervical and endocervical cancer | PTEN | "The reduced the expression of PTEN and p27 by miR- ......" | 24895988 |
| hsa-miR-222-5p | gastric cancer | PTEN | "MicroRNA 221 and microRNA 222 regulate gastric car ......" | 20618998 |
| hsa-miR-222-5p | lung cancer | PTEN | "MiR-222 induces cell growth and cell cycle progres ......" | 23974492 |
| hsa-miR-222-5p | lung cancer | PTEN | "The expression of tumor suppressor p27 and PTEN mi ......" | 27566197 |
| hsa-miR-222-5p | pancreatic cancer | PTEN | "MiR-222 and putative target gene expression levels ......" | 26535064 |
| hsa-miR-222-5p | breast cancer | CDKN1B | "miR 222 confers the resistance of breast cancer ce ......" | 27282281 |
| hsa-miR-222-5p | cervical and endocervical cancer | CDKN1B | "MiR-222 plays an important role in the tumorigenes ......" | 24895988 |
| hsa-miR-222-5p | glioblastoma | CDKN1B | "Based on bioinformatic analysis we found that the ......" | 19953484 |
| hsa-miR-222-5p | melanoma | CDKN1B | "Besides microvesicle marker characterization we ev ......" | 26912358 |
| hsa-miR-222-5p | ovarian cancer | CDKN1B | "miR 222 is upregulated in epithelial ovarian cance ......" | 24137356 |
| hsa-miR-222-5p | ovarian cancer | CDKN1B | "MiR 221 and MiR 222 alterations in sporadic ovaria ......" | 20461750 |
| hsa-miR-222-5p | prostate cancer | CDKN1B | "miR 221 and miR 222 expression affects the prolife ......" | 17569667 |
| hsa-miR-222-5p | breast cancer | AKR1B1 | "The aim of this study was to explore the possible ......" | 27746366 |
| hsa-miR-222-5p | breast cancer | AKR1B1 | "Western blot results suggested that miR-222 and -2 ......" | 23994196 |
| hsa-miR-222-5p | breast cancer | AKR1B1 | "Importantly Adr resistance induced by miR-222 over ......" | 27699665 |
| hsa-miR-222-5p | breast cancer | AKR1B1 | "The results showed that downregulation of miR-222 ......" | 27282281 |
| hsa-miR-222-5p | bladder cancer | PPP2R2A | "miR-222 activated the Akt/mTOR pathway and inhibit ......" | 26800397 |
| hsa-miR-222-5p | liver cancer | PPP2R2A | "The protein phosphatase 2A subunit B PPP2R2A was p ......" | 20103675 |
| hsa-miR-222-5p | lung cancer | PPP2R2A | "Based on in silico prediction one of the putative ......" | 21656127 |
| hsa-miR-222-5p | gastric cancer | RECK | "Increased miR 222 in H pylori associated gastric c ......" | 22321642 |
| hsa-miR-222-5p | gastric cancer | RECK | "miR 221 and miR 222 Simultaneously Target RECK and ......" | 26364844 |
| hsa-miR-222-5p | colorectal cancer | ADAM17 | "MiR 222 modulates multidrug resistance in human co ......" | 22677042 |
| hsa-miR-222-5p | liver cancer | AFP | "According to the median fold change of miR-222 3-f ......" | 24124720 |
| hsa-miR-222-5p | breast cancer | ARHGEF7 | "In this study miR-146a and miR-222 were shown to b ......" | 26689540 |
| hsa-miR-222-5p | cervical and endocervical cancer | ARID1A | "MiR 221 and miR 222 simultaneously target ARID1A a ......" | 27160122 |
| hsa-miR-222-5p | breast cancer | ARID3A | "Individual miR-222 could be detected as bright pho ......" | 26432333 |
| hsa-miR-222-5p | glioblastoma | BBC3 | "MiR 221 and miR 222 target PUMA to induce cell sur ......" | 20813046 |
| hsa-miR-222-5p | ovarian cancer | CDKN1C | "miR-221 and miR-222 negatively regulate expression ......" | 20461750 |
| hsa-miR-222-5p | chordoma | CHDM | "In this study miR-31 anti-miR-140-3p anti-miR148a ......" | 27016303 |
| hsa-miR-222-5p | breast cancer | CYP19A1 | "Celecoxib increases miR 222 while deterring aromat ......" | 24923427 |
| hsa-miR-222-5p | breast cancer | DICER1 | "Addition of these miRNAs to ESR1+ cells reduces Di ......" | 21761362 |
| hsa-miR-222-5p | melanoma | ETS1 | "Constitutive activation of the ETS 1 miR 222 circu ......" | 21711453 |
| hsa-miR-222-5p | breast cancer | FOXO1 | "RT-qPCR and Western blot results showed that miR-2 ......" | 27746366 |
| hsa-miR-222-5p | liver cancer | GNAI3 | "GNAI3 inhibits tumor cell migration and invasion a ......" | 25444921 |
| hsa-miR-222-5p | thyroid cancer | HGF | "Finally miR-296 and miR-222 levels negatively corr ......" | 19926710 |
| hsa-miR-222-5p | lung cancer | HMGA1 | "Here we showed that in a cohort of non-small cell ......" | 21656127 |
| hsa-miR-222-5p | thyroid cancer | HMGB1 | "HMGB1 induces the overexpression of miR 222 and mi ......" | 23023232 |
| hsa-miR-222-5p | kidney renal cell cancer | LARP6 | "Gain of function experiments showed that miR-221 a ......" | 26201448 |
| hsa-miR-222-5p | melanoma | PML | "We have identified the promyelocytic leukemia zinc ......" | 18417445 |
| hsa-miR-222-5p | breast cancer | QRSL1 | "In breast cancer the microRNAs miRNAs miR-221 and ......" | 23776679 |
| hsa-miR-222-5p | colorectal cancer | RELA | "Human CRC tissues had higher levels of miR-221 and ......" | 24931456 |
| hsa-miR-222-5p | prostate cancer | SIRT1 | "Down regulation of mir 221 and mir 222 restrain pr ......" | 24892674 |
| hsa-miR-222-5p | colorectal cancer | STAT3 | "We investigated whether microRNA miR-221 and miR-2 ......" | 24931456 |
| hsa-miR-222-5p | breast cancer | TRPS1 | "In breast cancer the microRNAs miRNAs miR-221 and ......" | 23776679 |
| hsa-miR-222-5p | thyroid cancer | TXK | "Finally miR-296 and miR-222 levels negatively corr ......" | 19926710 |
| hsa-miR-222-5p | gastric cancer | VGLL4 | "Here we confirmed the suppressor role of VGLL4 on ......" | 26045994 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-222-5p | AFF3 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.392; TCGA BRCA -0.61; TCGA CESC -0.443; TCGA COAD -0.559; TCGA ESCA -0.67; TCGA HNSC -0.198; TCGA KIRC -0.226; TCGA LUAD -0.243; TCGA LUSC -0.288; TCGA SARC -0.68; TCGA STAD -0.69; TCGA UCEC -0.268 |
hsa-miR-222-5p | PATZ1 | 11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA | MirTarget | TCGA BLCA -0.253; TCGA BRCA -0.191; TCGA CESC -0.255; TCGA HNSC -0.131; TCGA KIRC -0.056; TCGA KIRP -0.084; TCGA LUAD -0.099; TCGA PAAD -0.065; TCGA PRAD -0.121; TCGA SARC -0.061; TCGA THCA -0.066 |
hsa-miR-222-5p | TGFBR3 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.638; TCGA CESC -0.353; TCGA COAD -0.159; TCGA ESCA -0.28; TCGA HNSC -0.146; TCGA KIRC -0.126; TCGA LIHC -0.326; TCGA SARC -0.153; TCGA THCA -0.161; TCGA STAD -0.525 |
hsa-miR-222-5p | STMN2 | 11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC | MirTarget | TCGA BLCA -0.659; TCGA BRCA -0.178; TCGA CESC -0.444; TCGA COAD -0.881; TCGA ESCA -1.019; TCGA HNSC -0.289; TCGA LUSC -0.356; TCGA PAAD -0.289; TCGA PRAD -0.22; TCGA STAD -0.891; TCGA UCEC -0.238 |
hsa-miR-222-5p | PCMTD1 | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.2; TCGA CESC -0.141; TCGA COAD -0.218; TCGA ESCA -0.171; TCGA HNSC -0.074; TCGA KIRC -0.051; TCGA LIHC -0.071; TCGA LUAD -0.106; TCGA LUSC -0.133; TCGA SARC -0.234; TCGA THCA -0.159; TCGA STAD -0.234; TCGA UCEC -0.135 |
hsa-miR-222-5p | OPHN1 | 10 cancers: BLCA; CESC; COAD; ESCA; LUAD; PAAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.099; TCGA CESC -0.107; TCGA COAD -0.098; TCGA ESCA -0.099; TCGA LUAD -0.159; TCGA PAAD -0.182; TCGA SARC -0.187; TCGA THCA -0.178; TCGA STAD -0.161; TCGA UCEC -0.076 |
hsa-miR-222-5p | SESTD1 | 9 cancers: BLCA; CESC; COAD; KIRC; KIRP; LUAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.19; TCGA CESC -0.176; TCGA COAD -0.083; TCGA KIRC -0.065; TCGA KIRP -0.133; TCGA LUAD -0.156; TCGA SARC -0.186; TCGA STAD -0.176; TCGA UCEC -0.087 |
hsa-miR-222-5p | SORBS2 | 11 cancers: BLCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; PAAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.286; TCGA CESC -0.704; TCGA COAD -0.333; TCGA ESCA -0.278; TCGA KIRC -0.18; TCGA LIHC -0.253; TCGA LUAD -0.338; TCGA PAAD -0.243; TCGA THCA -0.525; TCGA STAD -0.59; TCGA UCEC -0.417 |
hsa-miR-222-5p | FRY | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; PAAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.534; TCGA BRCA -0.198; TCGA CESC -0.502; TCGA COAD -0.391; TCGA ESCA -0.489; TCGA HNSC -0.363; TCGA KIRC -0.115; TCGA LIHC -0.135; TCGA LUAD -0.123; TCGA PAAD -0.209; TCGA SARC -0.415; TCGA THCA -0.139; TCGA STAD -0.336 |
hsa-miR-222-5p | CBR4 | 10 cancers: BLCA; BRCA; KIRC; KIRP; LIHC; PAAD; PRAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.155; TCGA BRCA -0.091; TCGA KIRC -0.082; TCGA KIRP -0.058; TCGA LIHC -0.259; TCGA PAAD -0.097; TCGA PRAD -0.123; TCGA SARC -0.122; TCGA THCA -0.078; TCGA STAD -0.176 |
hsa-miR-222-5p | ZBTB4 | 9 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LUAD; PAAD; SARC; STAD | MirTarget | TCGA BLCA -0.092; TCGA BRCA -0.108; TCGA COAD -0.193; TCGA ESCA -0.205; TCGA KIRP -0.052; TCGA LUAD -0.086; TCGA PAAD -0.126; TCGA SARC -0.071; TCGA STAD -0.25 |
hsa-miR-222-5p | CDNF | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LIHC; SARC; THCA; UCEC | MirTarget | TCGA BLCA -0.147; TCGA BRCA -0.08; TCGA CESC -0.173; TCGA HNSC -0.14; TCGA KIRC -0.248; TCGA KIRP -0.148; TCGA LIHC -0.227; TCGA SARC -0.145; TCGA THCA -0.113; TCGA UCEC -0.123 |
hsa-miR-222-5p | ADAMTSL3 | 10 cancers: BLCA; COAD; ESCA; KIRC; LIHC; LUAD; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.387; TCGA COAD -0.841; TCGA ESCA -0.686; TCGA KIRC -0.13; TCGA LIHC -0.259; TCGA LUAD -0.16; TCGA PAAD -0.261; TCGA SARC -0.39; TCGA STAD -0.671; TCGA UCEC -0.17 |
hsa-miR-222-5p | PHYHIPL | 13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.363; TCGA CESC -0.34; TCGA COAD -0.488; TCGA ESCA -0.564; TCGA HNSC -0.437; TCGA KIRC -0.424; TCGA KIRP -0.36; TCGA LUAD -0.203; TCGA LUSC -0.569; TCGA PAAD -0.426; TCGA SARC -0.565; TCGA STAD -0.572; TCGA UCEC -0.298 |
hsa-miR-222-5p | CHAD | 13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.297; TCGA BRCA -0.655; TCGA CESC -0.347; TCGA ESCA -0.288; TCGA HNSC -0.229; TCGA KIRC -0.287; TCGA LIHC -0.263; TCGA LUAD -0.176; TCGA LUSC -0.337; TCGA PAAD -0.256; TCGA SARC -0.498; TCGA THCA -0.167; TCGA STAD -0.171 |
hsa-miR-222-5p | KRBA2 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; SARC; THCA; STAD | MirTarget | TCGA BLCA -0.233; TCGA BRCA -0.118; TCGA CESC -0.329; TCGA COAD -0.231; TCGA ESCA -0.25; TCGA HNSC -0.195; TCGA KIRC -0.086; TCGA LUAD -0.063; TCGA PAAD -0.178; TCGA SARC -0.203; TCGA THCA -0.113; TCGA STAD -0.271 |
hsa-miR-222-5p | CASD1 | 10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PRAD; SARC; STAD; UCEC | MirTarget | TCGA BLCA -0.162; TCGA BRCA -0.147; TCGA CESC -0.194; TCGA COAD -0.131; TCGA ESCA -0.08; TCGA HNSC -0.085; TCGA PRAD -0.075; TCGA SARC -0.088; TCGA STAD -0.191; TCGA UCEC -0.113 |
hsa-miR-222-5p | SDC2 | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; SARC; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.106; TCGA CESC -0.394; TCGA COAD -0.323; TCGA ESCA -0.332; TCGA HNSC -0.404; TCGA KIRP -0.138; TCGA LUSC -0.24; TCGA SARC -0.091; TCGA THCA -0.091; TCGA STAD -0.297; TCGA UCEC -0.195 |
hsa-miR-222-5p | CBX7 | 10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; PAAD; SARC; STAD | mirMAP | TCGA BLCA -0.307; TCGA BRCA -0.16; TCGA COAD -0.279; TCGA ESCA -0.351; TCGA HNSC -0.213; TCGA KIRC -0.159; TCGA LIHC -0.185; TCGA PAAD -0.252; TCGA SARC -0.199; TCGA STAD -0.424 |
hsa-miR-222-5p | HIF3A | 11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.629; TCGA CESC -0.451; TCGA COAD -0.401; TCGA ESCA -0.676; TCGA HNSC -0.493; TCGA KIRC -0.248; TCGA LIHC -0.16; TCGA LUAD -0.247; TCGA SARC -0.785; TCGA THCA -0.314; TCGA STAD -0.775 |
hsa-miR-222-5p | NTRK3 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; SARC; STAD | mirMAP | TCGA BLCA -0.471; TCGA CESC -0.351; TCGA COAD -0.846; TCGA ESCA -0.795; TCGA HNSC -0.482; TCGA KIRC -0.166; TCGA LUSC -0.396; TCGA SARC -0.397; TCGA STAD -0.74 |
hsa-miR-222-5p | GFRA1 | 12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.627; TCGA BRCA -0.875; TCGA CESC -0.21; TCGA COAD -0.76; TCGA ESCA -0.836; TCGA HNSC -0.378; TCGA KIRP -0.315; TCGA LUAD -0.218; TCGA LUSC -0.345; TCGA SARC -0.303; TCGA THCA -0.429; TCGA STAD -0.881 |
hsa-miR-222-5p | UBN2 | 10 cancers: BLCA; CESC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; THCA; UCEC | mirMAP | TCGA BLCA -0.172; TCGA CESC -0.091; TCGA KIRC -0.06; TCGA KIRP -0.201; TCGA LUAD -0.143; TCGA LUSC -0.063; TCGA PAAD -0.092; TCGA SARC -0.098; TCGA THCA -0.126; TCGA UCEC -0.113 |
hsa-miR-222-5p | ZNF704 | 10 cancers: BLCA; CESC; COAD; ESCA; KIRC; LUAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.313; TCGA CESC -0.357; TCGA COAD -0.219; TCGA ESCA -0.275; TCGA KIRC -0.173; TCGA LUAD -0.181; TCGA SARC -0.423; TCGA THCA -0.149; TCGA STAD -0.394; TCGA UCEC -0.141 |
hsa-miR-222-5p | TUB | 9 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.246; TCGA COAD -0.535; TCGA ESCA -0.717; TCGA HNSC -0.409; TCGA KIRC -0.27; TCGA LUAD -0.138; TCGA SARC -0.659; TCGA THCA -0.286; TCGA STAD -0.653 |
hsa-miR-222-5p | REPS2 | 10 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LIHC; PRAD; SARC; THCA; UCEC | mirMAP | TCGA BLCA -0.123; TCGA BRCA -0.298; TCGA CESC -0.301; TCGA KIRC -0.104; TCGA KIRP -0.133; TCGA LIHC -0.17; TCGA PRAD -0.094; TCGA SARC -0.242; TCGA THCA -0.124; TCGA UCEC -0.321 |
hsa-miR-222-5p | NPTX1 | 10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; SARC; STAD; UCEC | mirMAP | TCGA BLCA -0.289; TCGA CESC -0.3; TCGA COAD -0.99; TCGA ESCA -0.839; TCGA HNSC -0.342; TCGA LUAD -0.606; TCGA LUSC -0.238; TCGA SARC -0.651; TCGA STAD -1.169; TCGA UCEC -0.212 |
hsa-miR-222-5p | PPIL6 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUSC; PAAD; THCA; UCEC | mirMAP | TCGA BLCA -0.249; TCGA BRCA -0.146; TCGA CESC -0.472; TCGA HNSC -0.172; TCGA KIRC -0.166; TCGA KIRP -0.275; TCGA LUSC -0.201; TCGA PAAD -0.157; TCGA THCA -0.179; TCGA UCEC -0.193 |
hsa-miR-222-5p | C3orf70 | 10 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; SARC; THCA; STAD | mirMAP | TCGA BLCA -0.45; TCGA COAD -0.283; TCGA ESCA -0.247; TCGA HNSC -0.142; TCGA LUAD -0.237; TCGA LUSC -0.211; TCGA PAAD -0.157; TCGA SARC -0.536; TCGA THCA -0.112; TCGA STAD -0.671 |
hsa-miR-222-5p | VMAC | 13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC | mirMAP | TCGA BLCA -0.175; TCGA BRCA -0.093; TCGA CESC -0.12; TCGA COAD -0.147; TCGA HNSC -0.154; TCGA KIRP -0.113; TCGA LUAD -0.068; TCGA PAAD -0.157; TCGA PRAD -0.056; TCGA SARC -0.06; TCGA THCA -0.09; TCGA STAD -0.135; TCGA UCEC -0.259 |
hsa-miR-222-5p | PTPRT | 9 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PRAD; SARC; STAD | mirMAP | TCGA BLCA -0.256; TCGA BRCA -0.671; TCGA CESC -0.535; TCGA COAD -0.585; TCGA ESCA -0.622; TCGA HNSC -0.378; TCGA PRAD -0.362; TCGA SARC -0.741; TCGA STAD -0.483 |
hsa-miR-222-5p | MDM4 | 10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; STAD | mirMAP | TCGA BLCA -0.136; TCGA BRCA -0.051; TCGA CESC -0.115; TCGA HNSC -0.082; TCGA KIRC -0.084; TCGA KIRP -0.157; TCGA LUAD -0.187; TCGA LUSC -0.087; TCGA SARC -0.172; TCGA STAD -0.111 |
hsa-miR-222-5p | TPPP | 9 cancers: BRCA; KIRC; LIHC; LUAD; PAAD; SARC; THCA; STAD; UCEC | MirTarget | TCGA BRCA -0.278; TCGA KIRC -0.179; TCGA LIHC -0.381; TCGA LUAD -0.176; TCGA PAAD -0.204; TCGA SARC -0.58; TCGA THCA -0.394; TCGA STAD -0.212; TCGA UCEC -0.275 |
hsa-miR-222-5p | CD99L2 | 9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; STAD | mirMAP | TCGA BRCA -0.054; TCGA CESC -0.164; TCGA COAD -0.112; TCGA ESCA -0.171; TCGA HNSC -0.185; TCGA LIHC -0.158; TCGA LUAD -0.105; TCGA PAAD -0.156; TCGA STAD -0.257 |
Enriched cancer pathways of putative targets