microRNA information: hsa-miR-26a-1-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-26a-1-3p | miRbase |
| Accession: | MIMAT0004499 | miRbase |
| Precursor name: | hsa-mir-26a-1 | miRbase |
| Precursor accession: | MI0000083 | miRbase |
| Symbol: | MIR26A1 | HGNC |
| RefSeq ID: | NR_029499 | GenBank |
| Sequence: | CCUAUUCUUGGUUACUUGCACG |
Reported expression in cancers: hsa-miR-26a-1-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-26a-1-3p | NA | NA | "NA ......" | NA | NA |
| hsa-miR-26a-1-3p | " ......" |
Reported cancer pathway affected by hsa-miR-26a-1-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-26a-1-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|
Reported gene related to hsa-miR-26a-1-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-26a-1-3p | lung cancer | CDC6 | "Here it is demonstrated that miR26a and miR26b inh ......" | 25100863 |
Expression profile in cancer corhorts:
