microRNA information: hsa-miR-30c-1-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-30c-1-3p | miRbase |
| Accession: | MIMAT0004674 | miRbase |
| Precursor name: | hsa-mir-30c-1 | miRbase |
| Precursor accession: | MI0000736 | miRbase |
| Symbol: | MIR30C1 | HGNC |
| RefSeq ID: | NR_029833 | GenBank |
| Sequence: | CUGGGAGAGGGUUGUUUACUCC |
Reported expression in cancers: hsa-miR-30c-1-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-30c-1-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-30c-1-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-30c-1-3p | lung squamous cell cancer | poor survival; staging | "Previously we reported that common variants in pre ......" | 20889907 |
Reported gene related to hsa-miR-30c-1-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|
Expression profile in cancer corhorts:
