microRNA information: hsa-miR-325
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-325 | miRbase |
Accession: | MIMAT0000771 | miRbase |
Precursor name: | hsa-mir-325 | miRbase |
Precursor accession: | MI0000824 | miRbase |
Symbol: | MIR325 | HGNC |
RefSeq ID: | NR_029905 | GenBank |
Sequence: | CCUAGUAGGUGUCCAGUAAGUGU |
Reported expression in cancers: hsa-miR-325
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-325 | liver cancer | deregulation | "The microRNA 325 inhibits hepatocellular carcinoma ......" | 26194496 |
Reported cancer pathway affected by hsa-miR-325
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|
Reported cancer prognosis affected by hsa-miR-325
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-325 | liver cancer | progression; worse prognosis | "The microRNA 325 inhibits hepatocellular carcinoma ......" | 26194496 |
Reported gene related to hsa-miR-325
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-325 | liver cancer | HMGB1 | "We showed that miR-325 was decreased and HMGB1 was ......" | 26194496 |
hsa-miR-325 | lung squamous cell cancer | HMGB1 | "Expression of MicroRNA 325 3p and its potential fu ......" | 25776482 |