microRNA information: hsa-miR-337-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-337-3p | miRbase |
| Accession: | MIMAT0000754 | miRbase |
| Precursor name: | hsa-mir-337 | miRbase |
| Precursor accession: | MI0000806 | miRbase |
| Symbol: | MIR337 | HGNC |
| RefSeq ID: | NR_029889 | GenBank |
| Sequence: | CUCCUAUAUGAUGCCUUUCUUC |
Reported expression in cancers: hsa-miR-337-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-337-3p | endometrial cancer | downregulation | "We performed quantitative polymerase chain reactio ......" | 25174797 | qPCR |
| hsa-miR-337-3p | gastric cancer | deregulation | "The results from the miRNA microarray analysis wer ......" | 21475928 | qPCR; Microarray |
Reported cancer pathway affected by hsa-miR-337-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-337-3p | endometrial cancer | cell cycle pathway | "Integrated microRNA and mRNA transcriptome sequenc ......" | 25329664 |
Reported cancer prognosis affected by hsa-miR-337-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-337-3p | endometrial cancer | staging | "Integrated microRNA and mRNA transcriptome sequenc ......" | 25329664 | |
| hsa-miR-337-3p | gastric cancer | metastasis; malignant trasformation | "Loss of has miR 337 3p expression is associated wi ......" | 24422944 | |
| hsa-miR-337-3p | gastric cancer | metastasis; poor survival; progression | "In this study through mining computational algorit ......" | 27259238 | |
| hsa-miR-337-3p | kidney renal cell cancer | malignant trasformation | "Analysis of serum microRNAs miR 26a 2* miR 191 miR ......" | 22542158 | |
| hsa-miR-337-3p | lung squamous cell cancer | drug resistance | "miR 337 3p and its targets STAT3 and RAP1A modulat ......" | 22723956 |
Reported gene related to hsa-miR-337-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-337-3p | gastric cancer | MMP14 | "In this study through mining computational algorit ......" | 27259238 |
| hsa-miR-337-3p | gastric cancer | MZF1 | "In this study through mining computational algorit ......" | 27259238 |
| hsa-miR-337-3p | acute myeloid leukemia | NPM1 | "A polymorphism in the 3' untranslated region of th ......" | 23065518 |
| hsa-miR-337-3p | lung squamous cell cancer | RAP1A | "miR 337 3p and its targets STAT3 and RAP1A modulat ......" | 22723956 |
| hsa-miR-337-3p | lung squamous cell cancer | STAT3 | "miR 337 3p and its targets STAT3 and RAP1A modulat ......" | 22723956 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-337-3p | HAPLN1 | 9 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; PAAD; THCA | MirTarget; mirMAP | TCGA BLCA -0.263; TCGA BRCA -0.366; TCGA CESC -0.306; TCGA COAD -0.474; TCGA HNSC -0.192; TCGA KIRC -0.456; TCGA LGG -0.315; TCGA PAAD -0.516; TCGA THCA -0.346 |
hsa-miR-337-3p | PCBD2 | 10 cancers: BRCA; KIRC; KIRP; LGG; LUAD; LUSC; OV; SARC; THCA; STAD | mirMAP | TCGA BRCA -0.051; TCGA KIRC -0.11; TCGA KIRP -0.059; TCGA LGG -0.118; TCGA LUAD -0.079; TCGA LUSC -0.077; TCGA OV -0.087; TCGA SARC -0.064; TCGA THCA -0.056; TCGA STAD -0.076 |
hsa-miR-337-3p | AKAP5 | 9 cancers: CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; SARC; STAD | PITA | TCGA CESC -0.172; TCGA COAD -0.2; TCGA ESCA -0.17; TCGA HNSC -0.187; TCGA KIRP -0.126; TCGA LUAD -0.089; TCGA LUSC -0.22; TCGA SARC -0.325; TCGA STAD -0.248 |
Enriched cancer pathways of putative targets