microRNA information: hsa-miR-34a-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-34a-3p | miRbase |
| Accession: | MIMAT0004557 | miRbase |
| Precursor name: | hsa-mir-34a | miRbase |
| Precursor accession: | MI0000268 | miRbase |
| Symbol: | MIR34A | HGNC |
| RefSeq ID: | NR_029610 | GenBank |
| Sequence: | CAAUCAGCAAGUAUACUGCCCU |
Reported expression in cancers: hsa-miR-34a-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-34a-3p | B cell lymphoma | downregulation | "We measured the levels of miRNAs miR-15a miR-16-1 ......" | 21987025 | Reverse transcription PCR; qPCR |
| hsa-miR-34a-3p | B cell lymphoma | upregulation | "High miR 34a expression improves response to doxor ......" | 26854484 | |
| hsa-miR-34a-3p | bladder cancer | downregulation | "Expression and role of miR 34a in bladder cancer. ......" | 23720881 | qPCR |
| hsa-miR-34a-3p | bladder cancer | downregulation | "The expression of mir-34a was detected by quantita ......" | 25551284 | qPCR |
| hsa-miR-34a-3p | breast cancer | downregulation | "MiR 34a expression has an effect for lower risk of ......" | 22102859 | |
| hsa-miR-34a-3p | breast cancer | downregulation | "However the profile and biological effects of miR- ......" | 22623155 | qPCR |
| hsa-miR-34a-3p | breast cancer | downregulation | "In this study we investigated the therapeutic pote ......" | 23032974 | |
| hsa-miR-34a-3p | breast cancer | downregulation | "Inactivation of miR-34a has been reported in multi ......" | 23292869 | |
| hsa-miR-34a-3p | breast cancer | downregulation | "Previous studies have shown that microRNA-34a miR- ......" | 25783790 | |
| hsa-miR-34a-3p | breast cancer | downregulation | "As microRNA-34a miR-34a has been suggested to be a ......" | 27524218 | Reverse transcription PCR; in situ hybridization |
| hsa-miR-34a-3p | cervical and endocervical cancer | upregulation | "miR 34a and miR 125b Expression in HPV Infection a ......" | 26180794 | |
| hsa-miR-34a-3p | colon cancer | downregulation | "Moreover miR-34a also suppressed in vivo growth of ......" | 17875987 | Microarray |
| hsa-miR-34a-3p | colon cancer | downregulation | "MicroRNA-34a miR-34a has been reported to be downr ......" | 25333573 | |
| hsa-miR-34a-3p | colorectal cancer | downregulation | "Circulating miR 34a levels are reduced in colorect ......" | 22648208 | |
| hsa-miR-34a-3p | colorectal cancer | downregulation | "The miR-34 family members described as potential t ......" | 23183747 | RNA-Seq |
| hsa-miR-34a-3p | colorectal cancer | downregulation | "Association between miR 34a expression and recurre ......" | 23355243 | qPCR |
| hsa-miR-34a-3p | colorectal cancer | downregulation | "MiR-34a is a tumor suppressor that is frequently d ......" | 24370784 | qPCR |
| hsa-miR-34a-3p | esophageal cancer | downregulation | "Among those dysregulated miRNAs miR-203 miR-34b/c ......" | 21547903 | |
| hsa-miR-34a-3p | esophageal cancer | downregulation | "Inactivation of miR 34a by aberrant CpG methylatio ......" | 24528540 | qPCR |
| hsa-miR-34a-3p | esophageal cancer | downregulation | "Clinical significance of microRNA 34a in esophagea ......" | 26782413 | qPCR |
| hsa-miR-34a-3p | esophageal cancer | downregulation | "Increasing studies demonstrate that reduced expres ......" | 26944831 | qPCR |
| hsa-miR-34a-3p | gastric cancer | downregulation | "Meanwhile we found that miR-34a was down-regulated ......" | 24837198 | |
| hsa-miR-34a-3p | gastric cancer | downregulation | "Quantitative real-time polymerase chain reaction q ......" | 24988056 | qPCR |
| hsa-miR-34a-3p | gastric cancer | downregulation | "The prognostic value of miR 34a expression in comp ......" | 25932212 | qPCR |
| hsa-miR-34a-3p | gastric cancer | downregulation | "miR-335 and miR-34a are two microRNAs miRNAs usual ......" | 26318298 | Microarray |
| hsa-miR-34a-3p | gastric cancer | downregulation | "Prognostic Significance of MiR 34a Expression in P ......" | 26415802 | qPCR |
| hsa-miR-34a-3p | glioblastoma | downregulation | "In this study we found that microRNA-34a miR-34a i ......" | 21743299 | |
| hsa-miR-34a-3p | head and neck cancer | downregulation | "Dysregulation of microRNA 34a expression in head a ......" | 22629428 | |
| hsa-miR-34a-3p | head and neck cancer | downregulation | "Conversely decreased expressions of miR-153 miR-20 ......" | 25677760 | |
| hsa-miR-34a-3p | liver cancer | downregulation | "Several studies have shown that miR-34a represses ......" | 19006648 | |
| hsa-miR-34a-3p | liver cancer | downregulation | "Of these 15 downregulated proteins may be downstre ......" | 20186752 | |
| hsa-miR-34a-3p | liver cancer | downregulation | "However the correlation between miR-34a expression ......" | 23862748 | qPCR |
| hsa-miR-34a-3p | liver cancer | downregulation | "Previous studies have identified miR-34 family as ......" | 24704024 | Reverse transcription PCR |
| hsa-miR-34a-3p | lung cancer | downregulation | "miR-34a was identified as one of the downregulated ......" | 23036084 | |
| hsa-miR-34a-3p | lung cancer | downregulation | "The miR-34 family consists of tumor-suppressive mi ......" | 23805317 | |
| hsa-miR-34a-3p | lung squamous cell cancer | downregulation | "miR 34a as a prognostic marker of relapse in surgi ......" | 19736307 | Reverse transcription PCR |
| hsa-miR-34a-3p | lung squamous cell cancer | downregulation | "miR-34a and miR-15a/16 are functionally related; t ......" | 21575235 | qPCR |
| hsa-miR-34a-3p | lung squamous cell cancer | downregulation | "The miR-34 family is comprised of tumor-suppressiv ......" | 22047961 | |
| hsa-miR-34a-3p | lymphoma | deregulation | "We found miR-34a miR-146a and miR-193b to be up-re ......" | 25862860 | |
| hsa-miR-34a-3p | melanoma | downregulation | "Subsequently melanoma cell proliferation and migra ......" | 19029026 | |
| hsa-miR-34a-3p | melanoma | deregulation | "We determined the expression level of 16 potential ......" | 19830692 | qPCR |
| hsa-miR-34a-3p | melanoma | upregulation | "Microarray analysis was performed to measure miRNA ......" | 25982144 | Microarray; qPCR |
| hsa-miR-34a-3p | ovarian cancer | downregulation | "miR-34a expression was determined by quantitative ......" | 25895459 | qPCR |
| hsa-miR-34a-3p | prostate cancer | downregulation | "Multiple tumor-suppressive miRNAs were downregulat ......" | 22719071 | |
| hsa-miR-34a-3p | prostate cancer | downregulation | "Previous studies from our laboratory have shown th ......" | 23145211 | |
| hsa-miR-34a-3p | prostate cancer | downregulation | "Using novel high throughput technologies we identi ......" | 23573364 | |
| hsa-miR-34a-3p | prostate cancer | downregulation | "An analysis of miR-34a expression levels in matche ......" | 25587085 | |
| hsa-miR-34a-3p | prostate cancer | downregulation | "miR-34a is downregulated and a regulator of drug r ......" | 26499184 | |
| hsa-miR-34a-3p | sarcoma | upregulation | "miRNA expression was investigated in 49 primary EW ......" | 21960059 | qPCR; Microarray; in situ hybridization |
| hsa-miR-34a-3p | sarcoma | upregulation | "High expression of miR-34a in localized tumors was ......" | 25015333 | |
| hsa-miR-34a-3p | thyroid cancer | upregulation | "MiR-34a is best known as a tumor suppressor throug ......" | 24220341 |
Reported cancer pathway affected by hsa-miR-34a-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-34a-3p | acute myeloid leukemia | cell cycle pathway; Apoptosis pathway | "Profiling microRNA miRNA expression delineated TP5 ......" | 22810507 | |
| hsa-miR-34a-3p | acute myeloid leukemia | Apoptosis pathway | "Tumor suppressor miR 34a targets PD L1 and functio ......" | 25499621 | Luciferase |
| hsa-miR-34a-3p | bladder cancer | cell cycle pathway | "MiR 34a chemosensitizes bladder cancer cells to ci ......" | 21702042 | |
| hsa-miR-34a-3p | bladder cancer | cell cycle pathway; Apoptosis pathway | "Expression and role of miR 34a in bladder cancer; ......" | 23720881 | Flow cytometry |
| hsa-miR-34a-3p | bladder cancer | Epithelial mesenchymal transition pathway | "MicroRNA 34a functions as an anti metastatic micro ......" | 25551284 | Transwell assay; Luciferase |
| hsa-miR-34a-3p | bladder cancer | Apoptosis pathway | "miRNAs and their validated miRNA targets appear as ......" | 25572695 | Western blot |
| hsa-miR-34a-3p | breast cancer | Apoptosis pathway | "MiR 34a inhibits proliferation and migration of br ......" | 22623155 | Western blot |
| hsa-miR-34a-3p | breast cancer | cell cycle pathway; Apoptosis pathway | "Downregulation of miR 34a in breast tumors is not ......" | 23292869 | |
| hsa-miR-34a-3p | breast cancer | PI3K/Akt signaling pathway | "MicroRNA 34a suppresses cell proliferation by targ ......" | 24050776 | Luciferase |
| hsa-miR-34a-3p | breast cancer | Apoptosis pathway | "Hyaluronic acid chitosan nanoparticles for co deli ......" | 24565525 | |
| hsa-miR-34a-3p | breast cancer | Apoptosis pathway | "To address this problem a miRNA-delivering nanocap ......" | 25044638 | |
| hsa-miR-34a-3p | breast cancer | cell cycle pathway | "Effects on potential targets were analyzed with qP ......" | 25064703 | Western blot |
| hsa-miR-34a-3p | breast cancer | Apoptosis pathway | "miR 34a may regulate sensitivity of breast cancer ......" | 25623761 | Western blot |
| hsa-miR-34a-3p | breast cancer | cell cycle pathway | "Phytochemical regulation of the tumor suppressive ......" | 25789847 | Flow cytometry; Western blot; Luciferase |
| hsa-miR-34a-3p | breast cancer | Epithelial mesenchymal transition pathway | "Tumor suppressive microRNA 34a inhibits breast can ......" | 26678891 | |
| hsa-miR-34a-3p | breast cancer | Apoptosis pathway | "Conversely kallistatin stimulated expression of th ......" | 26790955 | |
| hsa-miR-34a-3p | breast cancer | Apoptosis pathway | "A novel miR 34a target protein kinase D1 stimulate ......" | 26895471 | |
| hsa-miR-34a-3p | cervical and endocervical cancer | Notch signaling pathway | "MicroRNA 34a suppresses invasion through downregul ......" | 20351093 | Western blot; RNAi |
| hsa-miR-34a-3p | cervical and endocervical cancer | Apoptosis pathway | "MicroRNAs as biomarkers of cervical cancer develop ......" | 24402874 | |
| hsa-miR-34a-3p | cervical and endocervical cancer | Apoptosis pathway | "The effects of lanthanum chloride on proliferation ......" | 26209160 | |
| hsa-miR-34a-3p | cervical and endocervical cancer | cell cycle pathway; Apoptosis pathway | "miR-34 family members can form a p53-miR-34 positi ......" | 26619844 | |
| hsa-miR-34a-3p | cervical and endocervical cancer | cell cycle pathway; Apoptosis pathway; Epithelial mesenchymal transition pathway | "microRNA 34a Upregulated Retinoic Acid Inducible G ......" | 26910120 | |
| hsa-miR-34a-3p | cervical and endocervical cancer | p53 signaling pathway | "HPV E6/p53 mediated down regulation of miR 34a inh ......" | 27186405 | Colony formation |
| hsa-miR-34a-3p | chordoma | Apoptosis pathway | "MicroRNA 608 and microRNA 34a regulate chordoma ma ......" | 24621885 | |
| hsa-miR-34a-3p | colon cancer | Apoptosis pathway | "For instance miR-34a up-regulation corresponded wi ......" | 20433755 | |
| hsa-miR-34a-3p | colorectal cancer | Apoptosis pathway | "The miR-34 family members described as potential t ......" | 23183747 | |
| hsa-miR-34a-3p | colorectal cancer | Wnt signaling pathway | "p53 regulates nuclear GSK 3 levels through miR 34 ......" | 23624843 | |
| hsa-miR-34a-3p | colorectal cancer | Notch signaling pathway | "miR 34a sets the "sweet spot" for notch in colorec ......" | 23642356 | |
| hsa-miR-34a-3p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "The microRNA miR-34 family is a direct transcripti ......" | 24337371 | |
| hsa-miR-34a-3p | colorectal cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 34a targets FMNL2 and E2F5 and suppresses ......" | 26103003 | |
| hsa-miR-34a-3p | endometrial cancer | cell cycle pathway | "The Significance of miR 34a Expression in Endometr ......" | 26734589 | |
| hsa-miR-34a-3p | esophageal cancer | cell cycle pathway; Apoptosis pathway | "Inactivation of miR 34a by aberrant CpG methylatio ......" | 24528540 | |
| hsa-miR-34a-3p | esophageal cancer | Apoptosis pathway | "miR 34a inhibits the migration and invasion of eso ......" | 25954903 | Western blot |
| hsa-miR-34a-3p | esophageal cancer | Apoptosis pathway | "Clinical significance of microRNA 34a in esophagea ......" | 26782413 | |
| hsa-miR-34a-3p | gastric cancer | cell cycle pathway; Apoptosis pathway | "Restoration of tumor suppressor miR 34 inhibits hu ......" | 18803879 | Western blot |
| hsa-miR-34a-3p | gastric cancer | Apoptosis pathway | "In order to identify miRNA signatures for gastric ......" | 22112324 | |
| hsa-miR-34a-3p | gastric cancer | Apoptosis pathway | "We aimed to investigate the expression of microRNA ......" | 23264087 | MTT assay; Flow cytometry; Western blot |
| hsa-miR-34a-3p | gastric cancer | Apoptosis pathway | "miR 34a regulates cisplatin induce gastric cancer ......" | 24068565 | Western blot; Flow cytometry |
| hsa-miR-34a-3p | gastric cancer | Apoptosis pathway | "Luteolin Induces Apoptosis by Up regulating miR 34 ......" | 24988056 | |
| hsa-miR-34a-3p | gastric cancer | Apoptosis pathway | "Sirt7 promotes gastric cancer growth and inhibits ......" | 25860861 | Colony formation |
| hsa-miR-34a-3p | gastric cancer | Apoptosis pathway | "miR 335 directly while miR 34a indirectly modulate ......" | 26318298 | Flow cytometry; Transwell assay |
| hsa-miR-34a-3p | gastric cancer | cell cycle pathway; Apoptosis pathway; Notch signaling pathway | "An integrated approach of predicted miR 34a target ......" | 26622549 | |
| hsa-miR-34a-3p | gastric cancer | Apoptosis pathway | "Upregulation of microRNA 34a enhances the DDP sens ......" | 27513895 | |
| hsa-miR-34a-3p | glioblastoma | cell cycle pathway | "MicroRNA 34a inhibits glioblastoma growth by targe ......" | 19773441 | |
| hsa-miR-34a-3p | glioblastoma | Apoptosis pathway | "MicroRNA 34a targets notch1 and inhibits cell prol ......" | 21743299 | Colony formation |
| hsa-miR-34a-3p | glioblastoma | cell cycle pathway | "miR 34a functions as a tumor suppressor modulating ......" | 22580610 | |
| hsa-miR-34a-3p | glioblastoma | cell cycle pathway; Apoptosis pathway | "We focused on miR-34a which is known for its key r ......" | 27569663 | |
| hsa-miR-34a-3p | head and neck cancer | Epithelial mesenchymal transition pathway | "MicroRNA 34a regulates epithelial mesenchymal tran ......" | 26323460 | Flow cytometry |
| hsa-miR-34a-3p | kidney renal cell cancer | cell cycle pathway; Apoptosis pathway | "Members of the miR-34 family have been shown to be ......" | 24503183 | Luciferase |
| hsa-miR-34a-3p | liver cancer | Apoptosis pathway | "miR 34a inhibits migration and invasion by down re ......" | 19006648 | |
| hsa-miR-34a-3p | liver cancer | cell cycle pathway; p53 signaling pathway | "The impact of miR 34a on protein output in hepatoc ......" | 20186752 | |
| hsa-miR-34a-3p | liver cancer | cell cycle pathway; Apoptosis pathway | "The miR-34 family members are direct transcription ......" | 20309940 | |
| hsa-miR-34a-3p | liver cancer | Apoptosis pathway | "Underexpression of miR 34a in hepatocellular carci ......" | 23593387 | |
| hsa-miR-34a-3p | liver cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA 34a targets Bcl 2 and sensitizes human he ......" | 23862748 | Luciferase; Western blot |
| hsa-miR-34a-3p | liver cancer | Apoptosis pathway | "Carboxymethyl Dextran Stabilized Polyethylenimine ......" | 27300477 | |
| hsa-miR-34a-3p | lung cancer | Apoptosis pathway | "MicroRNA 34a is an important component of PRIMA 1 ......" | 19921694 | Flow cytometry |
| hsa-miR-34a-3p | lung cancer | cell cycle pathway | "microRNA 34a sensitizes lung cancer cell lines to ......" | 23036084 | |
| hsa-miR-34a-3p | lung cancer | Apoptosis pathway | "MicroRNA 34a overcomes HGF mediated gefitinib resi ......" | 24983493 | |
| hsa-miR-34a-3p | lung cancer | Apoptosis pathway | "Downregulation of PEBP4 a target of miR 34a sensit ......" | 25038915 | Western blot; MTT assay; Flow cytometry; Luciferase |
| hsa-miR-34a-3p | lung cancer | Apoptosis pathway | "Negative feedback regulation of AXL by miR 34a mod ......" | 26667302 | |
| hsa-miR-34a-3p | lung squamous cell cancer | cell cycle pathway; Apoptosis pathway | "miR 34a and miR 15a/16 are co regulated in non sma ......" | 21575235 | Flow cytometry; RNAi |
| hsa-miR-34a-3p | lung squamous cell cancer | Apoptosis pathway | "Delta tocotrienol suppresses Notch 1 pathway by up ......" | 22438124 | |
| hsa-miR-34a-3p | lung squamous cell cancer | cell cycle pathway; Apoptosis pathway | "The miR-34 family under-expressed in-non small cel ......" | 22593438 | Flow cytometry |
| hsa-miR-34a-3p | lung squamous cell cancer | Apoptosis pathway | "Ectopic expression of miR 34a enhances radiosensit ......" | 23349340 | |
| hsa-miR-34a-3p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "Rhamnetin and cirsiliol induce radiosensitization ......" | 23902763 | |
| hsa-miR-34a-3p | lung squamous cell cancer | Apoptosis pathway | "MicroRNA 34a inhibits the proliferation and promot ......" | 25501507 | Luciferase; Western blot |
| hsa-miR-34a-3p | melanoma | cell cycle pathway | "MicroRNA 34a inhibits uveal melanoma cell prolifer ......" | 19029026 | Cell migration assay; Luciferase; Western blot |
| hsa-miR-34a-3p | melanoma | cell cycle pathway | "The authors' previous studies on miR-34a showed th ......" | 21051724 | Flow cytometry; Cell Proliferation Assay; Western blot |
| hsa-miR-34a-3p | ovarian cancer | Apoptosis pathway | "Frequent downregulation of miR 34 family in human ......" | 20145172 | |
| hsa-miR-34a-3p | ovarian cancer | cell cycle pathway | "To investigate the effects of miR-449 and miR-34 o ......" | 21321636 | Western blot |
| hsa-miR-34a-3p | ovarian cancer | cell cycle pathway | "The effect of miR-449 and miR-34 on the growth cel ......" | 26770455 | Flow cytometry; Cell Proliferation Assay |
| hsa-miR-34a-3p | ovarian cancer | cell cycle pathway; Apoptosis pathway | "Expression and promotor hypermethylation of miR 34 ......" | 26879132 | |
| hsa-miR-34a-3p | pancreatic cancer | cell cycle pathway; Apoptosis pathway | "MicroRNA miR 34 inhibits human pancreatic cancer t ......" | 19714243 | |
| hsa-miR-34a-3p | pancreatic cancer | cell cycle pathway; Apoptosis pathway | "Targeting epigenetic regulation of miR 34a for tre ......" | 21909380 | |
| hsa-miR-34a-3p | pancreatic cancer | Apoptosis pathway | "Genistein inhibits cell growth and induces apoptos ......" | 23140286 | |
| hsa-miR-34a-3p | pancreatic cancer | MAPK signaling pathway | "In our previous studies we identified four microRN ......" | 27380024 | |
| hsa-miR-34a-3p | prostate cancer | Apoptosis pathway | "Using qPCR we showed that the level of miR-34a inc ......" | 18497571 | |
| hsa-miR-34a-3p | prostate cancer | cell cycle pathway; Apoptosis pathway | "Effects of miR 34a on cell growth and chemoresista ......" | 18834855 | |
| hsa-miR-34a-3p | prostate cancer | Apoptosis pathway | "MicroRNA 34a modulates c Myc transcriptional compl ......" | 22235332 | Luciferase |
| hsa-miR-34a-3p | prostate cancer | cell cycle pathway | "In this study we used quantitative real-time-PCR t ......" | 22719071 | |
| hsa-miR-34a-3p | prostate cancer | Wnt signaling pathway; Ras signaling pathway | "MicroRNA 34a regulates WNT/TCF7 signaling and inhi ......" | 25436980 | |
| hsa-miR-34a-3p | prostate cancer | Epithelial mesenchymal transition pathway | "LEF1 Targeting EMT in Prostate Cancer Invasion Is ......" | 25587085 | Luciferase |
| hsa-miR-34a-3p | prostate cancer | Apoptosis pathway | "Here we report that chitosan nanoparticle-mediated ......" | 26313360 | |
| hsa-miR-34a-3p | prostate cancer | Apoptosis pathway | "Methylation induced silencing of miR 34a enhances ......" | 26499184 | |
| hsa-miR-34a-3p | prostate cancer | cell cycle pathway | "miR 34a inhibits cell proliferation in prostate ca ......" | 26722316 | Western blot; Flow cytometry |
| hsa-miR-34a-3p | prostate cancer | Apoptosis pathway | "Nevertheless decreased expressions of tumor suppre ......" | 26843836 | |
| hsa-miR-34a-3p | retinoblastoma | cell cycle pathway | "To investigate differential expression of microRNA ......" | 21941147 | |
| hsa-miR-34a-3p | sarcoma | cell cycle pathway; Apoptosis pathway | "Frequent concomitant inactivation of miR 34a and m ......" | 21225432 | |
| hsa-miR-34a-3p | sarcoma | Notch signaling pathway | "MicroRNA 34a inhibits the proliferation and metast ......" | 22457788 | |
| hsa-miR-34a-3p | sarcoma | Apoptosis pathway | "MicroRNA 199a 3p and microRNA 34a regulate apoptos ......" | 24957404 | |
| hsa-miR-34a-3p | sarcoma | cell cycle pathway | "p53 dependent activation of microRNA 34a in respon ......" | 25490093 | |
| hsa-miR-34a-3p | sarcoma | cell cycle pathway; Apoptosis pathway | "Genetically engineered pre microRNA 34a prodrug su ......" | 27216562 | |
| hsa-miR-34a-3p | sarcoma | cell cycle pathway; Apoptosis pathway | "MiR 34a and miR 203 Inhibit Survivin Expression to ......" | 27326248 | Colony formation |
| hsa-miR-34a-3p | thyroid cancer | Apoptosis pathway | "MiR 34a targets GAS1 to promote cell proliferation ......" | 24220341 | Colony formation |
Reported cancer prognosis affected by hsa-miR-34a-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-34a-3p | B cell lymphoma | poor survival | "Finally eight miRNAs were found to correlate with ......" | 18537969 | |
| hsa-miR-34a-3p | B cell lymphoma | malignant trasformation | "Myc mediated repression of microRNA 34a promotes h ......" | 21460242 | |
| hsa-miR-34a-3p | B cell lymphoma | malignant trasformation | "In this review we discuss miRNAs with essential fu ......" | 25541152 | |
| hsa-miR-34a-3p | B cell lymphoma | drug resistance; poor survival; differentiation | "High miR 34a expression improves response to doxor ......" | 26854484 | |
| hsa-miR-34a-3p | acute myeloid leukemia | progression; drug resistance; poor survival | "Profiling microRNA miRNA expression delineated TP5 ......" | 22810507 | |
| hsa-miR-34a-3p | acute myeloid leukemia | tumorigenesis | "Tumor suppressor miR 34a targets PD L1 and functio ......" | 25499621 | Luciferase |
| hsa-miR-34a-3p | bladder cancer | poor survival | "MiR 34a chemosensitizes bladder cancer cells to ci ......" | 21702042 | |
| hsa-miR-34a-3p | bladder cancer | tumor size | "Expression and role of miR 34a in bladder cancer; ......" | 23720881 | Flow cytometry |
| hsa-miR-34a-3p | bladder cancer | worse prognosis | "miR 34 is associated with poor prognosis of patien ......" | 24078448 | |
| hsa-miR-34a-3p | bladder cancer | tumorigenesis | "Cisplatin induced epigenetic activation of miR 34a ......" | 24423412 | |
| hsa-miR-34a-3p | bladder cancer | cell migration; metastasis | "MicroRNA 34a functions as an anti metastatic micro ......" | 25551284 | Transwell assay; Luciferase |
| hsa-miR-34a-3p | bladder cancer | recurrence | "Expression of tumor suppressive microRNA 34a is as ......" | 25556547 | Colony formation |
| hsa-miR-34a-3p | bladder cancer | drug resistance | "Focusing on the major obstacle regarding MIBC pati ......" | 27586262 | |
| hsa-miR-34a-3p | breast cancer | drug resistance; poor survival | "The mir 34 microRNA is required for the DNA damage ......" | 19421141 | |
| hsa-miR-34a-3p | breast cancer | metastasis; staging | "The relative concentrations of breast cancer-assoc ......" | 21047409 | |
| hsa-miR-34a-3p | breast cancer | drug resistance | "MiRNA microarray analysis identified 299 and 226 m ......" | 21399894 | Luciferase |
| hsa-miR-34a-3p | breast cancer | metastasis; recurrence; poor survival | "MiR 34a expression has an effect for lower risk of ......" | 22102859 | |
| hsa-miR-34a-3p | breast cancer | malignant trasformation | "MiR 34a inhibits proliferation and migration of br ......" | 22623155 | Western blot |
| hsa-miR-34a-3p | breast cancer | metastasis | "Here we describe the regulation and function of mi ......" | 23001043 | |
| hsa-miR-34a-3p | breast cancer | drug resistance | "MicroRNA 34a modulates chemosensitivity of breast ......" | 23085450 | Western blot; Flow cytometry; MTT assay; Luciferase |
| hsa-miR-34a-3p | breast cancer | metastasis; tumorigenesis | "Downregulation of miR 34a in breast tumors is not ......" | 23292869 | |
| hsa-miR-34a-3p | breast cancer | progression | "Deregulated serum concentrations of circulating ce ......" | 23748853 | |
| hsa-miR-34a-3p | breast cancer | poor survival | "Synergistic effects of curcumin with emodin agains ......" | 23771315 | Flow cytometry; Cell migration assay; MTT assay |
| hsa-miR-34a-3p | breast cancer | drug resistance; cell migration | "Hyaluronic acid chitosan nanoparticles for co deli ......" | 24565525 | |
| hsa-miR-34a-3p | breast cancer | drug resistance | "Neoadjuvant Chemotherapy in Breast Cancer Patients ......" | 25078559 | |
| hsa-miR-34a-3p | breast cancer | drug resistance | "We used RNAi-mediated p53 knockdown KD and antagom ......" | 25123132 | RNAi |
| hsa-miR-34a-3p | breast cancer | drug resistance; poor survival | "MiR 34a regulates therapy resistance by targeting ......" | 25173798 | |
| hsa-miR-34a-3p | breast cancer | metastasis | "Diallyl disulfide suppresses SRC/Ras/ERK signaling ......" | 25396727 | |
| hsa-miR-34a-3p | breast cancer | drug resistance | "MTT-cytotoxic miRNA microarray Real-time quantitat ......" | 25562151 | Western blot; Luciferase |
| hsa-miR-34a-3p | breast cancer | cell migration | "PEGylated thymoquinone nanoparticle mediated retar ......" | 25771001 | |
| hsa-miR-34a-3p | breast cancer | staging; metastasis | "MicroRNA 34a suppresses the breast cancer stem cel ......" | 25783790 | |
| hsa-miR-34a-3p | breast cancer | drug resistance; poor survival | "Phytochemical regulation of the tumor suppressive ......" | 25789847 | Flow cytometry; Western blot; Luciferase |
| hsa-miR-34a-3p | breast cancer | malignant trasformation | "Dysregulation of the miR 34a SIRT1 axis inhibits b ......" | 25826085 | |
| hsa-miR-34a-3p | breast cancer | metastasis | "Using real-time quantitative polymerase chain reac ......" | 26124926 | |
| hsa-miR-34a-3p | breast cancer | drug resistance | "New miRNA-based drugs are also promising therapy f ......" | 26199650 | |
| hsa-miR-34a-3p | breast cancer | drug resistance | "Furthermore several studies have documented that s ......" | 26310899 | |
| hsa-miR-34a-3p | breast cancer | cell migration; metastasis; staging; progression | "Tumor suppressive microRNA 34a inhibits breast can ......" | 26678891 | |
| hsa-miR-34a-3p | breast cancer | progression | "Conversely kallistatin stimulated expression of th ......" | 26790955 | |
| hsa-miR-34a-3p | breast cancer | drug resistance | "A novel miR 34a target protein kinase D1 stimulate ......" | 26895471 | |
| hsa-miR-34a-3p | breast cancer | metastasis; poor survival | "The miR 34a LDHA axis regulates glucose metabolism ......" | 26902416 | Luciferase |
| hsa-miR-34a-3p | breast cancer | progression | "MiR 34a Inhibits Breast Cancer Proliferation and P ......" | 27524218 | Luciferase; Western blot; MTT assay; Transwell assay; Wound Healing Assay |
| hsa-miR-34a-3p | breast cancer | worse prognosis; drug resistance | "The aim of this study was to investigate the role ......" | 27746365 | |
| hsa-miR-34a-3p | cervical and endocervical cancer | drug resistance | "MicroRNA 34a suppresses invasion through downregul ......" | 20351093 | Western blot; RNAi |
| hsa-miR-34a-3p | cervical and endocervical cancer | immune resistance; tumorigenesis | "MicroRNAs as biomarkers of cervical cancer develop ......" | 24402874 | |
| hsa-miR-34a-3p | cervical and endocervical cancer | tumorigenesis | "MiR 34a Inhibits Viability and Invasion of Human P ......" | 25675046 | |
| hsa-miR-34a-3p | cervical and endocervical cancer | progression | "HPV E6/p53 mediated down regulation of miR 34a inh ......" | 27186405 | Colony formation |
| hsa-miR-34a-3p | colon cancer | drug resistance | "Dysregulation of microRNA 34a expression causes dr ......" | 21067862 | |
| hsa-miR-34a-3p | colon cancer | cell migration | "MicroRNA 34a inhibits migration and invasion of co ......" | 22198213 | |
| hsa-miR-34a-3p | colon cancer | metastasis | "Expression of miR 34 is lost in colon cancer which ......" | 22992310 | |
| hsa-miR-34a-3p | colon cancer | metastasis | "Detection of miR 34a promoter methylation in combi ......" | 23243217 | |
| hsa-miR-34a-3p | colon cancer | staging; differentiation; drug resistance | "A microRNA miR 34a regulated bimodal switch target ......" | 23642368 | |
| hsa-miR-34a-3p | colon cancer | drug resistance | "Inhibition of lactate dehydrogenase A by microRNA ......" | 25333573 | |
| hsa-miR-34a-3p | colon cancer | staging; tumorigenesis; progression | "The microRNA-34 family miR-34a -34b and -34c have ......" | 25894979 | |
| hsa-miR-34a-3p | colon cancer | metastasis | "MiR 34a inhibits colon cancer proliferation and me ......" | 26324236 | Luciferase; Western blot |
| hsa-miR-34a-3p | colon cancer | staging | "A miR 34a Numb Feedforward Loop Triggered by Infla ......" | 26849305 | |
| hsa-miR-34a-3p | colon cancer | staging | "A long non coding RNA targets microRNA miR 34a to ......" | 27077950 | |
| hsa-miR-34a-3p | colorectal cancer | staging; progression | "The quantitative analysis by stem loop real time P ......" | 22562822 | |
| hsa-miR-34a-3p | colorectal cancer | recurrence; staging; metastasis; differentiation | "Association between miR 34a expression and recurre ......" | 23355243 | |
| hsa-miR-34a-3p | colorectal cancer | staging | "Genome-wide microarray analysis of miRNA expressio ......" | 23673725 | |
| hsa-miR-34a-3p | colorectal cancer | metastasis | "Detection of miR 34a and miR 34b/c in stool sample ......" | 24573638 | |
| hsa-miR-34a-3p | colorectal cancer | metastasis; progression | "Members of the miR-34 family are induced by the tu ......" | 24642471 | |
| hsa-miR-34a-3p | colorectal cancer | staging; metastasis; recurrence | "miR 34a 5p suppresses colorectal cancer metastasis ......" | 25362853 | |
| hsa-miR-34a-3p | colorectal cancer | progression; staging | "Circulating miRNAs miR 34a and miR 150 associated ......" | 25924769 | |
| hsa-miR-34a-3p | colorectal cancer | progression; metastasis | "MicroRNA 34a targets FMNL2 and E2F5 and suppresses ......" | 26103003 | |
| hsa-miR-34a-3p | colorectal cancer | drug resistance; metastasis | "For example overexpressing miR-34a a master regula ......" | 26518892 | |
| hsa-miR-34a-3p | colorectal cancer | staging; worse prognosis | "Serological under expression of microRNA 21 microR ......" | 27142899 | |
| hsa-miR-34a-3p | colorectal cancer | drug resistance; metastasis | "Downregulation of HMGB1 by miR 34a is sufficient t ......" | 27456356 | Luciferase |
| hsa-miR-34a-3p | endometrial cancer | cell migration | "Role of miR 34a as a suppressor of L1CAM in endome ......" | 24497324 | Luciferase |
| hsa-miR-34a-3p | endometrial cancer | tumorigenesis | "The Significance of miR 34a Expression in Endometr ......" | 26734589 | |
| hsa-miR-34a-3p | esophageal cancer | tumorigenesis; progression | "Transcriptional activation of microRNA 34a by NF k ......" | 22292433 | |
| hsa-miR-34a-3p | esophageal cancer | staging; metastasis; worse prognosis | "Inactivation of miR 34a by aberrant CpG methylatio ......" | 24528540 | |
| hsa-miR-34a-3p | esophageal cancer | metastasis | "miR 34a inhibits the migration and invasion of eso ......" | 25954903 | Western blot |
| hsa-miR-34a-3p | esophageal cancer | staging; differentiation; poor survival; progression; worse prognosis | "Clinical significance of microRNA 34a in esophagea ......" | 26782413 | |
| hsa-miR-34a-3p | esophageal cancer | progression; poor survival | "miR 34a inhibits the in vitro cell proliferation a ......" | 26944831 | Flow cytometry; Cell migration assay |
| hsa-miR-34a-3p | gastric cancer | poor survival; differentiation | "Restoration of tumor suppressor miR 34 inhibits hu ......" | 18803879 | Western blot |
| hsa-miR-34a-3p | gastric cancer | drug resistance | "In order to identify miRNA signatures for gastric ......" | 22112324 | |
| hsa-miR-34a-3p | gastric cancer | metastasis | "We previously identified five miRNAs miR-1 miR-20a ......" | 24122958 | |
| hsa-miR-34a-3p | gastric cancer | metastasis; cell migration | "MicroRNA 34A inhibits the growth invasion and meta ......" | 24837198 | Luciferase |
| hsa-miR-34a-3p | gastric cancer | tumorigenesis | "Previous studies have demonstrated that miR-34 fam ......" | 25658980 | |
| hsa-miR-34a-3p | gastric cancer | poor survival | "Sirt7 promotes gastric cancer growth and inhibits ......" | 25860861 | Colony formation |
| hsa-miR-34a-3p | gastric cancer | poor survival; recurrence; worse prognosis; staging; differentiation | "The prognostic value of miR 34a expression in comp ......" | 25932212 | |
| hsa-miR-34a-3p | gastric cancer | poor survival; staging; metastasis | "miR 335 directly while miR 34a indirectly modulate ......" | 26318298 | Flow cytometry; Transwell assay |
| hsa-miR-34a-3p | gastric cancer | progression; tumorigenesis; worse prognosis; staging; metastasis | "Prognostic Significance of MiR 34a Expression in P ......" | 26415802 | |
| hsa-miR-34a-3p | gastric cancer | metastasis | "MicroRNA 34a inhibits tumor invasion and metastasi ......" | 26464633 | Western blot |
| hsa-miR-34a-3p | gastric cancer | progression | "An integrated approach of predicted miR 34a target ......" | 26622549 | |
| hsa-miR-34a-3p | gastric cancer | metastasis; poor survival | "Nanovesicle mediated systemic delivery of microRNA ......" | 27497057 | |
| hsa-miR-34a-3p | gastric cancer | drug resistance | "Upregulation of microRNA 34a enhances the DDP sens ......" | 27513895 | |
| hsa-miR-34a-3p | glioblastoma | progression; poor survival | "MicroRNA 34a inhibits glioblastoma growth by targe ......" | 19773441 | |
| hsa-miR-34a-3p | glioblastoma | poor survival | "miR 34a functions as a tumor suppressor modulating ......" | 22580610 | |
| hsa-miR-34a-3p | glioblastoma | poor survival | "microRNA regulatory network inference identifies m ......" | 22750848 | |
| hsa-miR-34a-3p | head and neck cancer | poor survival | "Dysregulation of microRNA 34a expression in head a ......" | 22629428 | Colony formation |
| hsa-miR-34a-3p | head and neck cancer | worse prognosis | "Conversely decreased expressions of miR-153 miR-20 ......" | 25677760 | |
| hsa-miR-34a-3p | head and neck cancer | metastasis | "MiR 34a suppresses amphiregulin and tumor metastat ......" | 25762634 | Luciferase |
| hsa-miR-34a-3p | kidney papillary renal cell cancer | staging; poor survival; progression | "In the training stage the expression levels of 12 ......" | 25906110 | |
| hsa-miR-34a-3p | kidney renal cell cancer | malignant trasformation | "MicroRNA 34a suppresses malignant transformation b ......" | 22159222 | Luciferase |
| hsa-miR-34a-3p | liver cancer | metastasis; cell migration | "miR 34a inhibits migration and invasion by down re ......" | 19006648 | |
| hsa-miR-34a-3p | liver cancer | metastasis | "Identification of metastasis related microRNAs of ......" | 19912688 | |
| hsa-miR-34a-3p | liver cancer | cell migration | "The impact of miR 34a on protein output in hepatoc ......" | 20186752 | |
| hsa-miR-34a-3p | liver cancer | recurrence | "Sequencing and bioinformatics based analyses of th ......" | 21283620 | |
| hsa-miR-34a-3p | liver cancer | metastasis | "TGF β miR 34a CCL22 signaling induced Treg cell r ......" | 22975373 | |
| hsa-miR-34a-3p | liver cancer | progression; tumorigenesis; staging; metastasis | "Underexpression of miR 34a in hepatocellular carci ......" | 23593387 | |
| hsa-miR-34a-3p | liver cancer | tumorigenesis | "Numerous studies have focused on the association b ......" | 23632240 | |
| hsa-miR-34a-3p | liver cancer | poor survival; drug resistance | "MicroRNA 34a targets Bcl 2 and sensitizes human he ......" | 23862748 | Luciferase; Western blot |
| hsa-miR-34a-3p | liver cancer | tumorigenesis | "Previous studies have focused on the association o ......" | 23935875 | |
| hsa-miR-34a-3p | liver cancer | tumorigenesis | "Previous studies have identified miR-34 family as ......" | 24704024 | |
| hsa-miR-34a-3p | liver cancer | recurrence; progression; staging; tumor size | "MicroRNA 34a expression is predictive of recurrenc ......" | 25596083 | |
| hsa-miR-34a-3p | liver cancer | staging | "miR 34a induces cellular senescence via modulation ......" | 25686834 | |
| hsa-miR-34a-3p | liver cancer | staging | "This study investigated the potential of serum mic ......" | 26352740 | |
| hsa-miR-34a-3p | lung cancer | immune resistance | "Here we describe the development of a therapeutic ......" | 20570894 | |
| hsa-miR-34a-3p | lung cancer | tumorigenesis; progression | "The microRNA-34 mir-34 gene family members are dow ......" | 22964582 | |
| hsa-miR-34a-3p | lung cancer | drug resistance | "MicroRNA 34a overcomes HGF mediated gefitinib resi ......" | 24983493 | |
| hsa-miR-34a-3p | lung cancer | poor survival; recurrence; staging; metastasis | "The expression of microRNA 34a is inversely correl ......" | 26104764 | |
| hsa-miR-34a-3p | lung cancer | drug resistance | "In Vivo Delivery of miR 34a Sensitizes Lung Tumors ......" | 26670277 | |
| hsa-miR-34a-3p | lung squamous cell cancer | drug resistance; poor survival; recurrence | "miR 34a as a prognostic marker of relapse in surgi ......" | 19736307 | |
| hsa-miR-34a-3p | lung squamous cell cancer | staging; recurrence | "Recently miR-34 family has been shown to be part o ......" | 21383543 | |
| hsa-miR-34a-3p | lung squamous cell cancer | progression | "miR 34a and miR 15a/16 are co regulated in non sma ......" | 21575235 | Flow cytometry; RNAi |
| hsa-miR-34a-3p | lung squamous cell cancer | malignant trasformation | "miR-34a is known as a p53 regulated tumor suppress ......" | 21731696 | |
| hsa-miR-34a-3p | lung squamous cell cancer | staging | "Circulating miR 22 miR 24 and miR 34a as novel pre ......" | 23794259 | |
| hsa-miR-34a-3p | lung squamous cell cancer | poor survival | "Tumor-suppressive miR-34a a direct target of p53 h ......" | 24444609 | |
| hsa-miR-34a-3p | lung squamous cell cancer | poor survival | "Systemic nanodelivery of miR-34 and let-7 suppress ......" | 25174400 | |
| hsa-miR-34a-3p | lung squamous cell cancer | tumor size; staging | "Here we analyzed expression of miR-15a/16 miR-21 m ......" | 25384507 | |
| hsa-miR-34a-3p | lung squamous cell cancer | drug resistance | "Combinatorial Action of MicroRNAs let 7 and miR 34 ......" | 25714397 | |
| hsa-miR-34a-3p | lung squamous cell cancer | metastasis; worse prognosis; tumorigenesis | "Combined Effect of Metastasis Related MicroRNA miR ......" | 27444357 | |
| hsa-miR-34a-3p | lymphoma | worse prognosis | "Expression profiling of 664 miRNAs was investigate ......" | 23640973 | |
| hsa-miR-34a-3p | melanoma | poor survival; recurrence | "We determined the expression level of 16 potential ......" | 19830692 | |
| hsa-miR-34a-3p | melanoma | tumorigenesis | "Analysis of the miR 34a locus in 62 patients with ......" | 22198089 | |
| hsa-miR-34a-3p | melanoma | drug resistance | "To improve uveal melanoma specificity of adenoviru ......" | 24001901 | Luciferase |
| hsa-miR-34a-3p | melanoma | malignant trasformation | "5 Aminolevulinic acid mediated sonodynamic therapy ......" | 25982144 | Western blot |
| hsa-miR-34a-3p | ovarian cancer | motility; staging; progression | "Frequent downregulation of miR 34 family in human ......" | 20145172 | |
| hsa-miR-34a-3p | ovarian cancer | staging | "The aim of this study was to investigate whether m ......" | 22340095 | Western blot |
| hsa-miR-34a-3p | ovarian cancer | motility; metastasis; cell migration | "MiR 34a suppresses ovarian cancer proliferation an ......" | 25895459 | MTT assay; Transwell assay |
| hsa-miR-34a-3p | ovarian cancer | poor survival | "MiR 137 and miR 34a directly target Snail and inhi ......" | 27596137 | Western blot; Luciferase |
| hsa-miR-34a-3p | pancreatic cancer | poor survival | "MicroRNA miR 34 inhibits human pancreatic cancer t ......" | 19714243 | |
| hsa-miR-34a-3p | pancreatic cancer | poor survival | "Two miRNA candidates known to be downregulated in ......" | 21622730 | |
| hsa-miR-34a-3p | pancreatic cancer | progression | "Targeting epigenetic regulation of miR 34a for tre ......" | 21909380 | |
| hsa-miR-34a-3p | pancreatic cancer | drug resistance | "Furthermore several studies have documented that s ......" | 25250326 | |
| hsa-miR-34a-3p | prostate cancer | drug resistance | "Effects of miR 34a on cell growth and chemoresista ......" | 18834855 | |
| hsa-miR-34a-3p | prostate cancer | drug resistance | "MiR 34a attenuates paclitaxel resistance of hormon ......" | 20687223 | Western blot; Luciferase |
| hsa-miR-34a-3p | prostate cancer | metastasis; poor survival | "The microRNA miR 34a inhibits prostate cancer stem ......" | 21240262 | |
| hsa-miR-34a-3p | prostate cancer | metastasis | "Next generation sequencing technology was applied ......" | 21980368 | |
| hsa-miR-34a-3p | prostate cancer | cell migration | "MicroRNA 34a modulates c Myc transcriptional compl ......" | 22235332 | Luciferase |
| hsa-miR-34a-3p | prostate cancer | motility | "miR 34 cooperates with p53 in suppression of prost ......" | 24630988 | |
| hsa-miR-34a-3p | prostate cancer | progression; drug resistance; staging | "miR 34a is an intracellular and exosomal predictiv ......" | 25053345 | |
| hsa-miR-34a-3p | prostate cancer | metastasis; poor survival | "MicroRNA 34a regulates WNT/TCF7 signaling and inhi ......" | 25436980 | |
| hsa-miR-34a-3p | prostate cancer | metastasis | "Registered report: the microRNA miR 34a inhibits p ......" | 26231042 | Luciferase |
| hsa-miR-34a-3p | prostate cancer | metastasis; progression | "Here we report that chitosan nanoparticle-mediated ......" | 26313360 | |
| hsa-miR-34a-3p | prostate cancer | drug resistance | "Methylation induced silencing of miR 34a enhances ......" | 26499184 | |
| hsa-miR-34a-3p | prostate cancer | drug resistance | "Nevertheless decreased expressions of tumor suppre ......" | 26843836 | |
| hsa-miR-34a-3p | prostate cancer | progression | "Therefore identification of miRNAs could reveal a ......" | 26942553 | |
| hsa-miR-34a-3p | sarcoma | poor survival; progression; worse prognosis; malignant trasformation | "miR 34a predicts survival of Ewing's sarcoma patie ......" | 21960059 | |
| hsa-miR-34a-3p | sarcoma | metastasis | "MicroRNA 34a inhibits the proliferation and metast ......" | 22457788 | |
| hsa-miR-34a-3p | sarcoma | metastasis; cell migration | "miR 34a inhibits the metastasis of osteosarcoma ce ......" | 23314380 | Western blot |
| hsa-miR-34a-3p | sarcoma | worse prognosis; poor survival; metastasis | "Prognostic significance of miR 34a in Ewing sarcom ......" | 25015333 | |
| hsa-miR-34a-3p | sarcoma | drug resistance | "The present study aimed to employ the miRNA respon ......" | 25335093 | Luciferase |
| hsa-miR-34a-3p | sarcoma | drug resistance; progression | "p53 dependent activation of microRNA 34a in respon ......" | 25490093 | |
| hsa-miR-34a-3p | sarcoma | differentiation | "In parallel we observed the modulation of several ......" | 26123714 | |
| hsa-miR-34a-3p | sarcoma | staging; progression | "Recent progress on systemic delivery as well as cu ......" | 26380245 | |
| hsa-miR-34a-3p | sarcoma | differentiation | "CD99 regulates neural differentiation of Ewing sar ......" | 26616853 | |
| hsa-miR-34a-3p | sarcoma | drug resistance | "MiR 34a 5p promotes the multi drug resistance of o ......" | 27056900 | |
| hsa-miR-34a-3p | sarcoma | malignant trasformation | "Genetically engineered pre microRNA 34a prodrug su ......" | 27216562 | |
| hsa-miR-34a-3p | sarcoma | poor survival | "MiR 34a and miR 203 Inhibit Survivin Expression to ......" | 27326248 | Colony formation |
| hsa-miR-34a-3p | thyroid cancer | tumorigenesis | "MiR 34a targets GAS1 to promote cell proliferation ......" | 24220341 | Colony formation |
Reported gene related to hsa-miR-34a-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-34a-3p | B cell lymphoma | TP53 | "Compared with p53 normal group the expression leve ......" | 23450486 |
| hsa-miR-34a-3p | acute myeloid leukemia | TP53 | "Profiling microRNA miRNA expression delineated TP5 ......" | 22810507 |
| hsa-miR-34a-3p | bladder cancer | TP53 | "For this purpose cell viability assay Realtime qua ......" | 25572695 |
| hsa-miR-34a-3p | bladder cancer | TP53 | "MiR 34a chemosensitizes bladder cancer cells to ci ......" | 21702042 |
| hsa-miR-34a-3p | breast cancer | TP53 | "As expected p53 loss caused downregulation of esta ......" | 25123132 |
| hsa-miR-34a-3p | breast cancer | TP53 | "Conversely kallistatin stimulated expression of th ......" | 26790955 |
| hsa-miR-34a-3p | breast cancer | TP53 | "In particular mammalian miR-34 is upregulated by p ......" | 19421141 |
| hsa-miR-34a-3p | breast cancer | TP53 | "Further studies indicated that PEG4000-TQ-Nps coul ......" | 25771001 |
| hsa-miR-34a-3p | breast cancer | TP53 | "Downregulation of miR 34a in breast tumors is not ......" | 23292869 |
| hsa-miR-34a-3p | breast cancer | TP53 | "Functional genomic analysis highlighted a novel re ......" | 22102859 |
| hsa-miR-34a-3p | breast cancer | TP53 | "Phytochemical regulation of the tumor suppressive ......" | 25789847 |
| hsa-miR-34a-3p | cervical and endocervical cancer | TP53 | "Knockdown of oncoprotein E6 expression of human pa ......" | 27186405 |
| hsa-miR-34a-3p | cervical and endocervical cancer | TP53 | "miR-34a is directly regulated by p53 and acts as t ......" | 24402874 |
| hsa-miR-34a-3p | colon cancer | TP53 | "MicroRNA-34a miR-34a a transcriptional target of p ......" | 22198213 |
| hsa-miR-34a-3p | colon cancer | TP53 | "The microRNA-34 family miR-34a -34b and -34c have ......" | 25894979 |
| hsa-miR-34a-3p | colorectal cancer | TP53 | "Members of the miR-34 family are induced by the tu ......" | 24642471 |
| hsa-miR-34a-3p | colorectal cancer | TP53 | "The microRNA miR-34 family is a direct transcripti ......" | 24337371 |
| hsa-miR-34a-3p | colorectal cancer | TP53 | "p53 regulates nuclear GSK 3 levels through miR 34 ......" | 23624843 |
| hsa-miR-34a-3p | esophageal cancer | TP53 | "Reporter assay further showed that NF-kappaB-induc ......" | 22292433 |
| hsa-miR-34a-3p | esophageal cancer | TP53 | "p53 status was not correlated with miR-34a ......" | 26944831 |
| hsa-miR-34a-3p | esophageal cancer | TP53 | "MiR-34a a direct p53 target gene possesses tumor-s ......" | 24528540 |
| hsa-miR-34a-3p | gastric cancer | TP53 | "Restoration of tumor suppressor miR 34 inhibits hu ......" | 18803879 |
| hsa-miR-34a-3p | gastric cancer | TP53 | "MicroRNA-34a miR-34a is a direct transcriptional t ......" | 25932212 |
| hsa-miR-34a-3p | glioblastoma | TP53 | "The high miR-34a expression level in the cells aft ......" | 23155233 |
| hsa-miR-34a-3p | glioblastoma | TP53 | "MicroRNA-34a miR-34a is a transcriptional target o ......" | 19773441 |
| hsa-miR-34a-3p | head and neck cancer | TP53 | "Among these we found well studied molecules such a ......" | 24209638 |
| hsa-miR-34a-3p | kidney renal cell cancer | TP53 | "Members of the miR-34 family have been shown to be ......" | 24503183 |
| hsa-miR-34a-3p | liver cancer | TP53 | "Accumulating evidence suggests that miR-34a as a k ......" | 20186752 |
| hsa-miR-34a-3p | liver cancer | TP53 | "Numerous studies have focused on the association b ......" | 23632240 |
| hsa-miR-34a-3p | liver cancer | TP53 | "The miR-34 family members are direct transcription ......" | 20309940 |
| hsa-miR-34a-3p | liver cancer | TP53 | "MiR-34a a direct target of p53 has been shown to t ......" | 23862748 |
| hsa-miR-34a-3p | lung cancer | TP53 | "microRNA 34a sensitizes lung cancer cell lines to ......" | 23036084 |
| hsa-miR-34a-3p | lung cancer | TP53 | "The above results suggest that microRNA-34a is one ......" | 19921694 |
| hsa-miR-34a-3p | lung cancer | TP53 | "In conclusion overexpression of PEBP4 reduced the ......" | 25038915 |
| hsa-miR-34a-3p | lung squamous cell cancer | TP53 | "Moreover re-expression of miR-34a by transfection ......" | 22438124 |
| hsa-miR-34a-3p | lung squamous cell cancer | TP53 | "Recently miR-34 family has been shown to be part o ......" | 21383543 |
| hsa-miR-34a-3p | lung squamous cell cancer | TP53 | "Tumor-suppressive miR-34a a direct target of p53 h ......" | 24444609 |
| hsa-miR-34a-3p | lung squamous cell cancer | TP53 | "miR-34a is known as a p53 regulated tumor suppress ......" | 21731696 |
| hsa-miR-34a-3p | lung squamous cell cancer | TP53 | "In addition in patients with sufficient tumor tiss ......" | 19736307 |
| hsa-miR-34a-3p | lung squamous cell cancer | TP53 | "The miR-34 family under-expressed in-non small cel ......" | 22593438 |
| hsa-miR-34a-3p | lung squamous cell cancer | TP53 | "miR-34a is transcriptionally induced by the tumor ......" | 23349340 |
| hsa-miR-34a-3p | melanoma | TP53 | "5 Aminolevulinic acid mediated sonodynamic therapy ......" | 25982144 |
| hsa-miR-34a-3p | melanoma | TP53 | "MicroRNA-34a miR-34a a potential key effector of t ......" | 19029026 |
| hsa-miR-34a-3p | ovarian cancer | TP53 | "Particularly miR-34a has been revealed to be a dir ......" | 26879132 |
| hsa-miR-34a-3p | ovarian cancer | TP53 | "The miR-34 family is directly transactivated by tu ......" | 25895459 |
| hsa-miR-34a-3p | ovarian cancer | TP53 | "The miR-34 family is directly transactivated by tu ......" | 20145172 |
| hsa-miR-34a-3p | ovarian cancer | TP53 | "To investigate the effects of miR-449 and miR-34 o ......" | 21321636 |
| hsa-miR-34a-3p | pancreatic cancer | TP53 | "Transcription of the three miRNA miR-34 family mem ......" | 19714243 |
| hsa-miR-34a-3p | pancreatic cancer | TP53 | "MicroRNA-34a miR-34a is a transcriptional target o ......" | 21909380 |
| hsa-miR-34a-3p | prostate cancer | TP53 | "Here we show through expression analysis that miR- ......" | 21240262 |
| hsa-miR-34a-3p | prostate cancer | TP53 | "miR 34 cooperates with p53 in suppression of prost ......" | 24630988 |
| hsa-miR-34a-3p | prostate cancer | TP53 | "It appears that AR-dependent inhibition of p53 res ......" | 18497571 |
| hsa-miR-34a-3p | prostate cancer | TP53 | "Tumor suppressor p53 transcriptionally regulates e ......" | 18834855 |
| hsa-miR-34a-3p | retinoblastoma | TP53 | "miR-34a expression could be increased in Y79 cells ......" | 19443717 |
| hsa-miR-34a-3p | sarcoma | TP53 | "Studies have demonstrated that miR-34a which is a ......" | 22457788 |
| hsa-miR-34a-3p | sarcoma | TP53 | "As a direct target gene of p53 miR-34a has been su ......" | 23569431 |
| hsa-miR-34a-3p | sarcoma | TP53 | "The results demonstrated that miR-199a and miR-34a ......" | 24957404 |
| hsa-miR-34a-3p | sarcoma | TP53 | "In this study we evaluated the cascade of events d ......" | 25490093 |
| hsa-miR-34a-3p | sarcoma | TP53 | "The microRNA encoding genes miR-34a and miR-34b/c ......" | 21225432 |
| hsa-miR-34a-3p | breast cancer | NOTCH1 | "In addition intracellular restoration of miR-34a i ......" | 24565525 |
| hsa-miR-34a-3p | breast cancer | NOTCH1 | "MicroRNA 34a suppresses the breast cancer stem cel ......" | 25783790 |
| hsa-miR-34a-3p | breast cancer | NOTCH1 | "We showed that miR-34a as a tumor suppressor could ......" | 27082152 |
| hsa-miR-34a-3p | breast cancer | NOTCH1 | "miR 34a may regulate sensitivity of breast cancer ......" | 25623761 |
| hsa-miR-34a-3p | breast cancer | NOTCH1 | "MicroRNA 34a modulates chemosensitivity of breast ......" | 23085450 |
| hsa-miR-34a-3p | cervical and endocervical cancer | NOTCH1 | "MicroRNA 34a suppresses invasion through downregul ......" | 20351093 |
| hsa-miR-34a-3p | colon cancer | NOTCH1 | "Mechanistically miR-34a sequesters Notch1 mRNA to ......" | 23642368 |
| hsa-miR-34a-3p | colon cancer | NOTCH1 | "The re-expression of miR-34 led to a marked reduct ......" | 22992310 |
| hsa-miR-34a-3p | glioblastoma | NOTCH1 | "MicroRNA 34a targets notch1 and inhibits cell prol ......" | 21743299 |
| hsa-miR-34a-3p | lung squamous cell cancer | NOTCH1 | "Delta tocotrienol suppresses Notch 1 pathway by up ......" | 22438124 |
| hsa-miR-34a-3p | lung squamous cell cancer | NOTCH1 | "Rhamnetin and cirsiliol induce radiosensitization ......" | 23902763 |
| hsa-miR-34a-3p | pancreatic cancer | NOTCH1 | "We found that Re-expression forced expression of m ......" | 23140286 |
| hsa-miR-34a-3p | prostate cancer | NOTCH1 | "Most importantly BR-DIM intervention in PCa patien ......" | 24349627 |
| hsa-miR-34a-3p | prostate cancer | NOTCH1 | "Most importantly BR-DIM intervention in PCa patien ......" | 22347519 |
| hsa-miR-34a-3p | prostate cancer | NOTCH1 | "Inactivation of AR and Notch 1 signaling by miR 34 ......" | 23145211 |
| hsa-miR-34a-3p | sarcoma | NOTCH1 | "We also found that reexpression of miR-34a and miR ......" | 23430952 |
| hsa-miR-34a-3p | breast cancer | BCL2 | "In vitro and in vivo experiments showed that miR ......" | 24565525 |
| hsa-miR-34a-3p | breast cancer | BCL2 | "MiR 34a inhibits proliferation and migration of br ......" | 22623155 |
| hsa-miR-34a-3p | breast cancer | BCL2 | "Quantitative PCR and western analysis confirmed de ......" | 21399894 |
| hsa-miR-34a-3p | colon cancer | BCL2 | "For instance miR-34a up-regulation corresponded wi ......" | 20433755 |
| hsa-miR-34a-3p | gastric cancer | BCL2 | "Target analysis indicated that micro RNA miR-34a d ......" | 24988056 |
| hsa-miR-34a-3p | gastric cancer | BCL2 | "miR-34 targets Notch HMGA2 and Bcl-2 genes involve ......" | 18803879 |
| hsa-miR-34a-3p | glioblastoma | BCL2 | "The miR-34a expression levels in cells after irrad ......" | 23155233 |
| hsa-miR-34a-3p | liver cancer | BCL2 | "MicroRNA 34a targets Bcl 2 and sensitizes human he ......" | 23862748 |
| hsa-miR-34a-3p | lung cancer | BCL2 | "Tumors harvested from these lungs have elevated le ......" | 22964582 |
| hsa-miR-34a-3p | lung squamous cell cancer | BCL2 | "Functional analyses further indicate that restorat ......" | 24444609 |
| hsa-miR-34a-3p | pancreatic cancer | BCL2 | "Among the target proteins regulated by miR-34 are ......" | 19714243 |
| hsa-miR-34a-3p | prostate cancer | BCL2 | "Thus in PC3PR cells reduced expression of miR-34a ......" | 20687223 |
| hsa-miR-34a-3p | prostate cancer | BCL2 | "Manipulating miR-34a in prostate cancer cells conf ......" | 25053345 |
| hsa-miR-34a-3p | breast cancer | SIRT1 | "MiR 34a inhibits proliferation and migration of br ......" | 22623155 |
| hsa-miR-34a-3p | breast cancer | SIRT1 | "Dysregulation of the miR 34a SIRT1 axis inhibits b ......" | 25826085 |
| hsa-miR-34a-3p | colon cancer | SIRT1 | "Sirt1 which is one of the target genes for miR-34a ......" | 21067862 |
| hsa-miR-34a-3p | colon cancer | SIRT1 | "Interestingly RES increased the intracellular expr ......" | 23954321 |
| hsa-miR-34a-3p | colorectal cancer | SIRT1 | "For example overexpressing miR-34a a master regula ......" | 26518892 |
| hsa-miR-34a-3p | melanoma | SIRT1 | "5 Aminolevulinic acid mediated sonodynamic therapy ......" | 25982144 |
| hsa-miR-34a-3p | prostate cancer | SIRT1 | "We aimed to elucidate the molecular mechanisms und ......" | 20687223 |
| hsa-miR-34a-3p | prostate cancer | SIRT1 | "miR 34a inhibits cell proliferation in prostate ca ......" | 26722316 |
| hsa-miR-34a-3p | prostate cancer | SIRT1 | "In addition the present micellar system facilitate ......" | 27126903 |
| hsa-miR-34a-3p | prostate cancer | SIRT1 | "In PC3 cell ectopic expression of miR-34a decrease ......" | 18834855 |
| hsa-miR-34a-3p | bladder cancer | CD44 | "The c-Myc and CD44 were confirmed as direct target ......" | 25572695 |
| hsa-miR-34a-3p | bladder cancer | CD44 | "Furthermore we identified CD44 as being targeted b ......" | 24423412 |
| hsa-miR-34a-3p | bladder cancer | CD44 | "MicroRNA 34a functions as an anti metastatic micro ......" | 25551284 |
| hsa-miR-34a-3p | breast cancer | CD44 | "Nanocomplex-assisted delivery of miR-34a induces c ......" | 25044638 |
| hsa-miR-34a-3p | gastric cancer | CD44 | "Nanovesicle mediated systemic delivery of microRNA ......" | 27497057 |
| hsa-miR-34a-3p | prostate cancer | CD44 | "The microRNA miR 34a inhibits prostate cancer stem ......" | 21240262 |
| hsa-miR-34a-3p | prostate cancer | CD44 | "Registered report: the microRNA miR 34a inhibits p ......" | 26231042 |
| hsa-miR-34a-3p | sarcoma | CD44 | "miR 34a inhibits the metastasis of osteosarcoma ce ......" | 23314380 |
| hsa-miR-34a-3p | colon cancer | MET | "Detection of miR 34a promoter methylation in combi ......" | 23243217 |
| hsa-miR-34a-3p | glioblastoma | MET | "miR-34a levels in human gliomas inversely correlat ......" | 19773441 |
| hsa-miR-34a-3p | liver cancer | MET | "Underexpression of miR 34a in hepatocellular carci ......" | 23593387 |
| hsa-miR-34a-3p | liver cancer | MET | "miR 34a inhibits migration and invasion by down re ......" | 19006648 |
| hsa-miR-34a-3p | lung cancer | MET | "The expression of microRNA 34a is inversely correl ......" | 26104764 |
| hsa-miR-34a-3p | melanoma | MET | "MicroRNA 34a inhibits uveal melanoma cell prolifer ......" | 19029026 |
| hsa-miR-34a-3p | sarcoma | MET | "c-Met is a target of miR-34a and regulates the mig ......" | 22457788 |
| hsa-miR-34a-3p | B cell lymphoma | MYC | "Myc mediated repression of microRNA 34a promotes h ......" | 21460242 |
| hsa-miR-34a-3p | bladder cancer | MYC | "The c-Myc and CD44 were confirmed as direct target ......" | 25572695 |
| hsa-miR-34a-3p | kidney renal cell cancer | MYC | "MicroRNA 34a suppresses malignant transformation b ......" | 22159222 |
| hsa-miR-34a-3p | liver cancer | MYC | "miR 34a induces cellular senescence via modulation ......" | 25686834 |
| hsa-miR-34a-3p | lymphoma | MYC | "Among them miR-34a was also associated with poor p ......" | 23640973 |
| hsa-miR-34a-3p | lymphoma | MYC | "We report that miR-34a did not inhibit cell prolif ......" | 22830357 |
| hsa-miR-34a-3p | prostate cancer | MYC | "MicroRNA 34a modulates c Myc transcriptional compl ......" | 22235332 |
| hsa-miR-34a-3p | prostate cancer | AR | "In this study we found loss of miR-34a which targe ......" | 24349627 |
| hsa-miR-34a-3p | prostate cancer | AR | "In this study we found loss of miR-34a which targe ......" | 22347519 |
| hsa-miR-34a-3p | prostate cancer | AR | "In particular analysis of clinical prostate cancer ......" | 21343391 |
| hsa-miR-34a-3p | prostate cancer | AR | "To explore further the possible role of miRNAs in ......" | 25920548 |
| hsa-miR-34a-3p | prostate cancer | AR | "Repression of miR-34a a known AR-targeting miRNA c ......" | 25797256 |
| hsa-miR-34a-3p | prostate cancer | AR | "Inactivation of AR and Notch 1 signaling by miR 34 ......" | 23145211 |
| hsa-miR-34a-3p | cervical and endocervical cancer | E2F3 | "MiR 34a Inhibits Viability and Invasion of Human P ......" | 25675046 |
| hsa-miR-34a-3p | colon cancer | E2F3 | "The ectopic expression of miR-34a in the 5-FU-resi ......" | 21067862 |
| hsa-miR-34a-3p | colon cancer | E2F3 | "Interestingly RES increased the intracellular expr ......" | 23954321 |
| hsa-miR-34a-3p | colorectal cancer | E2F3 | "For example overexpressing miR-34a a master regula ......" | 26518892 |
| hsa-miR-34a-3p | head and neck cancer | E2F3 | "miR-34a overexpression also markedly downregulated ......" | 22629428 |
| hsa-miR-34a-3p | chordoma | EGFR | "We find that miR-34a inversely correlates with MET ......" | 24621885 |
| hsa-miR-34a-3p | glioblastoma | EGFR | "miR 34a functions as a tumor suppressor modulating ......" | 22580610 |
| hsa-miR-34a-3p | lung cancer | EGFR | "MicroRNA 34a overcomes HGF mediated gefitinib resi ......" | 24983493 |
| hsa-miR-34a-3p | lung squamous cell cancer | EGFR | "This effect was observed over a wide range of miRN ......" | 25714397 |
| hsa-miR-34a-3p | breast cancer | PCNA | "High miR-34a expression associated with poor progn ......" | 22102859 |
| hsa-miR-34a-3p | glioblastoma | PCNA | "Forced expression of miR-34a in GBM cells decrease ......" | 22580610 |
| hsa-miR-34a-3p | liver cancer | PCNA | "This inhibition of proliferation was associated wi ......" | 25792709 |
| hsa-miR-34a-3p | lung cancer | PCNA | "The effect of simultaneous overexpression of miR-4 ......" | 25909221 |
| hsa-miR-34a-3p | colon cancer | SNAI1 | "Using a case-control study design of 94 primary co ......" | 23243217 |
| hsa-miR-34a-3p | colorectal cancer | SNAI1 | "EMT-TFs and microRNAs such as ZEB1/2 and miR-200 o ......" | 27573895 |
| hsa-miR-34a-3p | ovarian cancer | SNAI1 | "MiR 137 and miR 34a directly target Snail and inhi ......" | 27596137 |
| hsa-miR-34a-3p | pancreatic cancer | SNAI1 | "Metformin but not rapamycin reduced glucose and in ......" | 25576058 |
| hsa-miR-34a-3p | breast cancer | AXL | "We identified human miR-34a expression as being >3 ......" | 21814748 |
| hsa-miR-34a-3p | lung cancer | AXL | "Negative feedback regulation of AXL by miR 34a mod ......" | 26667302 |
| hsa-miR-34a-3p | ovarian cancer | AXL | "MiR 34a suppresses ovarian cancer proliferation an ......" | 25895459 |
| hsa-miR-34a-3p | bladder cancer | CASP3 | "The up-regulation of miR-34a in T24 cells contribu ......" | 23720881 |
| hsa-miR-34a-3p | gastric cancer | CASP3 | "The effects of miR-34 restoration were assessed by ......" | 18803879 |
| hsa-miR-34a-3p | retinoblastoma | CASP3 | "The tumor suppressor functions of miR-34a in RB ce ......" | 19443717 |
| hsa-miR-34a-3p | sarcoma | EWSR1 | "Functional analysis of miR-34a in EWS cell lines i ......" | 21960059 |
| hsa-miR-34a-3p | sarcoma | EWSR1 | "This study aimed to explore the role of miR-34A ex ......" | 25015333 |
| hsa-miR-34a-3p | sarcoma | EWSR1 | "CD99 counteracts EWS-FLI1 in controlling NF-κB si ......" | 26616853 |
| hsa-miR-34a-3p | breast cancer | LDHA | "The miR 34a LDHA axis regulates glucose metabolism ......" | 26902416 |
| hsa-miR-34a-3p | cervical and endocervical cancer | LDHA | "HPV E6/p53 mediated down regulation of miR 34a inh ......" | 27186405 |
| hsa-miR-34a-3p | colon cancer | LDHA | "Inhibition of lactate dehydrogenase A by microRNA ......" | 25333573 |
| hsa-miR-34a-3p | breast cancer | NPS | "To address these problems miR-34a a potent endogen ......" | 24565525 |
| hsa-miR-34a-3p | breast cancer | NPS | "Moreover NPs mediated miR-34a up-regulation direct ......" | 25771001 |
| hsa-miR-34a-3p | lung squamous cell cancer | NPS | "To explore new therapeutic options we successfully ......" | 26406332 |
| hsa-miR-34a-3p | gastric cancer | TIMM8A | "Upregulation of microRNA 34a enhances the DDP sens ......" | 27513895 |
| hsa-miR-34a-3p | gastric cancer | TIMM8A | "As shown by Western blot and flow cytometry in com ......" | 24068565 |
| hsa-miR-34a-3p | lung cancer | TIMM8A | "microRNA 34a sensitizes lung cancer cell lines to ......" | 23036084 |
| hsa-miR-34a-3p | breast cancer | AKR1B1 | "To explore the influence of miR-34a on Notch1 expr ......" | 25623761 |
| hsa-miR-34a-3p | breast cancer | AKR1B1 | "The aim of this study is to evaluate the role of m ......" | 23085450 |
| hsa-miR-34a-3p | breast cancer | CCND1 | "Quantitative PCR and western analysis confirmed de ......" | 21399894 |
| hsa-miR-34a-3p | liver cancer | CCND1 | "This inhibition of proliferation was associated wi ......" | 25792709 |
| hsa-miR-34a-3p | sarcoma | CD99 | "CD99 counteracts EWS-FLI1 in controlling NF-κB si ......" | 26616853 |
| hsa-miR-34a-3p | sarcoma | CD99 | "To decipher their impact on the modified transcrip ......" | 26123714 |
| hsa-miR-34a-3p | bladder cancer | CDK6 | "Molecular analyses identified Cdk6 and sirtuin SIR ......" | 21702042 |
| hsa-miR-34a-3p | lung cancer | CDK6 | "The expression of microRNA 34a is inversely correl ......" | 26104764 |
| hsa-miR-34a-3p | endometrial cancer | CDKN2A | "The Significance of miR 34a Expression in Endometr ......" | 26734589 |
| hsa-miR-34a-3p | head and neck cancer | CDKN2A | "MiR-34a tumor levels significantly correlated with ......" | 25862914 |
| hsa-miR-34a-3p | breast cancer | FOSL1 | "Moreover significant downregulation of miR-34a in ......" | 23001043 |
| hsa-miR-34a-3p | colon cancer | FOSL1 | "MicroRNA 34a inhibits migration and invasion of co ......" | 22198213 |
| hsa-miR-34a-3p | B cell lymphoma | FOXP1 | "Myc mediated repression of microRNA 34a promotes h ......" | 21460242 |
| hsa-miR-34a-3p | B cell lymphoma | FOXP1 | "Our data further support FOXP1 as a target of miR- ......" | 26854484 |
| hsa-miR-34a-3p | breast cancer | HDAC1 | "MiR 34a regulates therapy resistance by targeting ......" | 25173798 |
| hsa-miR-34a-3p | gastric cancer | HDAC1 | "The reverse transcription-quantitative polymerase ......" | 26035691 |
| hsa-miR-34a-3p | prostate cancer | ITGA2 | "Erratum: Epigenetic silencing of miR 34a in human ......" | 24349627 |
| hsa-miR-34a-3p | prostate cancer | ITGA2 | "Epigenetic silencing of miR 34a in human prostate ......" | 22347519 |
| hsa-miR-34a-3p | kidney renal cell cancer | RHOA | "miR-34a was also found to repress RhoA expression ......" | 22159222 |
| hsa-miR-34a-3p | prostate cancer | RHOA | "miR-34a was found to repress RhoA a regulator of c ......" | 22235332 |
| hsa-miR-34a-3p | lung squamous cell cancer | SCLC1 | "Overexpression or downregulation of miR-34a did no ......" | 21731696 |
| hsa-miR-34a-3p | lung squamous cell cancer | SCLC1 | "The methylation of miR-34a and miR-34b/c was obser ......" | 22047961 |
| hsa-miR-34a-3p | breast cancer | SRC | "Furthermore Src was identified as a target of miR- ......" | 25396727 |
| hsa-miR-34a-3p | breast cancer | SRC | "miR 34a Silences c SRC to Attenuate Tumor Growth i ......" | 26676753 |
| hsa-miR-34a-3p | colorectal cancer | VEGFA | "Dysregulation of microRNA 34a expression in colore ......" | 24370784 |
| hsa-miR-34a-3p | head and neck cancer | VEGFA | "Interestingly miR-34a inhibited tumor angiogenesis ......" | 22629428 |
| hsa-miR-34a-3p | breast cancer | ZNF77 | "Within the M0-cohort patients at advanced tumor st ......" | 21047409 |
| hsa-miR-34a-3p | lung squamous cell cancer | ZNF77 | "In human NSCLC tissues miR-34a expression level wa ......" | 25501507 |
| hsa-miR-34a-3p | liver cancer | AFP | "Low miR-34a level was associated with larger tumor ......" | 25596083 |
| hsa-miR-34a-3p | prostate cancer | AGO2 | "Downregulation of AGO2 enhanced expression of miR- ......" | 24805183 |
| hsa-miR-34a-3p | gastric cancer | AKT1 | "Moreover the cancer-associated cell signalling pat ......" | 24837198 |
| hsa-miR-34a-3p | breast cancer | ALDH1A1 | "Mammosphere formation and expression of the stemne ......" | 25783790 |
| hsa-miR-34a-3p | head and neck cancer | AREG | "MiR 34a suppresses amphiregulin and tumor metastat ......" | 25762634 |
| hsa-miR-34a-3p | lung squamous cell cancer | ARHGDIB | "Ectopic expression of miR 34a enhances radiosensit ......" | 23349340 |
| hsa-miR-34a-3p | prostate cancer | ATG4B | "Methylation induced silencing of miR 34a enhances ......" | 26499184 |
| hsa-miR-34a-3p | colorectal cancer | AXIN2 | "p53 regulates nuclear GSK 3 levels through miR 34 ......" | 23624843 |
| hsa-miR-34a-3p | prostate cancer | BIRC5 | "We demonstrate that miR-34a can directly interfere ......" | 25436980 |
| hsa-miR-34a-3p | glioblastoma | CASP9 | "The miR-34a expression levels in cells after irrad ......" | 23155233 |
| hsa-miR-34a-3p | liver cancer | CCL22 | "TGF β miR 34a CCL22 signaling induced Treg cell r ......" | 22975373 |
| hsa-miR-34a-3p | glioblastoma | CCNA1 | "Forced expression of miR-34a in GBM cells decrease ......" | 22580610 |
| hsa-miR-34a-3p | lung cancer | CCNE1 | "The effect of simultaneous overexpression of miR-4 ......" | 25909221 |
| hsa-miR-34a-3p | acute myeloid leukemia | CD274 | "Tumor suppressor miR 34a targets PD L1 and functio ......" | 25499621 |
| hsa-miR-34a-3p | prostate cancer | CD33 | "Tumors with exogenous miR-34a showed reduced level ......" | 26231042 |
| hsa-miR-34a-3p | breast cancer | CDC37 | "These findings show a role for mir-34 in both apop ......" | 19421141 |
| hsa-miR-34a-3p | breast cancer | CDK4 | "Real-time PCR and western blot analysis of extract ......" | 25789847 |
| hsa-miR-34a-3p | chordoma | CHDM | "We find that miR-608 and miR-34a expressions are d ......" | 24621885 |
| hsa-miR-34a-3p | gastric cancer | DAPK2 | "E2F 1 promotes DAPK2 induced anti tumor immunity o ......" | 27704360 |
| hsa-miR-34a-3p | head and neck cancer | DCLRE1C | "Ectopic expression of miR-34a also significantly i ......" | 22629428 |
| hsa-miR-34a-3p | cervical and endocervical cancer | DDX58 | "In our study RIG-I and miR-34a suppressed cell gro ......" | 26910120 |
| hsa-miR-34a-3p | colon cancer | DLD | "Dysregulation of microRNA 34a expression causes dr ......" | 21067862 |
| hsa-miR-34a-3p | lung squamous cell cancer | DLL1 | "Delta tocotrienol suppresses Notch 1 pathway by up ......" | 22438124 |
| hsa-miR-34a-3p | colon cancer | DROSHA | "Conversely bypassing Par-4 overexpression by direc ......" | 20433755 |
| hsa-miR-34a-3p | gastric cancer | E2F1 | "E2F 1 promotes DAPK2 induced anti tumor immunity o ......" | 27704360 |
| hsa-miR-34a-3p | colorectal cancer | E2F5 | "MicroRNA 34a targets FMNL2 and E2F5 and suppresses ......" | 26103003 |
| hsa-miR-34a-3p | glioblastoma | EGF | "Our experiments found that miR-34a was often delet ......" | 22580610 |
| hsa-miR-34a-3p | breast cancer | ERBB2 | "We report smart nanoprobe hyaluronic acid HA-based ......" | 22947044 |
| hsa-miR-34a-3p | colorectal cancer | FMNL2 | "MicroRNA 34a targets FMNL2 and E2F5 and suppresses ......" | 26103003 |
| hsa-miR-34a-3p | lung cancer | FRTS1 | "RFS were longer in adenocarcinoma patients with hi ......" | 26104764 |
| hsa-miR-34a-3p | liver cancer | FUT8 | "Furthermore using microRNA array we identified FUT ......" | 27533464 |
| hsa-miR-34a-3p | thyroid cancer | GAS1 | "MiR 34a targets GAS1 to promote cell proliferation ......" | 24220341 |
| hsa-miR-34a-3p | breast cancer | HDAC7 | "MiR 34a regulates therapy resistance by targeting ......" | 25173798 |
| hsa-miR-34a-3p | pancreatic cancer | HDAC9 | "This study aimed to investigate the functional sig ......" | 21909380 |
| hsa-miR-34a-3p | lung cancer | HGF | "MicroRNA 34a overcomes HGF mediated gefitinib resi ......" | 24983493 |
| hsa-miR-34a-3p | gastric cancer | HMGA2 | "miR-34 targets Notch HMGA2 and Bcl-2 genes involve ......" | 18803879 |
| hsa-miR-34a-3p | colorectal cancer | HMGB1 | "Downregulation of HMGB1 by miR 34a is sufficient t ......" | 27456356 |
| hsa-miR-34a-3p | bladder cancer | HNF4G | "Luciferase assay was performed to verify the putat ......" | 25878394 |
| hsa-miR-34a-3p | prostate cancer | HOTAIR | "Genistein inhibits prostate cancer cell growth by ......" | 23936419 |
| hsa-miR-34a-3p | colorectal cancer | IL1RAPL1 | "MRX34 a miR-34a replacement is the first synthetic ......" | 26518892 |
| hsa-miR-34a-3p | colorectal cancer | IL6 | "Here we determined that exposure of human colorect ......" | 24642471 |
| hsa-miR-34a-3p | sarcoma | KCNH1 | "However the link between miR-34a and Eag1 in cance ......" | 23569431 |
| hsa-miR-34a-3p | endometrial cancer | L1CAM | "Role of miR 34a as a suppressor of L1CAM in endome ......" | 24497324 |
| hsa-miR-34a-3p | prostate cancer | LEF1 | "LEF1 Targeting EMT in Prostate Cancer Invasion Is ......" | 25587085 |
| hsa-miR-34a-3p | breast cancer | LEP | "Honokiol activates LKB1 miR 34a axis and antagoniz ......" | 26359358 |
| hsa-miR-34a-3p | endometrial cancer | LITAF | "This study was undertaken to analyze miR-34a expre ......" | 26734589 |
| hsa-miR-34a-3p | breast cancer | LMTK3 | "MicroRNA 34a suppresses cell proliferation by targ ......" | 24050776 |
| hsa-miR-34a-3p | gastric cancer | MAP2K6 | "In the final integrative analysis of gastric cance ......" | 26622549 |
| hsa-miR-34a-3p | breast cancer | MAVS | "Targeted expression of miR 34a using the T VISA sy ......" | 23032974 |
| hsa-miR-34a-3p | breast cancer | MAZ | "Functional genomic analysis highlighted a novel re ......" | 22102859 |
| hsa-miR-34a-3p | esophageal cancer | MMP2 | "The results showed that miR-34a overexpression inc ......" | 25954903 |
| hsa-miR-34a-3p | esophageal cancer | NFASC | "Transcriptional activation of microRNA 34a by NF k ......" | 22292433 |
| hsa-miR-34a-3p | esophageal cancer | NFKB1 | "Transcriptional activation of microRNA 34a by NF k ......" | 22292433 |
| hsa-miR-34a-3p | glioblastoma | NRGN | "We evaluated the capability of six NG derivatives ......" | 27569663 |
| hsa-miR-34a-3p | colon cancer | NUMB | "A miR 34a Numb Feedforward Loop Triggered by Infla ......" | 26849305 |
| hsa-miR-34a-3p | gastric cancer | PAEP | "Upregulation of Mir 34a in AGS Gastric Cancer Cell ......" | 26745070 |
| hsa-miR-34a-3p | colon cancer | PAWR | "Conversely bypassing Par-4 overexpression by direc ......" | 20433755 |
| hsa-miR-34a-3p | gastric cancer | PCBP2 | "The RNA binding protein PCBP2 facilitates gastric ......" | 24796666 |
| hsa-miR-34a-3p | glioblastoma | PDGFRA | "Mechanistically in addition to its direct regulati ......" | 22750848 |
| hsa-miR-34a-3p | gastric cancer | PDGFRB | "MicroRNA 34A inhibits the growth invasion and meta ......" | 24837198 |
| hsa-miR-34a-3p | lung cancer | PEBP4 | "Downregulation of PEBP4 a target of miR 34a sensit ......" | 25038915 |
| hsa-miR-34a-3p | bladder cancer | PECAM1 | "CD31 an endothelial cell-specific marker which sta ......" | 25551284 |
| hsa-miR-34a-3p | cervical and endocervical cancer | PLG | "Besides we identified that miR-34a affected cell i ......" | 20351093 |
| hsa-miR-34a-3p | breast cancer | PPR1 | "Two miRNAs miR-34a and miR-122 that were significa ......" | 25078559 |
| hsa-miR-34a-3p | lung cancer | PRIMA1 | "MicroRNA 34a is an important component of PRIMA 1 ......" | 19921694 |
| hsa-miR-34a-3p | breast cancer | PRKD1 | "A novel miR 34a target protein kinase D1 stimulate ......" | 26895471 |
| hsa-miR-34a-3p | endometrial cancer | PSME3 | "The Significance of miR 34a Expression in Endometr ......" | 26734589 |
| hsa-miR-34a-3p | lung squamous cell cancer | PTGS2 | "Furthermore restoration of miR-34a indirectly redu ......" | 23349340 |
| hsa-miR-34a-3p | colorectal cancer | PTK2 | "Dysregulation of microRNA 34a expression in colore ......" | 24370784 |
| hsa-miR-34a-3p | breast cancer | RAC1 | "Moreover NPs mediated miR-34a up-regulation direct ......" | 25771001 |
| hsa-miR-34a-3p | lung cancer | RAD51 | "In Vivo Delivery of miR 34a Sensitizes Lung Tumors ......" | 26670277 |
| hsa-miR-34a-3p | breast cancer | SERPINA4 | "Conversely kallistatin stimulated expression of th ......" | 26790955 |
| hsa-miR-34a-3p | gastric cancer | SIRT7 | "Sirt7 promotes gastric cancer growth and inhibits ......" | 25860861 |
| hsa-miR-34a-3p | liver cancer | SLC25A19 | "The aim of the current study was to investigate th ......" | 27165229 |
| hsa-miR-34a-3p | glioblastoma | SMAD4 | "Mechanistically in addition to its direct regulati ......" | 22750848 |
| hsa-miR-34a-3p | pancreatic cancer | SNAI2 | "Metformin but not rapamycin reduced glucose and in ......" | 25576058 |
| hsa-miR-34a-3p | colon cancer | SPEN | "Mechanistically miR-34a sequesters Notch1 mRNA to ......" | 23642368 |
| hsa-miR-34a-3p | colorectal cancer | STAT3 | "Here we determined that exposure of human colorect ......" | 24642471 |
| hsa-miR-34a-3p | breast cancer | STK11 | "Honokiol activates LKB1 miR 34a axis and antagoniz ......" | 26359358 |
| hsa-miR-34a-3p | colon cancer | TBATA | "Here we report a novel LncRNA Lnc34a that is enric ......" | 27077950 |
| hsa-miR-34a-3p | prostate cancer | TCF7 | "TCF7 a WNT signaling-related gene has been implica ......" | 25436980 |
| hsa-miR-34a-3p | sarcoma | TGFB1 | "To decipher their impact on the modified transcrip ......" | 26123714 |
| hsa-miR-34a-3p | gastric cancer | TGIF2 | "MicroRNA 34a inhibits tumor invasion and metastasi ......" | 26464633 |
| hsa-miR-34a-3p | liver cancer | TLR4 | "A functional variant at miR 34a binding site in to ......" | 25179842 |
| hsa-miR-34a-3p | breast cancer | TPD52 | "Tumor suppressive microRNA 34a inhibits breast can ......" | 26678891 |
| hsa-miR-34a-3p | lung cancer | TXK | "In this study we found that miR-34a and miR-34c ta ......" | 23805317 |
| hsa-miR-34a-3p | breast cancer | WNT1 | "MiR 34a Inhibits Breast Cancer Proliferation and P ......" | 27524218 |
| hsa-miR-34a-3p | prostate cancer | XRN1 | "Repression of miR-34a a known AR-targeting miRNA c ......" | 25797256 |
| hsa-miR-34a-3p | esophageal cancer | YY1 | "miR 34a inhibits the migration and invasion of eso ......" | 25954903 |
| hsa-miR-34a-3p | breast cancer | ZEB1 | "Finally an integral role of miR-34a is discovered ......" | 26359358 |
| hsa-miR-34a-3p | breast cancer | ZNF135 | "Within the M0-cohort patients at advanced tumor st ......" | 21047409 |
Expression profile in cancer corhorts:
