microRNA information: hsa-miR-3662
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-3662 | miRbase |
Accession: | MIMAT0018083 | miRbase |
Precursor name: | hsa-mir-3662 | miRbase |
Precursor accession: | MI0016063 | miRbase |
Symbol: | MIR3662 | HGNC |
RefSeq ID: | NR_037435 | GenBank |
Sequence: | GAAAAUGAUGAGUAGUGACUGAUG |
Reported expression in cancers: hsa-miR-3662
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-3662 | lung cancer | upregulation | "Plasma circulating microRNA 944 and microRNA 3662 ......" | 26079400 | Reverse transcription PCR |
Reported cancer pathway affected by hsa-miR-3662
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|
Reported cancer prognosis affected by hsa-miR-3662
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|
Reported gene related to hsa-miR-3662
miRNA | cancer | gene | reporting | PUBMED |
---|