microRNA information: hsa-miR-373-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-373-5p | miRbase |
| Accession: | MIMAT0000725 | miRbase |
| Precursor name: | hsa-mir-373 | miRbase |
| Precursor accession: | MI0000781 | miRbase |
| Symbol: | MIR373 | HGNC |
| RefSeq ID: | NR_029866 | GenBank |
| Sequence: | ACUCAAAAUGGGGGCGCUUUCC |
Reported expression in cancers: hsa-miR-373-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-373-5p | breast cancer | downregulation | "Global identification of miR 373 regulated genes i ......" | 21271679 | |
| hsa-miR-373-5p | cervical and endocervical cancer | upregulation | "miR-373 was reported to be elevated in several tum ......" | 25747718 | Reverse transcription PCR; qPCR |
| hsa-miR-373-5p | colorectal cancer | upregulation | "MiR 205 and MiR 373 Are Associated with Aggressive ......" | 27271572 | |
| hsa-miR-373-5p | esophageal cancer | upregulation | "It has been confirmed that miR-373 expression vari ......" | 27073718 | |
| hsa-miR-373-5p | gastric cancer | upregulation | "The present study showed that miR-373 is upregulat ......" | 24179536 | |
| hsa-miR-373-5p | liver cancer | upregulation | "MicroRNA 373 a new regulator of protein phosphatas ......" | 21481188 | |
| hsa-miR-373-5p | lung squamous cell cancer | downregulation | "Importantly miR-373 was found to be down-regulated ......" | 25063738 | |
| hsa-miR-373-5p | ovarian cancer | downregulation | "MiR-373 has been shown to play pivotal roles in tu ......" | 25460499 | |
| hsa-miR-373-5p | prostate cancer | downregulation | "Here we use quantitative real-time polymerase chai ......" | 26662140 | qPCR |
| hsa-miR-373-5p | retinoblastoma | upregulation | "Identification of miRNAs associated with tumorigen ......" | 18818933 | Microarray; Northern blot; in situ hybridization |
| hsa-miR-373-5p | thyroid cancer | deregulation | "Deregulated miRNAs were confirmed by quantitative ......" | 24127332 | qPCR; in situ hybridization |
Reported cancer pathway affected by hsa-miR-373-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-373-5p | breast cancer | Apoptosis pathway | "Increased serum levels of circulating exosomal mic ......" | 25333260 | |
| hsa-miR-373-5p | colorectal cancer | Epithelial mesenchymal transition pathway | "MiR 205 and MiR 373 Are Associated with Aggressive ......" | 27271572 | |
| hsa-miR-373-5p | esophageal cancer | Apoptosis pathway | "MicroRNA 373 promotes migration and invasion in hu ......" | 27073718 | |
| hsa-miR-373-5p | liver cancer | cell cycle pathway | "MicroRNA 373 a new regulator of protein phosphatas ......" | 21481188 | |
| hsa-miR-373-5p | lung squamous cell cancer | Epithelial mesenchymal transition pathway | "Epigenetic silencing of microRNA 373 to epithelial ......" | 25063738 | |
| hsa-miR-373-5p | ovarian cancer | Epithelial mesenchymal transition pathway | "MiR 373 targeting of the Rab22a oncogene suppresse ......" | 25460499 | Luciferase |
| hsa-miR-373-5p | retinoblastoma | cell cycle pathway | "Among them hsa-miR-373 hsa-miR-125b and hsa-miR-18 ......" | 26730174 |
Reported cancer prognosis affected by hsa-miR-373-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-373-5p | breast cancer | metastasis | "The second proves that miR-373 and miR-520c can al ......" | 18373886 | |
| hsa-miR-373-5p | breast cancer | metastasis | "Global identification of miR 373 regulated genes i ......" | 21271679 | Luciferase |
| hsa-miR-373-5p | breast cancer | tumor size; metastasis | "Real Time RT-PCR was performed to identify the miR ......" | 22524830 | |
| hsa-miR-373-5p | breast cancer | metastasis | "We hypothesized that miR-10b and miR-373 which are ......" | 23238818 | |
| hsa-miR-373-5p | breast cancer | progression | "Deregulated serum concentrations of circulating ce ......" | 23748853 | |
| hsa-miR-373-5p | breast cancer | staging | "Changes in serum levels of miR 21 miR 210 and miR ......" | 25086636 | |
| hsa-miR-373-5p | breast cancer | metastasis | "MiR 373 drives the epithelial to mesenchymal trans ......" | 26196741 | |
| hsa-miR-373-5p | breast cancer | cell migration; metastasis; worse prognosis | "Epigenetic silencing of ITGA2 by MiR 373 promotes ......" | 26258411 | |
| hsa-miR-373-5p | colon cancer | drug resistance | "Epigenetic silencing of microRNA 373 plays an impo ......" | 21785829 | |
| hsa-miR-373-5p | colorectal cancer | progression | "MiR 205 and MiR 373 Are Associated with Aggressive ......" | 27271572 | |
| hsa-miR-373-5p | esophageal cancer | tumorigenesis | "MicroRNA 373 miR 373 post transcriptionally regula ......" | 19501585 | |
| hsa-miR-373-5p | esophageal cancer | metastasis | "MicroRNA 373 promotes migration and invasion in hu ......" | 27073718 | |
| hsa-miR-373-5p | gastric cancer | recurrence | "In addition we validated the expression levels of ......" | 23007704 | |
| hsa-miR-373-5p | gastric cancer | tumorigenesis | "MicroRNA 373 is upregulated and targets TNFAIP1 in ......" | 24179536 | Luciferase |
| hsa-miR-373-5p | gastric cancer | metastasis | "Here we show that CD44 was expressed at different ......" | 27512943 | |
| hsa-miR-373-5p | liver cancer | progression | "MicroRNA 373 a new regulator of protein phosphatas ......" | 21481188 | |
| hsa-miR-373-5p | lung cancer | metastasis | "MiR 373 3p Promotes Invasion and Metastasis of Lun ......" | 26182868 | Western blot |
| hsa-miR-373-5p | ovarian cancer | metastasis; tumorigenesis; staging | "MiR 373 targeting of the Rab22a oncogene suppresse ......" | 25460499 | Luciferase |
| hsa-miR-373-5p | ovarian cancer | staging; metastasis | "Diagnostic and prognostic relevance of circulating ......" | 26943577 | |
| hsa-miR-373-5p | retinoblastoma | tumorigenesis | "Identification of miRNAs associated with tumorigen ......" | 18818933 | |
| hsa-miR-373-5p | retinoblastoma | metastasis | "Among them hsa-miR-373 hsa-miR-125b and hsa-miR-18 ......" | 26730174 | |
| hsa-miR-373-5p | sarcoma | metastasis; cell migration | "miR 520c and miR 373 upregulate MMP9 expression by ......" | 21898400 | Western blot |
Reported gene related to hsa-miR-373-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-373-5p | breast cancer | CD44 | "The second proves that miR-373 and miR-520c can al ......" | 18373886 |
| hsa-miR-373-5p | gastric cancer | CD44 | "Here we show that CD44 was expressed at different ......" | 27512943 |
| hsa-miR-373-5p | prostate cancer | CD44 | "miR-373 and miR-520c expression were decreased in ......" | 19158933 |
| hsa-miR-373-5p | colon cancer | RAB22A | "In clinical colon samples hsa-miR-373 was down-reg ......" | 21785829 |
| hsa-miR-373-5p | ovarian cancer | RAB22A | "MiR 373 targeting of the Rab22a oncogene suppresse ......" | 25460499 |
| hsa-miR-373-5p | ovarian cancer | RAB22A | "LncRNA HOTAIR controls the expression of Rab22a by ......" | 27484896 |
| hsa-miR-373-5p | breast cancer | TXNIP | "INFLUENCE OF miR 373 ON THE INVASION AND MIGRATION ......" | 26122224 |
| hsa-miR-373-5p | breast cancer | TXNIP | "MiR 373 drives the epithelial to mesenchymal trans ......" | 26196741 |
| hsa-miR-373-5p | breast cancer | TXNIP | "Luciferase and mutation assays validated that TXNI ......" | 21271679 |
| hsa-miR-373-5p | colorectal cancer | STAT3 | "Caco-2WT overexpressing miR-373 showed mitotic abn ......" | 27271572 |
| hsa-miR-373-5p | gastric cancer | STAT3 | "Activated STAT3 functioned as a miR-373 suppressor ......" | 27512943 |
| hsa-miR-373-5p | esophageal cancer | TIMP3 | "MicroRNA 373 promotes migration and invasion in hu ......" | 27073718 |
| hsa-miR-373-5p | esophageal cancer | TIMP3 | "Erratum: MicroRNA 373 promotes migration and invas ......" | 27429858 |
| hsa-miR-373-5p | breast cancer | CASP3 | "Fluorescent quantitative polymerase chain reaction ......" | 26122224 |
| hsa-miR-373-5p | breast cancer | CASP8 | "Fluorescent quantitative polymerase chain reaction ......" | 26122224 |
| hsa-miR-373-5p | lung cancer | CDH1 | "Mir 373 affects human lung cancer cells' growth an ......" | 23461063 |
| hsa-miR-373-5p | colorectal cancer | CDH2 | "Caco-2WT overexpressing miR-373 showed mitotic abn ......" | 27271572 |
| hsa-miR-373-5p | pancreatic cancer | CREB1 | "A novel epigenetic CREB miR 373 axis mediates ZIP4 ......" | 23857777 |
| hsa-miR-373-5p | breast cancer | ERBB2 | "Increased concentrations of miR-373 were associate ......" | 23748853 |
| hsa-miR-373-5p | breast cancer | ESR1 | "Overexpression of miR-373 by transfection of MCF-7 ......" | 25333260 |
| hsa-miR-373-5p | lung squamous cell cancer | HDAC9 | "Treatment with another HDAC inhibitor Trichostatin ......" | 25063738 |
| hsa-miR-373-5p | gastric cancer | HNRNPA0 | "Finally we identified HNRPA0 and PRDM4 as risk bio ......" | 23007704 |
| hsa-miR-373-5p | ovarian cancer | HOTAIR | "LncRNA HOTAIR controls the expression of Rab22a by ......" | 27484896 |
| hsa-miR-373-5p | lung squamous cell cancer | IRAK2 | "Epigenetic silencing of microRNA 373 to epithelial ......" | 25063738 |
| hsa-miR-373-5p | breast cancer | ITGA2 | "Epigenetic silencing of ITGA2 by MiR 373 promotes ......" | 26258411 |
| hsa-miR-373-5p | lung squamous cell cancer | LAMP1 | "Epigenetic silencing of microRNA 373 to epithelial ......" | 25063738 |
| hsa-miR-373-5p | esophageal cancer | LATS2 | "The present study has shown that LATS2 protein exp ......" | 19501585 |
| hsa-miR-373-5p | sarcoma | MMP9 | "Here we report new evidence in which miR-520c and ......" | 21898400 |
| hsa-miR-373-5p | prostate cancer | NR2C2 | "TR4 nuclear receptor increases prostate cancer inv ......" | 25980442 |
| hsa-miR-373-5p | breast cancer | NR4A1 | "Also estrogen-negative p=0.021 and progesterone-ne ......" | 25333260 |
| hsa-miR-373-5p | liver cancer | PPP6C | "The mRNA and protein levels of PPP6C were both inv ......" | 21481188 |
| hsa-miR-373-5p | gastric cancer | PRDM4 | "Finally we identified HNRPA0 and PRDM4 as risk bio ......" | 23007704 |
| hsa-miR-373-5p | breast cancer | RABEP1 | "Luciferase and mutation assays validated that TXNI ......" | 21271679 |
| hsa-miR-373-5p | breast cancer | ROS1 | "MiR-373 stimulates EMT migration and invasion thro ......" | 26196741 |
| hsa-miR-373-5p | pancreatic cancer | SLC39A4 | "A novel epigenetic CREB miR 373 axis mediates ZIP4 ......" | 23857777 |
| hsa-miR-373-5p | prostate cancer | SMAD3 | "TR4 nuclear receptor increases prostate cancer inv ......" | 25980442 |
| hsa-miR-373-5p | colorectal cancer | TLR4 | "To investigate the effects of miR-205 and miR-373 ......" | 27271572 |
| hsa-miR-373-5p | gastric cancer | TNFAIP1 | "MicroRNA 373 is upregulated and targets TNFAIP1 in ......" | 24179536 |
| hsa-miR-373-5p | bladder cancer | TP53 | "In contrast generalized increased expression of mi ......" | 23911686 |
| hsa-miR-373-5p | breast cancer | TWIST1 | "MiR 373 drives the epithelial to mesenchymal trans ......" | 26196741 |
| hsa-miR-373-5p | cervical and endocervical cancer | YOD1 | "MicroRNA 373 functions as an oncogene and targets ......" | 25747718 |