microRNA information: hsa-miR-424-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-424-3p | miRbase |
| Accession: | MIMAT0004749 | miRbase |
| Precursor name: | hsa-mir-424 | miRbase |
| Precursor accession: | MI0001446 | miRbase |
| Symbol: | MIR424 | HGNC |
| RefSeq ID: | NR_029946 | GenBank |
| Sequence: | CAAAACGUGAGGCGCUGCUAU |
Reported expression in cancers: hsa-miR-424-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-424-3p | B cell lymphoma | deregulation | "Here we report a comprehensive miRNA-profiling stu ......" | 21062812 | |
| hsa-miR-424-3p | cervical and endocervical cancer | downregulation | "We previously identified a different characteristi ......" | 22469983 | qPCR |
| hsa-miR-424-3p | colorectal cancer | downregulation | "The in vivo significance of expression of miR-16/1 ......" | 21390519 | qPCR |
| hsa-miR-424-3p | colorectal cancer | upregulation | "Similarly to miR-195 the members of the same miR f ......" | 22710713 | |
| hsa-miR-424-3p | liver cancer | deregulation | "In this study we demonstrated the down-regulation ......" | 24675898 | qPCR |
Reported cancer pathway affected by hsa-miR-424-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-424-3p | cervical and endocervical cancer | Apoptosis pathway | "Suppressed miR 424 expression via upregulation of ......" | 22469983 | Luciferase; RNAi |
| hsa-miR-424-3p | endometrial cancer | PI3K/Akt signaling pathway | "MicroRNA 424 suppresses estradiol induced cell pro ......" | 26638889 | Luciferase |
Reported cancer prognosis affected by hsa-miR-424-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-424-3p | bladder cancer | staging; worse prognosis | "Our results revealed that the miR-424 level is sig ......" | 26090723 | |
| hsa-miR-424-3p | breast cancer | drug resistance | "To gain further insight into the molecular mechani ......" | 25633049 | |
| hsa-miR-424-3p | cervical and endocervical cancer | progression; staging; metastasis; differentiation; cell migration | "Suppressed miR 424 expression via upregulation of ......" | 22469983 | Luciferase; RNAi |
| hsa-miR-424-3p | liver cancer | cell migration; tumorigenesis | "MicroRNA 424 is down regulated in hepatocellular c ......" | 24675898 | |
| hsa-miR-424-3p | liver cancer | progression; worse prognosis; poor survival | "MicroRNA 424 inhibits Akt3/E2F3 axis and tumor gro ......" | 26315541 | |
| hsa-miR-424-3p | liver cancer | worse prognosis; progression; poor survival; staging | "Decreased expression of serum miR 424 correlates w ......" | 26823812 | |
| hsa-miR-424-3p | lung cancer | metastasis | "By developing an integrated bioinformatics analysi ......" | 26075299 | |
| hsa-miR-424-3p | lung squamous cell cancer | metastasis | "The miRs were quantified by microarray hybridizati ......" | 22295063 | |
| hsa-miR-424-3p | lung squamous cell cancer | poor survival | "Using a linear combination of the miR CT values wi ......" | 24007627 | |
| hsa-miR-424-3p | lung squamous cell cancer | drug resistance; progression; worse prognosis | "Loss of MiR 424 3p not miR 424 5p confers chemores ......" | 27500472 | Transwell assay |
| hsa-miR-424-3p | prostate cancer | metastasis | "Regulation of epithelial plasticity by miR 424 and ......" | 24193225 | |
| hsa-miR-424-3p | sarcoma | cell migration | "Tumor suppressive microRNA 424 inhibits osteosarco ......" | 23599729 | Luciferase; Western blot |
Reported gene related to hsa-miR-424-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-424-3p | cervical and endocervical cancer | MMP9 | "Furthermore RNAi-mediated knockdown of Chk1 decrea ......" | 22469983 |
| hsa-miR-424-3p | lung squamous cell cancer | MMP9 | "After transfection of miR-424 the proliferation an ......" | 27666545 |
| hsa-miR-424-3p | liver cancer | AFP | "Reduced expression of serum miR-424 was associated ......" | 26823812 |
| hsa-miR-424-3p | liver cancer | AKT3 | "Silencing Akt3 and E2F3 by siRNA pheno-copied the ......" | 26315541 |
| hsa-miR-424-3p | cervical and endocervical cancer | CHEK1 | "Suppressed miR 424 expression via upregulation of ......" | 22469983 |
| hsa-miR-424-3p | bladder cancer | DNMT1 | "Our results revealed that the miR-424 level is sig ......" | 26090723 |
| hsa-miR-424-3p | liver cancer | E2F3 | "Silencing Akt3 and E2F3 by siRNA pheno-copied the ......" | 26315541 |
| hsa-miR-424-3p | lung squamous cell cancer | E2F6 | "The 3'UTR of E2F6 was cloned into luciferase repor ......" | 27666545 |
| hsa-miR-424-3p | endometrial cancer | E2F7 | "MicroRNA 424 may function as a tumor suppressor in ......" | 25708247 |
| hsa-miR-424-3p | bladder cancer | EGFR | "Furthermore the EGFR pathway plays a role in the t ......" | 26090723 |
| hsa-miR-424-3p | sarcoma | FASN | "Tumor suppressive microRNA 424 inhibits osteosarco ......" | 23599729 |
| hsa-miR-424-3p | endometrial cancer | GPER1 | "MicroRNA 424 suppresses estradiol induced cell pro ......" | 26638889 |
| hsa-miR-424-3p | lung squamous cell cancer | MMP2 | "After transfection of miR-424 the proliferation an ......" | 27666545 |
| hsa-miR-424-3p | liver cancer | MYB | "MicroRNA 424 is down regulated in hepatocellular c ......" | 24675898 |
| hsa-miR-424-3p | gastric cancer | SMAD3 | "miR 424 5p promotes proliferation of gastric cance ......" | 27655675 |
| hsa-miR-424-3p | pancreatic cancer | SOCS6 | "MicroRNA 424 5p suppresses the expression of SOCS6 ......" | 23653113 |
| hsa-miR-424-3p | lung squamous cell cancer | YAP1 | "Additionally it is miR-424-3p but not miR-424-5p t ......" | 27500472 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-424-3p | KLHDC1 | 9 cancers: BLCA; BRCA; ESCA; KIRC; LGG; LUAD; LUSC; SARC; STAD | MirTarget | TCGA BLCA -0.198; TCGA BRCA -0.081; TCGA ESCA -0.278; TCGA KIRC -0.098; TCGA LGG -0.104; TCGA LUAD -0.077; TCGA LUSC -0.197; TCGA SARC -0.135; TCGA STAD -0.371 |
hsa-miR-424-3p | NRXN1 | 9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; PAAD; SARC; STAD | miRNATAP | TCGA BLCA -0.499; TCGA BRCA -0.138; TCGA COAD -0.355; TCGA ESCA -0.566; TCGA HNSC -0.3; TCGA LUAD -0.26; TCGA PAAD -0.439; TCGA SARC -0.404; TCGA STAD -0.885 |
Enriched cancer pathways of putative targets