microRNA information: hsa-miR-433-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-433-3p | miRbase |
| Accession: | MIMAT0001627 | miRbase |
| Precursor name: | hsa-mir-433 | miRbase |
| Precursor accession: | MI0001723 | miRbase |
| Symbol: | MIR433 | HGNC |
| RefSeq ID: | NR_029966 | GenBank |
| Sequence: | AUCAUGAUGGGCUCCUCGGUGU |
Reported expression in cancers: hsa-miR-433-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-433-3p | gastric cancer | downregulation | "Down regulated miR 9 and miR 433 in human gastric ......" | 19531230 | qPCR |
| hsa-miR-433-3p | gastric cancer | downregulation | "The Tumor Suppressor Roles of miR 433 and miR 127 ......" | 23880861 | |
| hsa-miR-433-3p | gastric cancer | downregulation | "Compared with the expression levels in the normal ......" | 25013480 | |
| hsa-miR-433-3p | gastric cancer | downregulation | "Real-time quantitative PCR RTQ-PCR was employed to ......" | 25270964 | qPCR |
| hsa-miR-433-3p | liver cancer | deregulation | "In this study we identified 10 upregulated miRNAs ......" | 22362728 | qPCR |
| hsa-miR-433-3p | liver cancer | deregulation | "Six hundred and sixty seven human miRNAs were quan ......" | 23082062 | Microarray; Reverse transcription PCR |
Reported cancer pathway affected by hsa-miR-433-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-433-3p | bladder cancer | Epithelial mesenchymal transition pathway | "c Met and CREB1 are involved in miR 433 mediated i ......" | 26844702 | Colony formation |
| hsa-miR-433-3p | gastric cancer | cell cycle pathway | "The Tumor Suppressor Roles of miR 433 and miR 127 ......" | 23880861 | |
| hsa-miR-433-3p | retinoblastoma | cell cycle pathway; Apoptosis pathway | "MiR 433 inhibits retinoblastoma malignancy by supp ......" | 27470361 |
Reported cancer prognosis affected by hsa-miR-433-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-433-3p | gastric cancer | staging; metastasis; poor survival | "353 gastric samples from two independent subsets o ......" | 20022810 | |
| hsa-miR-433-3p | gastric cancer | staging; progression; cell migration | "The Tumor Suppressor Roles of miR 433 and miR 127 ......" | 23880861 | |
| hsa-miR-433-3p | gastric cancer | metastasis | "Real-time quantitative PCR RTQ-PCR was employed to ......" | 25270964 | |
| hsa-miR-433-3p | liver cancer | cell migration; drug resistance | "MicroRNA 433 inhibits liver cancer cell migration ......" | 23979134 | |
| hsa-miR-433-3p | ovarian cancer | drug resistance | "Overexpression of the microRNA miR 433 promotes re ......" | 25684390 | |
| hsa-miR-433-3p | ovarian cancer | malignant trasformation; cell migration | "MicroRNA 433 inhibits migration and invasion of ov ......" | 27468873 | Western blot; Wound Healing Assay |
| hsa-miR-433-3p | retinoblastoma | metastasis | "MiR 433 inhibits retinoblastoma malignancy by supp ......" | 27470361 |
Reported gene related to hsa-miR-433-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-433-3p | bladder cancer | CREB1 | "c Met and CREB1 are involved in miR 433 mediated i ......" | 26844702 |
| hsa-miR-433-3p | liver cancer | CREB1 | "We show for the first time that potent microRNA-43 ......" | 23979134 |
| hsa-miR-433-3p | ovarian cancer | NOTCH1 | "MicroRNA 433 inhibits migration and invasion of ov ......" | 27468873 |
| hsa-miR-433-3p | retinoblastoma | NOTCH1 | "MiR 433 inhibits retinoblastoma malignancy by supp ......" | 27470361 |
| hsa-miR-433-3p | ovarian cancer | C10ORF2 | "Furthermore in relation to a chemotherapeutic resp ......" | 25684390 |
| hsa-miR-433-3p | liver cancer | CAMP | "MicroRNA 433 inhibits liver cancer cell migration ......" | 23979134 |
| hsa-miR-433-3p | ovarian cancer | CDK6 | "Mechanistically we demonstrate that downregulation ......" | 25684390 |
| hsa-miR-433-3p | prostate cancer | DUSP3 | "Circulating miR-433 which was differentially expre ......" | 27601638 |
| hsa-miR-433-3p | gastric cancer | GRB2 | "GRB2 and RAB34 targets of miR-433 and miR-9 respec ......" | 19531230 |
| hsa-miR-433-3p | gastric cancer | KRAS | "Furthermore the ectopic expression of miR-433 and ......" | 23880861 |
| hsa-miR-433-3p | gastric cancer | MAPK4 | "Furthermore the ectopic expression of miR-433 and ......" | 23880861 |
| hsa-miR-433-3p | bladder cancer | MET | "c Met and CREB1 are involved in miR 433 mediated i ......" | 26844702 |
| hsa-miR-433-3p | liver cancer | PAK4 | "MicroRNA 433 inhibits cell proliferation in hepato ......" | 25410752 |
| hsa-miR-433-3p | retinoblastoma | PAX6 | "MiR 433 inhibits retinoblastoma malignancy by supp ......" | 27470361 |
| hsa-miR-433-3p | gastric cancer | RAB34 | "GRB2 and RAB34 targets of miR-433 and miR-9 respec ......" | 19531230 |