microRNA information: hsa-miR-485-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-485-5p | miRbase |
Accession: | MIMAT0002175 | miRbase |
Precursor name: | hsa-mir-485 | miRbase |
Precursor accession: | MI0002469 | miRbase |
Symbol: | MIR485 | HGNC |
RefSeq ID: | NR_030160 | GenBank |
Sequence: | AGAGGCUGGCCGUGAUGAAUUC |
Reported expression in cancers: hsa-miR-485-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-485-5p | gastric cancer | downregulation | "miR-485-5p is reported as a potential suppressor i ......" | 26807169 | |
hsa-miR-485-5p | gastric cancer | downregulation | "Reduced miR 485 5p expression predicts poor progno ......" | 27160123 | qPCR |
hsa-miR-485-5p | liver cancer | downregulation | "We found that miR-485-5p was significantly downreg ......" | 26054676 | |
hsa-miR-485-5p | lung cancer | downregulation | "In this study we found that the expression level o ......" | 27262438 | |
hsa-miR-485-5p | sarcoma | deregulation | "Hypoxic conditions were verified and miRNA express ......" | 24927770 | Microarray |
Reported cancer pathway affected by hsa-miR-485-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-485-5p | lung cancer | mTOR signaling pathway | "MiR 485 inhibits metastasis and EMT of lung adenoc ......" | 27262438 | Luciferase |
hsa-miR-485-5p | prostate cancer | Apoptosis pathway | "MicroRNAs miR 154 miR 299 5p miR 376a miR 376c miR ......" | 24166498 |
Reported cancer prognosis affected by hsa-miR-485-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-485-5p | breast cancer | cell migration | "miR 485 acts as a tumor suppressor by inhibiting c ......" | 23886178 | Colony formation; Cell migration assay |
hsa-miR-485-5p | breast cancer | metastasis; cell migration | "MiR 485 3p and miR 485 5p suppress breast cancer c ......" | 27010860 | |
hsa-miR-485-5p | gastric cancer | progression; metastasis; malignant trasformation; staging; worse prognosis | "miR 485 5p acts as a negative regulator in gastric ......" | 26807169 | |
hsa-miR-485-5p | gastric cancer | worse prognosis; staging; metastasis; tumor size; poor survival | "Reduced miR 485 5p expression predicts poor progno ......" | 27160123 | |
hsa-miR-485-5p | liver cancer | progression; staging; metastasis | "Involvement of miR 485 5p in hepatocellular carcin ......" | 26054676 | Luciferase |
hsa-miR-485-5p | lung cancer | metastasis; progression | "MiR 485 inhibits metastasis and EMT of lung adenoc ......" | 27262438 | Luciferase |
hsa-miR-485-5p | prostate cancer | poor survival | "Fludarabine treatment favors the retention of miR ......" | 23734815 | |
hsa-miR-485-5p | sarcoma | drug resistance | "Hypoxic conditions were verified and miRNA express ......" | 24927770 | Luciferase |
Reported gene related to hsa-miR-485-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-485-5p | liver cancer | BSG | "Involvement of miR 485 5p in hepatocellular carcin ......" | 26054676 |
hsa-miR-485-5p | breast cancer | CBR1 | "This SNP is located in the 3' untranslated region ......" | 25003827 |
hsa-miR-485-5p | gastric cancer | FLOT1 | "miR 485 5p acts as a negative regulator in gastric ......" | 26807169 |
hsa-miR-485-5p | lung cancer | FLOT2 | "MiR 485 inhibits metastasis and EMT of lung adenoc ......" | 27262438 |
hsa-miR-485-5p | breast cancer | HPGD | "miR 485 5p binding site SNP rs8752 in HPGD gene is ......" | 25003827 |