microRNA information: hsa-miR-491-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-491-5p | miRbase |
| Accession: | MIMAT0002807 | miRbase |
| Precursor name: | hsa-mir-491 | miRbase |
| Precursor accession: | MI0003126 | miRbase |
| Symbol: | MIR491 | HGNC |
| RefSeq ID: | NR_030166 | GenBank |
| Sequence: | AGUGGGGAACCCUUCCAUGAGG |
Reported expression in cancers: hsa-miR-491-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-491-5p | breast cancer | downregulation | "The involvement of miR-491-5p in breast cancer dev ......" | 25725194 | |
| hsa-miR-491-5p | cervical and endocervical cancer | downregulation | "MicroRNA 491 5p suppresses cervical cancer cell gr ......" | 26034994 | |
| hsa-miR-491-5p | colon cancer | upregulation | "Prognostic value of miR 221 3p miR 342 3p and miR ......" | 25075256 | |
| hsa-miR-491-5p | esophageal cancer | downregulation | "The luciferase reporter assay was used to confirm ......" | 26279431 | |
| hsa-miR-491-5p | glioblastoma | downregulation | "Two mature products of MIR 491 coordinate to suppr ......" | 24747968 | RNA-Seq |
| hsa-miR-491-5p | liver cancer | downregulation | "MicroRNA 491 is involved in metastasis of hepatoce ......" | 23725476 | qPCR; Microarray |
| hsa-miR-491-5p | lung squamous cell cancer | downregulation | "MicroRNAs-491-5p miR-491-5p has been found to invo ......" | 27158341 |
Reported cancer pathway affected by hsa-miR-491-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-491-5p | cervical and endocervical cancer | Apoptosis pathway; PI3K/Akt signaling pathway | "MicroRNA 491 5p suppresses cervical cancer cell gr ......" | 26034994 | Luciferase |
| hsa-miR-491-5p | colorectal cancer | Apoptosis pathway | "Functional screening identifies a microRNA miR 491 ......" | 20039318 | |
| hsa-miR-491-5p | lung squamous cell cancer | Apoptosis pathway | "MicroRNAs-491-5p miR-491-5p has been found to invo ......" | 27158341 | |
| hsa-miR-491-5p | ovarian cancer | Apoptosis pathway | "miR 491 5p induced apoptosis in ovarian carcinoma ......" | 25299770 | |
| hsa-miR-491-5p | pancreatic cancer | Apoptosis pathway | "MicroRNA miR 491 5p targeting both TP53 and Bcl XL ......" | 23519249 | |
| hsa-miR-491-5p | thyroid cancer | cell cycle pathway | "MATERIAL AND METHODS We conducted qRT-PCR analysis ......" | 27062921 |
Reported cancer prognosis affected by hsa-miR-491-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-491-5p | breast cancer | progression | "miR 491 5p functions as a tumor suppressor by targ ......" | 25725194 | |
| hsa-miR-491-5p | cervical and endocervical cancer | progression; staging; metastasis | "MicroRNA 491 5p suppresses cervical cancer cell gr ......" | 26034994 | Luciferase |
| hsa-miR-491-5p | colon cancer | poor survival; staging | "Prognostic value of miR 221 3p miR 342 3p and miR ......" | 25075256 | |
| hsa-miR-491-5p | glioblastoma | poor survival | "Two mature products of MIR 491 coordinate to suppr ......" | 24747968 | |
| hsa-miR-491-5p | liver cancer | metastasis; differentiation | "MicroRNA 491 is involved in metastasis of hepatoce ......" | 23725476 | Western blot; Transwell assay |
| hsa-miR-491-5p | liver cancer | recurrence | "MiR 491 attenuates cancer stem cells like properti ......" | 26188902 | |
| hsa-miR-491-5p | liver cancer | staging; tumor size; poor survival; malignant trasformation | "miR 491 inhibits the proliferation invasion and mi ......" | 27053618 | MTT assay; Western blot |
| hsa-miR-491-5p | lung squamous cell cancer | staging | "To explore the potential therapeutic targets of ea ......" | 26781349 | |
| hsa-miR-491-5p | lung squamous cell cancer | staging; metastasis; cell migration; malignant trasformation | "MicroRNAs-491-5p miR-491-5p has been found to invo ......" | 27158341 |
Reported gene related to hsa-miR-491-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-491-5p | colorectal cancer | BCL2L1 | "Functional screening identifies a microRNA miR 491 ......" | 20039318 |
| hsa-miR-491-5p | ovarian cancer | BCL2L1 | "We found that miR-491-5p efficiently induces apopt ......" | 25299770 |
| hsa-miR-491-5p | pancreatic cancer | BCL2L1 | "Targeted site prediction indicated that both Bcl-X ......" | 23519249 |
| hsa-miR-491-5p | glioblastoma | MMP9 | "Among them two miRNAs: miR-885-5p and miR-491-5p w ......" | 21831363 |
| hsa-miR-491-5p | liver cancer | MMP9 | "Our results suggest that miR-491 is involved in me ......" | 23725476 |
| hsa-miR-491-5p | liver cancer | MMP9 | "On one hand as a target miRNA of MMP9 miR-491 decr ......" | 24680928 |
| hsa-miR-491-5p | esophageal cancer | TPX2 | "Low Expression of miR 491 Promotes Esophageal Canc ......" | 26279431 |
| hsa-miR-491-5p | liver cancer | TPX2 | "miR 491 inhibits the proliferation invasion and mi ......" | 27053618 |
| hsa-miR-491-5p | liver cancer | ADRA1A | "Overexpression of miR-491 targeted G-protein-coupl ......" | 26188902 |
| hsa-miR-491-5p | ovarian cancer | BCL2L11 | "We found that miR-491-5p efficiently induces apopt ......" | 25299770 |
| hsa-miR-491-5p | liver cancer | CDH1 | "Moreover miR-491 had a positive relationship with ......" | 23725476 |
| hsa-miR-491-5p | glioblastoma | CDKN2A | "MIR-491 is commonly co-deleted with its adjacent C ......" | 24747968 |
| hsa-miR-491-5p | liver cancer | CIB1 | "Overexpression of miR-491 targeted G-protein-coupl ......" | 26188902 |
| hsa-miR-491-5p | thyroid cancer | CTGF | "We identified CTGF as target of miR-491 and viabil ......" | 27062921 |
| hsa-miR-491-5p | ovarian cancer | EGF | "This latter effect is due to direct targeting of e ......" | 25299770 |
| hsa-miR-491-5p | ovarian cancer | EGFR | "This latter effect is due to direct targeting of e ......" | 25299770 |
| hsa-miR-491-5p | lung squamous cell cancer | IGF2BP1 | "Mechanically IGF2BP1 was identified as direct targ ......" | 27158341 |
| hsa-miR-491-5p | breast cancer | KDM4B | "miR 491 5p functions as a tumor suppressor by targ ......" | 25725194 |
| hsa-miR-491-5p | breast cancer | MBD2 | "Furthermore the histone demethylase JMJD2B was ide ......" | 25725194 |
| hsa-miR-491-5p | liver cancer | P4HB | "MiR 491 attenuates cancer stem cells like properti ......" | 26188902 |
| hsa-miR-491-5p | cervical and endocervical cancer | TERT | "In addition the dual-luciferase reporter assay rev ......" | 26034994 |
| hsa-miR-491-5p | pancreatic cancer | TP53 | "Targeted site prediction indicated that both Bcl-X ......" | 23519249 |
| hsa-miR-491-5p | liver cancer | VIM | "Moreover miR-491 had a positive relationship with ......" | 23725476 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-491-5p | NOTCH3 | 9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUSC; PAAD; THCA | MirTarget; miRanda | TCGA BLCA -0.103; TCGA BRCA -0.091; TCGA CESC -0.251; TCGA ESCA -0.302; TCGA HNSC -0.096; TCGA LGG -0.055; TCGA LUSC -0.154; TCGA PAAD -0.13; TCGA THCA -0.192 |
hsa-miR-491-5p | TRIM29 | 9 cancers: BLCA; CESC; ESCA; HNSC; LUSC; PAAD; PRAD; THCA; UCEC | MirTarget; miRanda | TCGA BLCA -0.241; TCGA CESC -0.55; TCGA ESCA -0.671; TCGA HNSC -0.308; TCGA LUSC -0.261; TCGA PAAD -0.799; TCGA PRAD -0.596; TCGA THCA -0.69; TCGA UCEC -0.202 |
hsa-miR-491-5p | DMPK | 9 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; PRAD; SARC; UCEC | PITA; miRanda; miRNATAP | TCGA BLCA -0.145; TCGA BRCA -0.196; TCGA CESC -0.093; TCGA KIRC -0.155; TCGA KIRP -0.127; TCGA LGG -0.103; TCGA PRAD -0.099; TCGA SARC -0.258; TCGA UCEC -0.141 |
hsa-miR-491-5p | GJB3 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD | miRanda | TCGA BLCA -0.224; TCGA CESC -0.328; TCGA COAD -0.27; TCGA ESCA -0.504; TCGA HNSC -0.379; TCGA LUAD -0.288; TCGA LUSC -0.312; TCGA PAAD -0.708; TCGA PRAD -0.479 |
hsa-miR-491-5p | TPM2 | 10 cancers: BLCA; BRCA; COAD; KIRP; LGG; PAAD; PRAD; SARC; THCA; UCEC | miRanda | TCGA BLCA -0.352; TCGA BRCA -0.111; TCGA COAD -0.213; TCGA KIRP -0.151; TCGA LGG -0.12; TCGA PAAD -0.263; TCGA PRAD -0.28; TCGA SARC -0.388; TCGA THCA -0.187; TCGA UCEC -0.389 |
hsa-miR-491-5p | GLI2 | 9 cancers: BLCA; BRCA; COAD; ESCA; LGG; PAAD; PRAD; THCA; UCEC | miRanda | TCGA BLCA -0.33; TCGA BRCA -0.086; TCGA COAD -0.241; TCGA ESCA -0.329; TCGA LGG -0.072; TCGA PAAD -0.335; TCGA PRAD -0.233; TCGA THCA -0.29; TCGA UCEC -0.198 |
hsa-miR-491-5p | SYDE1 | 9 cancers: BLCA; BRCA; COAD; LGG; LUSC; PRAD; SARC; THCA; UCEC | miRanda | TCGA BLCA -0.145; TCGA BRCA -0.086; TCGA COAD -0.181; TCGA LGG -0.203; TCGA LUSC -0.117; TCGA PRAD -0.183; TCGA SARC -0.056; TCGA THCA -0.065; TCGA UCEC -0.236 |
hsa-miR-491-5p | ANXA8 | 9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; THCA | miRanda | TCGA BLCA -0.336; TCGA CESC -0.77; TCGA COAD -0.273; TCGA ESCA -0.92; TCGA HNSC -0.325; TCGA LUSC -0.497; TCGA PAAD -0.666; TCGA PRAD -0.556; TCGA THCA -0.581 |
hsa-miR-491-5p | SEPT9 | 9 cancers: BLCA; BRCA; ESCA; HNSC; LGG; PAAD; PRAD; SARC; THCA | miRanda | TCGA BLCA -0.064; TCGA BRCA -0.161; TCGA ESCA -0.075; TCGA HNSC -0.107; TCGA LGG -0.097; TCGA PAAD -0.125; TCGA PRAD -0.15; TCGA SARC -0.063; TCGA THCA -0.192 |
hsa-miR-491-5p | RIN3 | 9 cancers: BLCA; BRCA; CESC; LGG; PAAD; PRAD; SARC; THCA; UCEC | miRanda | TCGA BLCA -0.128; TCGA BRCA -0.057; TCGA CESC -0.177; TCGA LGG -0.113; TCGA PAAD -0.188; TCGA PRAD -0.185; TCGA SARC -0.096; TCGA THCA -0.389; TCGA UCEC -0.126 |
hsa-miR-491-5p | IL4R | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; PAAD; PRAD; SARC; THCA; UCEC | miRanda | TCGA BLCA -0.171; TCGA BRCA -0.105; TCGA CESC -0.192; TCGA ESCA -0.126; TCGA HNSC -0.173; TCGA PAAD -0.187; TCGA PRAD -0.143; TCGA SARC -0.217; TCGA THCA -0.226; TCGA UCEC -0.248 |
hsa-miR-491-5p | PML | 9 cancers: BLCA; CESC; ESCA; HNSC; LGG; PAAD; SARC; THCA; UCEC | miRanda; mirMAP | TCGA BLCA -0.08; TCGA CESC -0.161; TCGA ESCA -0.125; TCGA HNSC -0.136; TCGA LGG -0.131; TCGA PAAD -0.141; TCGA SARC -0.097; TCGA THCA -0.146; TCGA UCEC -0.06 |
hsa-miR-491-5p | IER5 | 10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; PAAD; PRAD; THCA | miRanda | TCGA BLCA -0.118; TCGA BRCA -0.081; TCGA CESC -0.166; TCGA ESCA -0.196; TCGA HNSC -0.109; TCGA LGG -0.067; TCGA LUAD -0.064; TCGA PAAD -0.153; TCGA PRAD -0.204; TCGA THCA -0.247 |
hsa-miR-491-5p | ARSI | 9 cancers: BLCA; BRCA; COAD; HNSC; LUSC; PAAD; PRAD; THCA; UCEC | miRanda | TCGA BLCA -0.493; TCGA BRCA -0.28; TCGA COAD -0.334; TCGA HNSC -0.228; TCGA LUSC -0.193; TCGA PAAD -0.28; TCGA PRAD -0.149; TCGA THCA -0.862; TCGA UCEC -0.404 |
hsa-miR-491-5p | TBC1D10C | 9 cancers: BLCA; BRCA; CESC; COAD; LGG; PAAD; PRAD; THCA; UCEC | miRanda | TCGA BLCA -0.188; TCGA BRCA -0.356; TCGA CESC -0.188; TCGA COAD -0.194; TCGA LGG -0.112; TCGA PAAD -0.232; TCGA PRAD -0.107; TCGA THCA -0.144; TCGA UCEC -0.164 |
hsa-miR-491-5p | ADAM19 | 9 cancers: BLCA; BRCA; CESC; COAD; LGG; PAAD; PRAD; SARC; THCA | miRanda | TCGA BLCA -0.304; TCGA BRCA -0.108; TCGA CESC -0.15; TCGA COAD -0.153; TCGA LGG -0.101; TCGA PAAD -0.34; TCGA PRAD -0.262; TCGA SARC -0.235; TCGA THCA -0.641 |
hsa-miR-491-5p | TNS4 | 9 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA | mirMAP | TCGA BLCA -0.238; TCGA CESC -0.291; TCGA ESCA -0.577; TCGA HNSC -0.358; TCGA LUAD -0.276; TCGA LUSC -0.41; TCGA PAAD -0.858; TCGA PRAD -0.576; TCGA THCA -0.382 |
hsa-miR-491-5p | ALS2CL | 10 cancers: BRCA; CESC; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; UCEC | MirTarget; miRanda | TCGA BRCA -0.102; TCGA CESC -0.246; TCGA ESCA -0.237; TCGA HNSC -0.111; TCGA KIRC -0.252; TCGA KIRP -0.247; TCGA PAAD -0.221; TCGA PRAD -0.217; TCGA SARC -0.409; TCGA UCEC -0.177 |
hsa-miR-491-5p | HLA-F | 9 cancers: BRCA; CESC; HNSC; LGG; PAAD; PRAD; SARC; THCA; UCEC | miRanda | TCGA BRCA -0.194; TCGA CESC -0.203; TCGA HNSC -0.118; TCGA LGG -0.148; TCGA PAAD -0.13; TCGA PRAD -0.118; TCGA SARC -0.143; TCGA THCA -0.367; TCGA UCEC -0.168 |
hsa-miR-491-5p | GJB2 | 9 cancers: BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; THCA | miRanda | TCGA BRCA -0.317; TCGA CESC -0.4; TCGA COAD -0.178; TCGA ESCA -0.488; TCGA HNSC -0.385; TCGA LUAD -0.252; TCGA LUSC -0.393; TCGA PAAD -0.696; TCGA THCA -0.355 |
hsa-miR-491-5p | SDC1 | 9 cancers: BRCA; CESC; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; THCA | miRanda | TCGA BRCA -0.266; TCGA CESC -0.177; TCGA ESCA -0.356; TCGA HNSC -0.249; TCGA LGG -0.201; TCGA LUSC -0.113; TCGA PAAD -0.307; TCGA PRAD -0.259; TCGA THCA -0.242 |
hsa-miR-491-5p | PARP9 | 9 cancers: CESC; COAD; HNSC; LGG; LIHC; LUAD; SARC; THCA; UCEC | miRanda | TCGA CESC -0.217; TCGA COAD -0.14; TCGA HNSC -0.138; TCGA LGG -0.155; TCGA LIHC -0.101; TCGA LUAD -0.098; TCGA SARC -0.166; TCGA THCA -0.154; TCGA UCEC -0.078 |
hsa-miR-491-5p | PLP2 | 9 cancers: ESCA; HNSC; LGG; LUAD; LUSC; PRAD; SARC; THCA; UCEC | miRanda | TCGA ESCA -0.178; TCGA HNSC -0.092; TCGA LGG -0.129; TCGA LUAD -0.123; TCGA LUSC -0.125; TCGA PRAD -0.231; TCGA SARC -0.141; TCGA THCA -0.25; TCGA UCEC -0.084 |
Enriched cancer pathways of putative targets