microRNA information: hsa-miR-493-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-493-3p | miRbase |
| Accession: | MIMAT0003161 | miRbase |
| Precursor name: | hsa-mir-493 | miRbase |
| Precursor accession: | MI0003132 | miRbase |
| Symbol: | MIR493 | HGNC |
| RefSeq ID: | NR_030172 | GenBank |
| Sequence: | UGAAGGUCUACUGUGUGCCAGG |
Reported expression in cancers: hsa-miR-493-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-493-3p | colon cancer | upregulation | "Functional analyses showed that miR-493 and to a l ......" | 22373578 | |
| hsa-miR-493-3p | gastric cancer | downregulation | "Tissue samples obtained from 36 gastric cancer pat ......" | 26730339 | qPCR; Microarray; in situ hybridization |
Reported cancer pathway affected by hsa-miR-493-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-493-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-493-3p | bladder cancer | motility | "Tumor suppressor microRNA 493 decreases cell motil ......" | 22057916 | Luciferase |
| hsa-miR-493-3p | colon cancer | tumorigenesis; metastasis | "miR 493 induction during carcinogenesis blocks met ......" | 22373578 | |
| hsa-miR-493-3p | colon cancer | metastasis | "MKK7 mediates miR 493 dependent suppression of liv ......" | 24533778 | RNAi |
| hsa-miR-493-3p | gastric cancer | cell migration; staging; metastasis; progression; poor survival | "MiR 493 suppresses the proliferation and invasion ......" | 26730339 | Wound Healing Assay |
| hsa-miR-493-3p | gastric cancer | drug resistance | "miR 493 mediated DKK1 down regulation confers prol ......" | 26799283 | |
| hsa-miR-493-3p | lung cancer | metastasis; progression | "MicroRNA 493 suppresses tumor growth invasion and ......" | 25105419 |
Reported gene related to hsa-miR-493-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-493-3p | colon cancer | IGF1R | "We previously showed that IGF1R is a target gene o ......" | 24533778 |
| hsa-miR-493-3p | colon cancer | IGF1R | "IGF1R was identified as a direct target of miR-493 ......" | 22373578 |
| hsa-miR-493-3p | bladder cancer | RHOC | "Tumor suppressor microRNA 493 decreases cell motil ......" | 22057916 |
| hsa-miR-493-3p | gastric cancer | RHOC | "MiR 493 suppresses the proliferation and invasion ......" | 26730339 |
| hsa-miR-493-3p | gastric cancer | DKK1 | "miR 493 mediated DKK1 down regulation confers prol ......" | 26799283 |
| hsa-miR-493-3p | lung cancer | E2F1 | "MicroRNA 493 suppresses tumor growth invasion and ......" | 25105419 |
| hsa-miR-493-3p | gastric cancer | FRTS1 | "Moreover miR-493 might independently predict OS an ......" | 26730339 |
| hsa-miR-493-3p | breast cancer | FUT4 | "miR 493 5p attenuates the invasiveness and tumorig ......" | 27375041 |
| hsa-miR-493-3p | bladder cancer | FZD4 | "Tumor suppressor microRNA 493 decreases cell motil ......" | 22057916 |
| hsa-miR-493-3p | colon cancer | MAP2K7 | "MKK7 mediates miR 493 dependent suppression of liv ......" | 24533778 |
Expression profile in cancer corhorts:
