microRNA information: hsa-miR-512-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-512-3p | miRbase |
| Accession: | MIMAT0002823 | miRbase |
| Precursor name: | hsa-mir-512-1 | miRbase |
| Precursor accession: | MI0003140 | miRbase |
| Symbol: | MIR512-1 | HGNC |
| RefSeq ID: | NR_030180 | GenBank |
| Sequence: | AAGUGCUGUCAUAGCUGAGGUC |
Reported expression in cancers: hsa-miR-512-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-512-3p | liver cancer | deregulation | "In this study we identified 10 upregulated miRNAs ......" | 22362728 | qPCR |
| hsa-miR-512-3p | liver cancer | deregulation | "Six hundred and sixty seven human miRNAs were quan ......" | 23082062 | Microarray; Reverse transcription PCR |
| hsa-miR-512-3p | lymphoma | deregulation | "We identified an miRNA signature of 7 miRNAs 5 upr ......" | 23801630 |
Reported cancer pathway affected by hsa-miR-512-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-512-3p | liver cancer | Apoptosis pathway | "Inhibition of c FLIP expression by miR 512 3p cont ......" | 20372864 | Luciferase |
| hsa-miR-512-3p | lung cancer | Apoptosis pathway | "Reactivation of epigenetically silenced miR 512 an ......" | 25591738 | |
| hsa-miR-512-3p | lung squamous cell cancer | Apoptosis pathway | "MiR 512 5p induces apoptosis and inhibits glycolys ......" | 26648284 |
Reported cancer prognosis affected by hsa-miR-512-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-512-3p | lung cancer | cell migration | "Reactivation of epigenetically silenced miR 512 an ......" | 25591738 | |
| hsa-miR-512-3p | lung squamous cell cancer | metastasis | "Inhibition of RAC1 GEF DOCK3 by miR 512 3p contrib ......" | 25687035 |
Reported gene related to hsa-miR-512-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-512-3p | liver cancer | CFLAR | "Inhibition of c FLIP expression by miR 512 3p cont ......" | 20372864 |
| hsa-miR-512-3p | lung squamous cell cancer | DOCK3 | "Inhibition of RAC1 GEF DOCK3 by miR 512 3p contrib ......" | 25687035 |
| hsa-miR-512-3p | lung squamous cell cancer | RAC1 | "Inhibition of RAC1 GEF DOCK3 by miR 512 3p contrib ......" | 25687035 |