---

microRNA information: hsa-miR-519a-3p

Section	ID	link
Mature name:	hsa-miR-519a-3p	miRbase
Accession:	MIMAT0002869	miRbase
Precursor name:	hsa-mir-519a-1	miRbase
Precursor accession:	MI0003178	miRbase
Symbol:	MIR519A1	HGNC
RefSeq ID:	NR_030218	GenBank
Sequence:	AAAGUGCAUCCUUUUAGAGUGU

---

Reported expression in cancers: hsa-miR-519a-3p

miRNA	cancer	regulation	reporting	PUBMED	method
hsa-miR-519a-3p	liver cancer	deregulation	"In this study we identified 10 upregulated miRNAs ......"	22362728	qPCR
hsa-miR-519a-3p	liver cancer	deregulation	"Six hundred and sixty seven human miRNAs were quan ......"	23082062	Microarray; Reverse transcription PCR
hsa-miR-519a-3p	thyroid cancer	upregulation	"Additionally we quantified miR-371a-3p and miR-519 ......"	23062364	in situ hybridization

---

Reported cancer pathway affected by hsa-miR-519a-3p

miRNA	cancer	pathway	reporting	PUBMED	functional study
hsa-miR-519a-3p	breast cancer	cell cycle pathway	"By combining functional enrichment analysis and pr ......"	24752803
hsa-miR-519a-3p	colorectal cancer	Apoptosis pathway	"We used real-time PCR and western blot to measure ......"	26792278	Western blot; Flow cytometry; MTT assay

---

Reported cancer prognosis affected by hsa-miR-519a-3p

miRNA	cancer	prognosis	reporting	PUBMED	functional study
hsa-miR-519a-3p	breast cancer	drug resistance	"The few available studies investigating microRNA i ......"	26473850
hsa-miR-519a-3p	head and neck cancer	progression	"Several miRNAs miRLet-7A miR-1 miR-206 miR-153 miR ......"	26239836

---

Reported gene related to hsa-miR-519a-3p

miRNA	cancer	gene	reporting	PUBMED
hsa-miR-519a-3p	gastric cancer	ELAVL1	"MiR 519 inhibits gastric cancer cell activity thro ......"	26819420
hsa-miR-519a-3p	colorectal cancer	ORAI1	"Moreover cell proliferation and apoptosis were mea ......"	26792278