microRNA information: hsa-miR-552-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-552-3p | miRbase |
| Accession: | MIMAT0003215 | miRbase |
| Precursor name: | hsa-mir-552 | miRbase |
| Precursor accession: | MI0003557 | miRbase |
| Symbol: | MIR552 | HGNC |
| RefSeq ID: | NR_030278 | GenBank |
| Sequence: | AACAGGUGACUGGUUAGACAA |
Reported expression in cancers: hsa-miR-552-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-552-3p | NA | NA | "NA ......" | NA | NA |
| hsa-miR-552-3p | " ......" |
Reported cancer pathway affected by hsa-miR-552-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-552-3p | NA | NA | "NA ......" | NA | NA |
| hsa-miR-552-3p | " ......" |
Reported cancer prognosis affected by hsa-miR-552-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-552-3p | colorectal cancer | staging; metastasis | "The miRNA expression profiles of CRC tissues match ......" | 22970014 | |
| hsa-miR-552-3p | colorectal cancer | metastasis | "MicroRNA 552 enhances metastatic capacity of color ......" | 27661126 | Luciferase |
| hsa-miR-552-3p | lung cancer | metastasis | "miR 592 and miR 552 can distinguish between primar ......" | 24778034 |
Reported gene related to hsa-miR-552-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-552-3p | colorectal cancer | ADAM28 | "Importantly the gene of A Disintegrin And Metallop ......" | 27661126 |
| hsa-miR-552-3p | colorectal cancer | CCL28 | "Importantly the gene of A Disintegrin And Metallop ......" | 27661126 |