microRNA information: hsa-miR-557
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-557 | miRbase |
| Accession: | MIMAT0003221 | miRbase |
| Precursor name: | hsa-mir-557 | miRbase |
| Precursor accession: | MI0003563 | miRbase |
| Symbol: | MIR557 | HGNC |
| RefSeq ID: | NR_030284 | GenBank |
| Sequence: | GUUUGCACGGGUGGGCCUUGUCU |
Reported expression in cancers: hsa-miR-557
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-557 | liver cancer | downregulation | "The following miRNAs were downregulated in the tum ......" | 23205106 |
Reported cancer pathway affected by hsa-miR-557
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-557
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|
Reported gene related to hsa-miR-557
| miRNA | cancer | gene | reporting | PUBMED |
|---|