microRNA information: hsa-miR-590-3p

SectionIDlink
Mature name: hsa-miR-590-3pmiRbase
Accession: MIMAT0004801miRbase
Precursor name: hsa-mir-590 miRbase
Precursor accession: MI0003602miRbase
Symbol: MIR590HGNC
RefSeq ID: NR_030321GenBank
Sequence: UAAUUUUAUGUAUAAGCUAGU



Reported expression in cancers: hsa-miR-590-3p

miRNAcancerregulationreportingPUBMEDmethod
hsa-miR-590-3p

glioblastomadownregulation"Expression levels of miR-590-3p in 15 GBM specimen ......"26556542qPCR



Reported cancer pathway affected by hsa-miR-590-3p

miRNAcancerpathwayreportingPUBMEDfunctional study
hsa-miR-590-3p

glioblastomaEpithelial mesenchymal transition pathway"miR 590 3p suppresses cancer cell migration invasi ......"26556542Western blot; Luciferase
hsa-miR-590-3p

liver cancerPI3K/Akt signaling pathway"Roles of miR 590 5p and miR 590 3p in the developm ......"23803188Colony formation; MTT assay; Western blot; Luciferase



Reported cancer prognosis affected by hsa-miR-590-3p

miRNAcancerprognosisreportingPUBMEDfunctional study
hsa-miR-590-3p

breast cancerdrug resistance"A feedback expression of microRNA 590 and activati ......"25150595
hsa-miR-590-3p

colorectal cancermetastasis"MiR 590 5p inhibits colorectal cancer angiogenesis ......"27735951
hsa-miR-590-3p

glioblastomacell migration; metastasis"miR 590 3p suppresses cancer cell migration invasi ......"26556542Western blot; Luciferase
hsa-miR-590-3p

liver cancerpoor survival; tumorigenesis"Roles of miR 590 5p and miR 590 3p in the developm ......"23803188Colony formation; MTT assay; Western blot; Luciferase



Reported gene related to hsa-miR-590-3p

miRNAcancergenereportingPUBMED
hsa-miR-590-3p

breast cancerATF3"These miRNAs were down regulated in MDA-MB231 cell ......"25150595
hsa-miR-590-3p

cervical and endocervical cancerCHL1"MicroRNA 590 promotes cervical cancer cell growth ......"24288179
hsa-miR-590-3p

lung squamous cell cancerMYC"We identified important regulators MYC NFKB1 miR-5 ......"24200043
hsa-miR-590-3p

lung squamous cell cancerNFKB1"We identified important regulators MYC NFKB1 miR-5 ......"24200043
hsa-miR-590-3p

liver cancerPDCD4"Targetscan predicted PDCD4 and PTEN as the potenti ......"23803188
hsa-miR-590-3p

liver cancerPTEN"Targetscan predicted PDCD4 and PTEN as the potenti ......"23803188
hsa-miR-590-3p

gastric cancerRECK"miR 590 5p regulates gastric cancer cell growth an ......"27757042
hsa-miR-590-3p

breast cancerTCF3"A feedback expression of microRNA 590 and activati ......"25150595
hsa-miR-590-3p

glioblastomaZEB1"miR 590 3p suppresses cancer cell migration invasi ......"26556542
hsa-miR-590-3p

glioblastomaZEB2"miR 590 3p suppresses cancer cell migration invasi ......"26556542



Expression profile in cancer corhorts:




Putative target regulations

miRNAGeneCancerInteractionCorrelation beta
hsa-miR-590-3p
ATXN1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; PITA; miRanda; mirMAP
TCGA BLCA -0.341; TCGA BRCA -0.124; TCGA CESC -0.225; TCGA COAD -0.185; TCGA ESCA -0.112; TCGA HNSC -0.188; TCGA LUAD -0.099; TCGA LUSC -0.176; TCGA PAAD -0.202; TCGA PRAD -0.183; TCGA SARC -0.139; TCGA STAD -0.291; TCGA UCEC -0.159
hsa-miR-590-3p
CITED2
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; SARC; STAD; UCEC
miRNAWalker2 validate; miRanda; mirMAP
TCGA BLCA -0.112; TCGA BRCA -0.28; TCGA CESC -0.263; TCGA ESCA -0.141; TCGA KIRC -0.144; TCGA KIRP -0.128; TCGA LUAD -0.226; TCGA LUSC -0.32; TCGA SARC -0.213; TCGA STAD -0.271; TCGA UCEC -0.418
hsa-miR-590-3p
HIPK1
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRNAWalker2 validate; MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.093; TCGA BRCA -0.054; TCGA CESC -0.203; TCGA ESCA -0.138; TCGA HNSC -0.076; TCGA KIRC -0.15; TCGA KIRP -0.151; TCGA LUAD -0.113; TCGA LUSC -0.168; TCGA PAAD -0.12; TCGA PRAD -0.129; TCGA SARC -0.112; TCGA STAD -0.138
hsa-miR-590-3p
ID4
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; miRanda
TCGA BLCA -0.429; TCGA BRCA -0.269; TCGA COAD -0.398; TCGA ESCA -0.263; TCGA HNSC -0.25; TCGA KIRC -0.293; TCGA LUAD -0.319; TCGA LUSC -0.405; TCGA PRAD -0.432; TCGA SARC -0.658; TCGA STAD -0.46; TCGA UCEC -0.239
hsa-miR-590-3p
IL6ST
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.43; TCGA BRCA -0.537; TCGA CESC -0.409; TCGA COAD -0.398; TCGA ESCA -0.311; TCGA HNSC -0.294; TCGA KIRC -0.364; TCGA KIRP -0.813; TCGA LUAD -0.383; TCGA LUSC -0.533; TCGA PAAD -0.383; TCGA PRAD -0.548; TCGA SARC -0.491; TCGA THCA -0.251; TCGA STAD -0.36; TCGA UCEC -0.279
hsa-miR-590-3p
KCTD20
11 cancers: BLCA; CESC; COAD; ESCA; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; mirMAP
TCGA BLCA -0.124; TCGA CESC -0.159; TCGA COAD -0.095; TCGA ESCA -0.158; TCGA KIRP -0.165; TCGA PAAD -0.193; TCGA PRAD -0.121; TCGA SARC -0.114; TCGA THCA -0.079; TCGA STAD -0.22; TCGA UCEC -0.129
hsa-miR-590-3p
LIMS1
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; PAAD; PRAD; SARC; STAD
miRNAWalker2 validate; miRanda
TCGA BLCA -0.129; TCGA CESC -0.212; TCGA COAD -0.168; TCGA ESCA -0.119; TCGA HNSC -0.203; TCGA KIRP -0.433; TCGA LUSC -0.176; TCGA PAAD -0.341; TCGA PRAD -0.292; TCGA SARC -0.13; TCGA STAD -0.101
hsa-miR-590-3p
MED13L
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.083; TCGA BRCA -0.165; TCGA CESC -0.114; TCGA COAD -0.09; TCGA HNSC -0.112; TCGA KIRP -0.167; TCGA LGG -0.097; TCGA LUAD -0.122; TCGA LUSC -0.082; TCGA PRAD -0.145; TCGA SARC -0.166; TCGA STAD -0.194; TCGA UCEC -0.153
hsa-miR-590-3p
NEDD4
10 cancers: BLCA; BRCA; HNSC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.106; TCGA BRCA -0.173; TCGA HNSC -0.113; TCGA LUSC -0.171; TCGA PAAD -0.288; TCGA PRAD -0.189; TCGA SARC -0.176; TCGA THCA -0.177; TCGA STAD -0.3; TCGA UCEC -0.295
hsa-miR-590-3p
NEO1
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; UCEC
miRNAWalker2 validate; miRanda; mirMAP
TCGA BLCA -0.177; TCGA BRCA -0.153; TCGA HNSC -0.148; TCGA KIRC -0.138; TCGA KIRP -0.137; TCGA LUAD -0.191; TCGA PAAD -0.172; TCGA PRAD -0.122; TCGA SARC -0.413; TCGA THCA -0.108; TCGA UCEC -0.207
hsa-miR-590-3p
NR3C1
12 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRNAWalker2 validate; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.195; TCGA BRCA -0.221; TCGA COAD -0.47; TCGA HNSC -0.081; TCGA LGG -0.099; TCGA LUAD -0.119; TCGA LUSC -0.185; TCGA PAAD -0.224; TCGA PRAD -0.288; TCGA SARC -0.075; TCGA STAD -0.33; TCGA UCEC -0.297
hsa-miR-590-3p
PPP2R5A
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; SARC; UCEC
miRNAWalker2 validate
TCGA BLCA -0.154; TCGA BRCA -0.06; TCGA HNSC -0.07; TCGA KIRC -0.199; TCGA KIRP -0.096; TCGA LGG -0.109; TCGA LIHC -0.161; TCGA LUAD -0.134; TCGA SARC -0.252; TCGA UCEC -0.093
hsa-miR-590-3p
PRKAR2B
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUSC; SARC; STAD; UCEC
miRNAWalker2 validate; miRanda
TCGA BLCA -0.27; TCGA BRCA -0.304; TCGA CESC -0.336; TCGA COAD -0.365; TCGA ESCA -0.536; TCGA KIRC -0.621; TCGA KIRP -0.283; TCGA LGG -0.154; TCGA LUSC -0.155; TCGA SARC -0.258; TCGA STAD -0.613; TCGA UCEC -0.412
hsa-miR-590-3p
SESN3
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUAD; PRAD; SARC; STAD
miRNAWalker2 validate; MirTarget; miRanda
TCGA BLCA -0.262; TCGA BRCA -0.123; TCGA COAD -0.462; TCGA HNSC -0.397; TCGA KIRC -0.356; TCGA KIRP -0.356; TCGA LUAD -0.275; TCGA PRAD -0.17; TCGA SARC -0.151; TCGA STAD -0.404
hsa-miR-590-3p
SETD7
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.2; TCGA BRCA -0.197; TCGA CESC -0.139; TCGA ESCA -0.204; TCGA HNSC -0.187; TCGA KIRP -0.136; TCGA LGG -0.052; TCGA LUAD -0.094; TCGA LUSC -0.214; TCGA PAAD -0.27; TCGA PRAD -0.094; TCGA SARC -0.175; TCGA THCA -0.146; TCGA STAD -0.347; TCGA UCEC -0.325
hsa-miR-590-3p
SGCB
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; miRanda; mirMAP
TCGA BLCA -0.274; TCGA BRCA -0.116; TCGA CESC -0.208; TCGA COAD -0.143; TCGA ESCA -0.324; TCGA HNSC -0.098; TCGA LUAD -0.117; TCGA LUSC -0.223; TCGA PAAD -0.231; TCGA PRAD -0.258; TCGA SARC -0.204; TCGA THCA -0.143; TCGA STAD -0.347; TCGA UCEC -0.207
hsa-miR-590-3p
SKI
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRNAWalker2 validate
TCGA BLCA -0.118; TCGA BRCA -0.054; TCGA CESC -0.131; TCGA COAD -0.087; TCGA HNSC -0.114; TCGA LUAD -0.165; TCGA LUSC -0.195; TCGA PAAD -0.107; TCGA PRAD -0.083; TCGA THCA -0.056; TCGA STAD -0.185; TCGA UCEC -0.13
hsa-miR-590-3p
AFF4
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.114; TCGA BRCA -0.15; TCGA CESC -0.144; TCGA COAD -0.099; TCGA ESCA -0.155; TCGA HNSC -0.102; TCGA KIRC -0.086; TCGA KIRP -0.166; TCGA LGG -0.082; TCGA LUAD -0.136; TCGA LUSC -0.151; TCGA PAAD -0.112; TCGA PRAD -0.141; TCGA SARC -0.208; TCGA THCA -0.112; TCGA STAD -0.212; TCGA UCEC -0.132
hsa-miR-590-3p
HLF
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.883; TCGA BRCA -0.554; TCGA COAD -0.263; TCGA ESCA -0.46; TCGA KIRC -0.369; TCGA KIRP -0.265; TCGA LGG -0.203; TCGA LUAD -0.738; TCGA PRAD -0.357; TCGA SARC -0.955; TCGA STAD -1.087; TCGA UCEC -0.871
hsa-miR-590-3p
CEP68
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.114; TCGA BRCA -0.202; TCGA CESC -0.119; TCGA COAD -0.1; TCGA ESCA -0.157; TCGA KIRC -0.188; TCGA KIRP -0.215; TCGA LGG -0.15; TCGA LIHC -0.129; TCGA LUAD -0.121; TCGA PRAD -0.171; TCGA SARC -0.219; TCGA STAD -0.307; TCGA UCEC -0.251
hsa-miR-590-3p
RGS5
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.578; TCGA BRCA -0.358; TCGA CESC -0.288; TCGA COAD -0.482; TCGA ESCA -0.297; TCGA HNSC -0.211; TCGA LIHC -0.254; TCGA LUAD -0.245; TCGA LUSC -0.498; TCGA SARC -0.246; TCGA THCA -0.294; TCGA STAD -0.532; TCGA UCEC -0.333
hsa-miR-590-3p
RBM24
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.79; TCGA BRCA -0.519; TCGA CESC -0.495; TCGA COAD -0.312; TCGA ESCA -0.444; TCGA HNSC -0.385; TCGA PRAD -0.429; TCGA SARC -1.065; TCGA STAD -1.046; TCGA UCEC -0.626
hsa-miR-590-3p
SETX
10 cancers: BLCA; BRCA; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.057; TCGA BRCA -0.06; TCGA KIRC -0.088; TCGA KIRP -0.075; TCGA LUAD -0.075; TCGA LUSC -0.099; TCGA PRAD -0.112; TCGA THCA -0.09; TCGA STAD -0.077; TCGA UCEC -0.076
hsa-miR-590-3p
LCA5
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.237; TCGA BRCA -0.331; TCGA CESC -0.414; TCGA COAD -0.358; TCGA ESCA -0.149; TCGA HNSC -0.14; TCGA KIRC -0.162; TCGA KIRP -0.272; TCGA LUAD -0.235; TCGA LUSC -0.216; TCGA PAAD -0.282; TCGA PRAD -0.284; TCGA SARC -0.332; TCGA THCA -0.167; TCGA STAD -0.332; TCGA UCEC -0.427
hsa-miR-590-3p
ANK3
12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.125; TCGA CESC -0.26; TCGA ESCA -0.199; TCGA HNSC -0.249; TCGA KIRC -0.471; TCGA LGG -0.156; TCGA LUAD -0.227; TCGA LUSC -0.104; TCGA PAAD -0.147; TCGA PRAD -0.107; TCGA SARC -0.234; TCGA STAD -0.197
hsa-miR-590-3p
DZIP1
12 cancers: BLCA; CESC; COAD; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.223; TCGA CESC -0.318; TCGA COAD -0.619; TCGA KIRC -0.209; TCGA KIRP -0.263; TCGA LGG -0.104; TCGA LUAD -0.117; TCGA LUSC -0.141; TCGA PAAD -0.259; TCGA PRAD -0.306; TCGA STAD -0.667; TCGA UCEC -0.316
hsa-miR-590-3p
VPS13C
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.177; TCGA BRCA -0.16; TCGA CESC -0.194; TCGA ESCA -0.134; TCGA KIRC -0.137; TCGA KIRP -0.187; TCGA LUAD -0.17; TCGA LUSC -0.232; TCGA PRAD -0.173; TCGA SARC -0.198; TCGA STAD -0.101; TCGA UCEC -0.105
hsa-miR-590-3p
TGFBR3
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.472; TCGA BRCA -0.499; TCGA CESC -0.285; TCGA ESCA -0.327; TCGA HNSC -0.189; TCGA KIRC -0.459; TCGA LUAD -0.416; TCGA PRAD -0.348; TCGA SARC -0.3; TCGA STAD -0.691; TCGA UCEC -0.496
hsa-miR-590-3p
KAT2B
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.105; TCGA BRCA -0.121; TCGA CESC -0.201; TCGA COAD -0.132; TCGA ESCA -0.219; TCGA KIRC -0.225; TCGA KIRP -0.244; TCGA LGG -0.081; TCGA LUAD -0.165; TCGA LUSC -0.288; TCGA PRAD -0.076; TCGA SARC -0.254; TCGA STAD -0.335; TCGA UCEC -0.105
hsa-miR-590-3p
EPHA3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.605; TCGA BRCA -0.382; TCGA CESC -0.415; TCGA COAD -0.716; TCGA ESCA -0.394; TCGA HNSC -0.361; TCGA KIRP -0.354; TCGA LUAD -0.364; TCGA LUSC -0.504; TCGA PAAD -0.57; TCGA PRAD -0.306; TCGA STAD -0.678; TCGA UCEC -0.448
hsa-miR-590-3p
BCOR
11 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.073; TCGA CESC -0.123; TCGA HNSC -0.131; TCGA KIRC -0.129; TCGA KIRP -0.222; TCGA LGG -0.053; TCGA LUAD -0.148; TCGA PRAD -0.102; TCGA SARC -0.213; TCGA THCA -0.067; TCGA STAD -0.059
hsa-miR-590-3p
COL4A4
10 cancers: BLCA; COAD; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.47; TCGA COAD -0.424; TCGA KIRC -0.86; TCGA KIRP -0.527; TCGA LGG -0.246; TCGA LUAD -0.402; TCGA LUSC -0.545; TCGA PRAD -0.288; TCGA STAD -0.348; TCGA UCEC -0.448
hsa-miR-590-3p
UBL3
15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.232; TCGA BRCA -0.156; TCGA CESC -0.3; TCGA COAD -0.101; TCGA HNSC -0.155; TCGA KIRC -0.25; TCGA KIRP -0.225; TCGA LGG -0.118; TCGA LUAD -0.185; TCGA LUSC -0.351; TCGA PAAD -0.102; TCGA PRAD -0.103; TCGA THCA -0.11; TCGA STAD -0.148; TCGA UCEC -0.309
hsa-miR-590-3p
ANKRD40
10 cancers: BLCA; BRCA; ESCA; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.075; TCGA BRCA -0.085; TCGA ESCA -0.083; TCGA LUAD -0.061; TCGA PAAD -0.087; TCGA PRAD -0.081; TCGA SARC -0.113; TCGA THCA -0.053; TCGA STAD -0.197; TCGA UCEC -0.093
hsa-miR-590-3p
AKAP11
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.168; TCGA BRCA -0.169; TCGA CESC -0.235; TCGA COAD -0.102; TCGA ESCA -0.155; TCGA HNSC -0.082; TCGA KIRC -0.181; TCGA KIRP -0.207; TCGA LGG -0.138; TCGA LUAD -0.103; TCGA LUSC -0.241; TCGA PRAD -0.22; TCGA SARC -0.172; TCGA THCA -0.093; TCGA STAD -0.209; TCGA UCEC -0.196
hsa-miR-590-3p
IBTK
9 cancers: BLCA; CESC; KIRC; KIRP; LGG; LUSC; PRAD; THCA; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.054; TCGA CESC -0.09; TCGA KIRC -0.129; TCGA KIRP -0.154; TCGA LGG -0.062; TCGA LUSC -0.095; TCGA PRAD -0.089; TCGA THCA -0.057; TCGA UCEC -0.06
hsa-miR-590-3p
PCOLCE2
10 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; STAD
MirTarget; miRanda
TCGA BLCA -0.603; TCGA BRCA -0.38; TCGA COAD -0.596; TCGA HNSC -0.403; TCGA LGG -0.247; TCGA LUAD -0.294; TCGA LUSC -0.304; TCGA PAAD -0.429; TCGA PRAD -0.281; TCGA STAD -0.791
hsa-miR-590-3p
FERMT2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.569; TCGA BRCA -0.287; TCGA CESC -0.401; TCGA COAD -0.69; TCGA ESCA -0.441; TCGA HNSC -0.251; TCGA KIRC -0.223; TCGA KIRP -0.29; TCGA LUAD -0.126; TCGA LUSC -0.426; TCGA PAAD -0.361; TCGA PRAD -0.31; TCGA SARC -0.321; TCGA THCA -0.096; TCGA STAD -0.787; TCGA UCEC -0.358
hsa-miR-590-3p
STEAP4
9 cancers: BLCA; BRCA; COAD; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.292; TCGA BRCA -0.507; TCGA COAD -0.382; TCGA LUAD -0.278; TCGA LUSC -0.634; TCGA PAAD -0.27; TCGA PRAD -0.14; TCGA STAD -0.639; TCGA UCEC -0.417
hsa-miR-590-3p
FAM114A1
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; PAAD; PRAD; SARC; THCA; STAD
MirTarget; mirMAP
TCGA BLCA -0.18; TCGA BRCA -0.064; TCGA CESC -0.215; TCGA ESCA -0.17; TCGA HNSC -0.214; TCGA KIRP -0.267; TCGA PAAD -0.255; TCGA PRAD -0.209; TCGA SARC -0.166; TCGA THCA -0.119; TCGA STAD -0.151
hsa-miR-590-3p
DUSP3
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.186; TCGA BRCA -0.093; TCGA COAD -0.081; TCGA ESCA -0.214; TCGA HNSC -0.116; TCGA KIRC -0.096; TCGA LUSC -0.122; TCGA PAAD -0.093; TCGA PRAD -0.187; TCGA SARC -0.172; TCGA THCA -0.086; TCGA STAD -0.346; TCGA UCEC -0.091
hsa-miR-590-3p
PRICKLE2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.506; TCGA BRCA -0.428; TCGA CESC -0.28; TCGA COAD -0.6; TCGA ESCA -0.464; TCGA KIRC -0.115; TCGA LGG -0.155; TCGA LUAD -0.267; TCGA LUSC -0.548; TCGA PAAD -0.307; TCGA PRAD -0.427; TCGA SARC -0.397; TCGA STAD -0.885; TCGA UCEC -0.484
hsa-miR-590-3p
ATRNL1
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; PRAD; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.229; TCGA BRCA -0.42; TCGA COAD -0.948; TCGA HNSC -0.374; TCGA KIRC -1.119; TCGA KIRP -0.378; TCGA LGG -0.295; TCGA PRAD -0.384; TCGA STAD -0.792; TCGA UCEC -0.532
hsa-miR-590-3p
AXIN2
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; SARC; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.473; TCGA BRCA -0.364; TCGA CESC -0.5; TCGA HNSC -0.271; TCGA KIRC -0.383; TCGA LGG -0.114; TCGA LUAD -0.264; TCGA LUSC -0.36; TCGA PRAD -0.152; TCGA SARC -0.36; TCGA UCEC -0.201
hsa-miR-590-3p
ZXDA
10 cancers: BLCA; BRCA; CESC; COAD; KIRP; LGG; LUAD; PRAD; SARC; STAD
MirTarget; mirMAP
TCGA BLCA -0.071; TCGA BRCA -0.115; TCGA CESC -0.123; TCGA COAD -0.102; TCGA KIRP -0.168; TCGA LGG -0.158; TCGA LUAD -0.11; TCGA PRAD -0.158; TCGA SARC -0.266; TCGA STAD -0.224
hsa-miR-590-3p
TMEM47
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.561; TCGA BRCA -0.282; TCGA CESC -0.596; TCGA COAD -0.603; TCGA ESCA -0.543; TCGA HNSC -0.35; TCGA KIRC -0.273; TCGA KIRP -0.223; TCGA LUAD -0.232; TCGA LUSC -0.502; TCGA PAAD -0.417; TCGA PRAD -0.191; TCGA SARC -0.553; TCGA THCA -0.207; TCGA STAD -0.694; TCGA UCEC -0.428
hsa-miR-590-3p
ARHGAP5
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.117; TCGA BRCA -0.097; TCGA CESC -0.212; TCGA ESCA -0.2; TCGA HNSC -0.106; TCGA KIRC -0.309; TCGA KIRP -0.198; TCGA LUAD -0.09; TCGA LUSC -0.092; TCGA PAAD -0.141; TCGA PRAD -0.158; TCGA SARC -0.155; TCGA THCA -0.109; TCGA STAD -0.184; TCGA UCEC -0.187
hsa-miR-590-3p
ZC3H13
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.128; TCGA BRCA -0.091; TCGA CESC -0.241; TCGA COAD -0.145; TCGA HNSC -0.095; TCGA KIRC -0.173; TCGA KIRP -0.178; TCGA LUAD -0.106; TCGA LUSC -0.131; TCGA PAAD -0.113; TCGA PRAD -0.21; TCGA SARC -0.165; TCGA STAD -0.178; TCGA UCEC -0.103
hsa-miR-590-3p
EEA1
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.102; TCGA BRCA -0.142; TCGA CESC -0.137; TCGA COAD -0.071; TCGA HNSC -0.143; TCGA KIRP -0.131; TCGA LUAD -0.127; TCGA LUSC -0.164; TCGA PAAD -0.144; TCGA PRAD -0.126; TCGA SARC -0.159; TCGA THCA -0.08; TCGA STAD -0.198; TCGA UCEC -0.147
hsa-miR-590-3p
ARMC9
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.193; TCGA BRCA -0.068; TCGA CESC -0.243; TCGA COAD -0.233; TCGA ESCA -0.298; TCGA HNSC -0.091; TCGA KIRC -0.127; TCGA KIRP -0.103; TCGA LUAD -0.12; TCGA LUSC -0.215; TCGA PAAD -0.285; TCGA SARC -0.157; TCGA THCA -0.1; TCGA STAD -0.345; TCGA UCEC -0.192
hsa-miR-590-3p
DOCK11
10 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.374; TCGA BRCA -0.179; TCGA COAD -0.247; TCGA ESCA -0.374; TCGA LUAD -0.119; TCGA LUSC -0.498; TCGA PAAD -0.209; TCGA PRAD -0.22; TCGA STAD -0.365; TCGA UCEC -0.207
hsa-miR-590-3p
CLIP4
10 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LGG; PRAD; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.26; TCGA BRCA -0.131; TCGA COAD -0.635; TCGA HNSC -0.125; TCGA KIRP -0.112; TCGA LGG -0.098; TCGA PRAD -0.351; TCGA THCA -0.108; TCGA STAD -0.671; TCGA UCEC -0.217
hsa-miR-590-3p
USP47
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.072; TCGA BRCA -0.063; TCGA CESC -0.083; TCGA ESCA -0.086; TCGA HNSC -0.087; TCGA KIRP -0.12; TCGA LGG -0.089; TCGA LUAD -0.095; TCGA LUSC -0.081; TCGA PAAD -0.062; TCGA PRAD -0.076; TCGA SARC -0.124; TCGA THCA -0.061; TCGA STAD -0.141; TCGA UCEC -0.096
hsa-miR-590-3p
PRKACB
9 cancers: BLCA; CESC; COAD; KIRC; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.201; TCGA CESC -0.15; TCGA COAD -0.288; TCGA KIRC -0.17; TCGA LUSC -0.081; TCGA PRAD -0.128; TCGA SARC -0.103; TCGA STAD -0.32; TCGA UCEC -0.186
hsa-miR-590-3p
SNX2
10 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.112; TCGA BRCA -0.057; TCGA COAD -0.053; TCGA KIRC -0.148; TCGA KIRP -0.168; TCGA LUAD -0.057; TCGA LUSC -0.119; TCGA PAAD -0.068; TCGA STAD -0.08; TCGA UCEC -0.101
hsa-miR-590-3p
ELF1
9 cancers: BLCA; BRCA; CESC; COAD; KIRP; LUAD; LUSC; PRAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.127; TCGA BRCA -0.075; TCGA CESC -0.199; TCGA COAD -0.1; TCGA KIRP -0.135; TCGA LUAD -0.065; TCGA LUSC -0.172; TCGA PRAD -0.228; TCGA UCEC -0.096
hsa-miR-590-3p
FNIP1
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; SARC; THCA; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.094; TCGA BRCA -0.167; TCGA CESC -0.138; TCGA ESCA -0.136; TCGA HNSC -0.08; TCGA LGG -0.062; TCGA LIHC -0.082; TCGA LUAD -0.062; TCGA LUSC -0.118; TCGA SARC -0.174; TCGA THCA -0.107; TCGA UCEC -0.088
hsa-miR-590-3p
KCNT2
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.36; TCGA BRCA -0.235; TCGA CESC -0.252; TCGA ESCA -0.733; TCGA HNSC -0.226; TCGA LGG -0.29; TCGA LUAD -0.255; TCGA LUSC -0.807; TCGA PAAD -0.225; TCGA PRAD -0.345; TCGA SARC -0.336; TCGA STAD -0.746; TCGA UCEC -0.446
hsa-miR-590-3p
DACH1
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.224; TCGA BRCA -0.702; TCGA CESC -0.437; TCGA COAD -0.222; TCGA HNSC -0.232; TCGA KIRC -0.753; TCGA KIRP -0.635; TCGA LGG -0.172; TCGA LUAD -0.386; TCGA LUSC -0.388; TCGA PRAD -0.188; TCGA UCEC -0.157
hsa-miR-590-3p
ZDHHC15
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.624; TCGA BRCA -0.251; TCGA CESC -0.646; TCGA COAD -0.801; TCGA ESCA -0.625; TCGA HNSC -0.437; TCGA KIRC -0.82; TCGA KIRP -0.389; TCGA LUAD -0.381; TCGA LUSC -0.522; TCGA PAAD -0.243; TCGA PRAD -0.366; TCGA SARC -0.771; TCGA THCA -0.084; TCGA STAD -0.799; TCGA UCEC -0.537
hsa-miR-590-3p
CEP120
10 cancers: BLCA; BRCA; COAD; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.069; TCGA BRCA -0.157; TCGA COAD -0.055; TCGA KIRP -0.112; TCGA LUAD -0.103; TCGA LUSC -0.11; TCGA PRAD -0.107; TCGA SARC -0.104; TCGA STAD -0.098; TCGA UCEC -0.222
hsa-miR-590-3p
SMAD4
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LGG; LUAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.089; TCGA BRCA -0.088; TCGA CESC -0.109; TCGA ESCA -0.132; TCGA KIRC -0.132; TCGA LGG -0.085; TCGA LUAD -0.094; TCGA PRAD -0.07; TCGA SARC -0.2; TCGA STAD -0.166; TCGA UCEC -0.178
hsa-miR-590-3p
MBNL3
9 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.265; TCGA CESC -0.246; TCGA HNSC -0.163; TCGA KIRC -0.537; TCGA KIRP -0.561; TCGA LUAD -0.177; TCGA LUSC -0.168; TCGA PAAD -0.229; TCGA PRAD -0.358
hsa-miR-590-3p
RABGAP1
13 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.122; TCGA CESC -0.099; TCGA COAD -0.107; TCGA ESCA -0.175; TCGA KIRC -0.158; TCGA KIRP -0.154; TCGA LGG -0.082; TCGA LUAD -0.066; TCGA PRAD -0.108; TCGA SARC -0.32; TCGA THCA -0.092; TCGA STAD -0.286; TCGA UCEC -0.078
hsa-miR-590-3p
TBC1D9
10 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; STAD
MirTarget; miRanda; mirMAP
TCGA BLCA -0.079; TCGA BRCA -0.498; TCGA COAD -0.35; TCGA KIRC -0.377; TCGA KIRP -0.301; TCGA LGG -0.115; TCGA LUAD -0.07; TCGA LUSC -0.194; TCGA PRAD -0.073; TCGA STAD -0.113
hsa-miR-590-3p
NEK7
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.144; TCGA BRCA -0.083; TCGA CESC -0.12; TCGA COAD -0.107; TCGA ESCA -0.119; TCGA KIRP -0.166; TCGA LUSC -0.245; TCGA PAAD -0.165; TCGA PRAD -0.146; TCGA SARC -0.155; TCGA STAD -0.2; TCGA UCEC -0.176
hsa-miR-590-3p
ACADSB
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.19; TCGA BRCA -0.442; TCGA CESC -0.151; TCGA ESCA -0.153; TCGA KIRC -0.58; TCGA KIRP -0.364; TCGA LGG -0.155; TCGA LUAD -0.228; TCGA SARC -0.151; TCGA STAD -0.137; TCGA UCEC -0.158
hsa-miR-590-3p
DCP1A
10 cancers: BLCA; BRCA; CESC; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.056; TCGA BRCA -0.1; TCGA CESC -0.096; TCGA KIRC -0.111; TCGA LUAD -0.058; TCGA LUSC -0.092; TCGA PRAD -0.07; TCGA SARC -0.156; TCGA STAD -0.055; TCGA UCEC -0.108
hsa-miR-590-3p
MKX
10 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.616; TCGA BRCA -0.479; TCGA COAD -0.397; TCGA KIRC -0.392; TCGA KIRP -0.534; TCGA LGG -0.318; TCGA PAAD -0.473; TCGA PRAD -0.251; TCGA STAD -0.851; TCGA UCEC -0.286
hsa-miR-590-3p
BHLHE22
10 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUAD; LUSC; PAAD; SARC; STAD
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.301; TCGA BRCA -0.215; TCGA COAD -0.543; TCGA ESCA -0.361; TCGA LIHC -0.307; TCGA LUAD -0.135; TCGA LUSC -0.46; TCGA PAAD -0.258; TCGA SARC -0.453; TCGA STAD -0.44
hsa-miR-590-3p
MYLK
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.848; TCGA BRCA -0.32; TCGA CESC -0.421; TCGA COAD -0.805; TCGA ESCA -0.72; TCGA HNSC -0.23; TCGA KIRC -0.208; TCGA KIRP -0.259; TCGA LUAD -0.275; TCGA LUSC -0.505; TCGA PAAD -0.482; TCGA PRAD -0.644; TCGA SARC -1.197; TCGA THCA -0.135; TCGA STAD -1.158; TCGA UCEC -0.666
hsa-miR-590-3p
ECM2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.528; TCGA BRCA -0.537; TCGA CESC -0.37; TCGA COAD -0.656; TCGA ESCA -0.278; TCGA HNSC -0.325; TCGA KIRC -0.117; TCGA LUAD -0.3; TCGA LUSC -0.79; TCGA PAAD -0.548; TCGA PRAD -0.176; TCGA SARC -0.204; TCGA STAD -0.455; TCGA UCEC -0.557
hsa-miR-590-3p
SDC2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.361; TCGA BRCA -0.129; TCGA CESC -0.29; TCGA COAD -0.489; TCGA ESCA -0.178; TCGA HNSC -0.36; TCGA KIRC -0.138; TCGA KIRP -0.193; TCGA LUAD -0.219; TCGA LUSC -0.461; TCGA PAAD -0.289; TCGA PRAD -0.128; TCGA STAD -0.385; TCGA UCEC -0.44
hsa-miR-590-3p
MCC
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.156; TCGA BRCA -0.318; TCGA COAD -0.555; TCGA HNSC -0.148; TCGA KIRC -0.272; TCGA KIRP -0.366; TCGA LUAD -0.257; TCGA LUSC -0.228; TCGA PAAD -0.182; TCGA PRAD -0.465; TCGA SARC -0.216; TCGA STAD -0.54; TCGA UCEC -0.27
hsa-miR-590-3p
APBB2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.189; TCGA BRCA -0.274; TCGA CESC -0.159; TCGA COAD -0.081; TCGA ESCA -0.154; TCGA HNSC -0.125; TCGA KIRC -0.133; TCGA KIRP -0.291; TCGA LGG -0.125; TCGA LUAD -0.162; TCGA LUSC -0.356; TCGA PAAD -0.197; TCGA SARC -0.146; TCGA THCA -0.074; TCGA STAD -0.226; TCGA UCEC -0.164
hsa-miR-590-3p
TSHZ3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.6; TCGA BRCA -0.304; TCGA CESC -0.388; TCGA COAD -0.592; TCGA ESCA -0.424; TCGA HNSC -0.252; TCGA KIRP -0.258; TCGA LUAD -0.167; TCGA LUSC -0.442; TCGA PAAD -0.354; TCGA PRAD -0.23; TCGA SARC -0.103; TCGA STAD -0.617; TCGA UCEC -0.416
hsa-miR-590-3p
PTEN
12 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.096; TCGA BRCA -0.131; TCGA CESC -0.141; TCGA HNSC -0.092; TCGA KIRP -0.118; TCGA LGG -0.062; TCGA LIHC -0.101; TCGA LUAD -0.094; TCGA LUSC -0.199; TCGA PAAD -0.086; TCGA STAD -0.152; TCGA UCEC -0.162
hsa-miR-590-3p
IDE
9 cancers: BLCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.073; TCGA HNSC -0.165; TCGA KIRC -0.149; TCGA KIRP -0.311; TCGA LUAD -0.069; TCGA PAAD -0.212; TCGA PRAD -0.221; TCGA SARC -0.114; TCGA THCA -0.136
hsa-miR-590-3p
PJA2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.292; TCGA BRCA -0.207; TCGA CESC -0.193; TCGA COAD -0.201; TCGA ESCA -0.209; TCGA HNSC -0.116; TCGA KIRC -0.104; TCGA KIRP -0.267; TCGA LUAD -0.153; TCGA LUSC -0.193; TCGA PAAD -0.129; TCGA PRAD -0.224; TCGA SARC -0.273; TCGA THCA -0.129; TCGA STAD -0.36; TCGA UCEC -0.248
hsa-miR-590-3p
CA5B
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; THCA; STAD
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.148; TCGA BRCA -0.147; TCGA CESC -0.135; TCGA COAD -0.126; TCGA ESCA -0.176; TCGA KIRC -0.174; TCGA KIRP -0.237; TCGA LUAD -0.087; TCGA LUSC -0.11; TCGA THCA -0.08; TCGA STAD -0.353
hsa-miR-590-3p
ZNF704
16 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.281; TCGA BRCA -0.261; TCGA CESC -0.644; TCGA COAD -0.199; TCGA HNSC -0.342; TCGA KIRC -0.379; TCGA KIRP -0.44; TCGA LGG -0.137; TCGA LUAD -0.296; TCGA LUSC -0.218; TCGA PAAD -0.405; TCGA PRAD -0.238; TCGA SARC -0.471; TCGA THCA -0.186; TCGA STAD -0.406; TCGA UCEC -0.184
hsa-miR-590-3p
MPP7
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.271; TCGA BRCA -0.351; TCGA CESC -0.192; TCGA HNSC -0.241; TCGA KIRC -0.949; TCGA KIRP -0.341; TCGA LGG -0.301; TCGA PRAD -0.18; TCGA SARC -0.763; TCGA THCA -0.146; TCGA STAD -0.489; TCGA UCEC -0.172
hsa-miR-590-3p
SIGLEC6
10 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.63; TCGA BRCA -0.389; TCGA COAD -0.623; TCGA ESCA -0.617; TCGA LUAD -0.499; TCGA LUSC -0.826; TCGA PAAD -0.532; TCGA PRAD -0.239; TCGA SARC -0.563; TCGA STAD -0.369
hsa-miR-590-3p
RUNDC3B
11 cancers: BLCA; BRCA; CESC; ESCA; LGG; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.243; TCGA BRCA -0.381; TCGA CESC -0.308; TCGA ESCA -0.303; TCGA LGG -0.161; TCGA LUSC -0.378; TCGA PRAD -0.141; TCGA SARC -0.258; TCGA THCA -0.105; TCGA STAD -0.463; TCGA UCEC -0.414
hsa-miR-590-3p
SEMA3E
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; PRAD; SARC; THCA; STAD
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.546; TCGA BRCA -0.57; TCGA CESC -0.646; TCGA COAD -1.006; TCGA ESCA -0.932; TCGA HNSC -0.272; TCGA KIRC -0.652; TCGA PRAD -0.199; TCGA SARC -0.474; TCGA THCA -0.409; TCGA STAD -0.82
hsa-miR-590-3p
VAMP4
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUSC; SARC; THCA; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.07; TCGA BRCA -0.08; TCGA CESC -0.095; TCGA COAD -0.079; TCGA ESCA -0.097; TCGA KIRC -0.063; TCGA KIRP -0.062; TCGA LGG -0.149; TCGA LUSC -0.077; TCGA SARC -0.117; TCGA THCA -0.104; TCGA STAD -0.217; TCGA UCEC -0.188
hsa-miR-590-3p
ITGAV
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.192; TCGA BRCA -0.12; TCGA CESC -0.201; TCGA COAD -0.262; TCGA ESCA -0.174; TCGA HNSC -0.155; TCGA KIRC -0.096; TCGA KIRP -0.337; TCGA LUSC -0.122; TCGA PAAD -0.308; TCGA PRAD -0.177; TCGA SARC -0.161; TCGA STAD -0.179; TCGA UCEC -0.243
hsa-miR-590-3p
C1R
9 cancers: BLCA; BRCA; COAD; ESCA; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.332; TCGA BRCA -0.121; TCGA COAD -0.586; TCGA ESCA -0.317; TCGA LUSC -0.27; TCGA PAAD -0.424; TCGA PRAD -0.156; TCGA STAD -0.323; TCGA UCEC -0.197
hsa-miR-590-3p
FAT3
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.542; TCGA BRCA -0.521; TCGA CESC -0.59; TCGA COAD -0.657; TCGA ESCA -0.867; TCGA HNSC -0.25; TCGA KIRC -0.368; TCGA KIRP -0.417; TCGA LGG -0.217; TCGA LUAD -0.454; TCGA LUSC -0.647; TCGA PAAD -0.433; TCGA PRAD -0.772; TCGA SARC -1.191; TCGA STAD -1.24; TCGA UCEC -0.467
hsa-miR-590-3p
ZNF654
12 cancers: BLCA; CESC; ESCA; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.055; TCGA CESC -0.124; TCGA ESCA -0.126; TCGA KIRP -0.157; TCGA LGG -0.088; TCGA LUAD -0.083; TCGA LUSC -0.072; TCGA PRAD -0.106; TCGA SARC -0.104; TCGA THCA -0.055; TCGA STAD -0.123; TCGA UCEC -0.124
hsa-miR-590-3p
NPR3
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.47; TCGA BRCA -0.183; TCGA COAD -1; TCGA HNSC -0.392; TCGA KIRC -0.373; TCGA LUAD -0.293; TCGA LUSC -0.395; TCGA PAAD -0.749; TCGA THCA -0.36; TCGA STAD -0.771; TCGA UCEC -0.396
hsa-miR-590-3p
DYNC1LI2
12 cancers: BLCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.097; TCGA CESC -0.149; TCGA ESCA -0.139; TCGA HNSC -0.069; TCGA LUAD -0.09; TCGA LUSC -0.105; TCGA PAAD -0.113; TCGA PRAD -0.103; TCGA SARC -0.126; TCGA THCA -0.069; TCGA STAD -0.233; TCGA UCEC -0.111
hsa-miR-590-3p
FAM122A
9 cancers: BLCA; BRCA; KIRC; KIRP; LUAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.064; TCGA BRCA -0.11; TCGA KIRC -0.203; TCGA KIRP -0.14; TCGA LUAD -0.093; TCGA PRAD -0.081; TCGA SARC -0.083; TCGA STAD -0.123; TCGA UCEC -0.129
hsa-miR-590-3p
SH3BGRL
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.399; TCGA BRCA -0.148; TCGA CESC -0.236; TCGA COAD -0.241; TCGA ESCA -0.274; TCGA HNSC -0.153; TCGA KIRP -0.088; TCGA LUAD -0.102; TCGA LUSC -0.297; TCGA PAAD -0.1; TCGA PRAD -0.159; TCGA SARC -0.353; TCGA STAD -0.437; TCGA UCEC -0.318
hsa-miR-590-3p
FNDC3A
12 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.122; TCGA BRCA -0.111; TCGA CESC -0.242; TCGA COAD -0.106; TCGA KIRC -0.147; TCGA KIRP -0.112; TCGA LUAD -0.062; TCGA LUSC -0.208; TCGA PRAD -0.202; TCGA THCA -0.066; TCGA STAD -0.089; TCGA UCEC -0.14
hsa-miR-590-3p
TRPS1
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; PAAD; PRAD; STAD
MirTarget; PITA; miRanda
TCGA BLCA -0.309; TCGA CESC -0.319; TCGA COAD -0.532; TCGA HNSC -0.2; TCGA KIRC -0.175; TCGA KIRP -0.174; TCGA PAAD -0.36; TCGA PRAD -0.186; TCGA STAD -0.552
hsa-miR-590-3p
NFAT5
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.112; TCGA BRCA -0.101; TCGA CESC -0.095; TCGA ESCA -0.099; TCGA HNSC -0.098; TCGA KIRC -0.255; TCGA KIRP -0.181; TCGA LUAD -0.116; TCGA LUSC -0.129; TCGA PAAD -0.082; TCGA PRAD -0.141; TCGA SARC -0.147; TCGA THCA -0.091; TCGA STAD -0.181; TCGA UCEC -0.102
hsa-miR-590-3p
PICALM
9 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.06; TCGA COAD -0.053; TCGA HNSC -0.061; TCGA KIRC -0.072; TCGA KIRP -0.114; TCGA LUSC -0.096; TCGA PAAD -0.143; TCGA STAD -0.114; TCGA UCEC -0.084
hsa-miR-590-3p
SSPN
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.43; TCGA BRCA -0.304; TCGA CESC -0.303; TCGA COAD -0.502; TCGA ESCA -0.529; TCGA HNSC -0.306; TCGA LUAD -0.122; TCGA LUSC -0.443; TCGA PAAD -0.411; TCGA PRAD -0.347; TCGA SARC -0.223; TCGA THCA -0.137; TCGA STAD -0.627; TCGA UCEC -0.385
hsa-miR-590-3p
ANKS1B
9 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LGG; PRAD; SARC; STAD
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.666; TCGA BRCA -0.203; TCGA CESC -0.369; TCGA ESCA -0.638; TCGA KIRP -0.419; TCGA LGG -0.122; TCGA PRAD -0.124; TCGA SARC -0.795; TCGA STAD -0.26
hsa-miR-590-3p
SESTD1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; PITA; miRNATAP
TCGA BLCA -0.262; TCGA BRCA -0.08; TCGA CESC -0.177; TCGA COAD -0.088; TCGA ESCA -0.17; TCGA KIRC -0.16; TCGA KIRP -0.224; TCGA LUAD -0.14; TCGA LUSC -0.176; TCGA PAAD -0.186; TCGA PRAD -0.16; TCGA SARC -0.279; TCGA STAD -0.26
hsa-miR-590-3p
TM4SF18
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUSC; THCA; STAD; UCEC
MirTarget
TCGA BLCA -0.178; TCGA BRCA -0.206; TCGA CESC -0.351; TCGA COAD -0.274; TCGA HNSC -0.122; TCGA LUSC -0.446; TCGA THCA -0.164; TCGA STAD -0.087; TCGA UCEC -0.403
hsa-miR-590-3p
NEXN
13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.67; TCGA BRCA -0.21; TCGA COAD -0.695; TCGA ESCA -0.597; TCGA KIRC -0.177; TCGA KIRP -0.197; TCGA LUAD -0.185; TCGA LUSC -0.651; TCGA PAAD -0.513; TCGA PRAD -0.473; TCGA SARC -0.511; TCGA STAD -0.939; TCGA UCEC -0.627
hsa-miR-590-3p
DNM3
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.281; TCGA BRCA -0.169; TCGA CESC -0.444; TCGA COAD -0.433; TCGA ESCA -0.31; TCGA KIRC -0.487; TCGA KIRP -0.372; TCGA LGG -0.21; TCGA LIHC -0.293; TCGA LUAD -0.153; TCGA LUSC -0.413; TCGA PAAD -0.139; TCGA PRAD -0.145; TCGA SARC -0.196; TCGA THCA -0.177; TCGA STAD -0.224; TCGA UCEC -0.388
hsa-miR-590-3p
AASS
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LUAD; PAAD; SARC; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.3; TCGA BRCA -0.377; TCGA COAD -0.239; TCGA ESCA -0.173; TCGA KIRC -0.252; TCGA LUAD -0.159; TCGA PAAD -0.165; TCGA SARC -0.106; TCGA STAD -0.504; TCGA UCEC -0.286
hsa-miR-590-3p
RCOR3
11 cancers: BLCA; BRCA; CESC; ESCA; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.063; TCGA BRCA -0.094; TCGA CESC -0.077; TCGA ESCA -0.094; TCGA LGG -0.07; TCGA LUAD -0.061; TCGA PRAD -0.087; TCGA SARC -0.249; TCGA THCA -0.062; TCGA STAD -0.18; TCGA UCEC -0.099
hsa-miR-590-3p
NCAM2
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.605; TCGA BRCA -0.477; TCGA COAD -1.048; TCGA ESCA -0.847; TCGA HNSC -0.335; TCGA KIRC -0.559; TCGA LGG -0.207; TCGA LUAD -0.279; TCGA LUSC -0.701; TCGA PAAD -0.475; TCGA STAD -0.743; TCGA UCEC -0.348
hsa-miR-590-3p
MBNL1
9 cancers: BLCA; COAD; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.178; TCGA COAD -0.078; TCGA LUAD -0.113; TCGA LUSC -0.057; TCGA PAAD -0.084; TCGA PRAD -0.124; TCGA SARC -0.253; TCGA STAD -0.276; TCGA UCEC -0.148
hsa-miR-590-3p
CYP1B1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.374; TCGA CESC -0.28; TCGA COAD -0.766; TCGA ESCA -0.83; TCGA HNSC -0.235; TCGA KIRC -0.312; TCGA LUSC -0.41; TCGA PAAD -0.428; TCGA PRAD -0.327; TCGA SARC -0.595; TCGA STAD -0.748; TCGA UCEC -0.444
hsa-miR-590-3p
ZMYND11
13 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.163; TCGA CESC -0.142; TCGA ESCA -0.159; TCGA KIRC -0.255; TCGA KIRP -0.195; TCGA LGG -0.131; TCGA LUAD -0.067; TCGA LUSC -0.099; TCGA PRAD -0.149; TCGA SARC -0.192; TCGA THCA -0.06; TCGA STAD -0.247; TCGA UCEC -0.151
hsa-miR-590-3p
SLC6A1
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.154; TCGA BRCA -0.104; TCGA CESC -0.328; TCGA COAD -0.294; TCGA HNSC -0.243; TCGA LGG -0.347; TCGA LUAD -0.185; TCGA LUSC -0.515; TCGA PAAD -0.209; TCGA THCA -0.393; TCGA STAD -0.346; TCGA UCEC -0.237
hsa-miR-590-3p
GCNT4
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.202; TCGA BRCA -0.413; TCGA CESC -0.343; TCGA COAD -0.388; TCGA ESCA -0.358; TCGA HNSC -0.202; TCGA KIRC -0.745; TCGA KIRP -0.615; TCGA LUAD -0.319; TCGA LUSC -0.432; TCGA PRAD -0.536; TCGA SARC -0.681; TCGA STAD -0.26; TCGA UCEC -0.376
hsa-miR-590-3p
HMCN1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.419; TCGA BRCA -0.418; TCGA CESC -0.318; TCGA COAD -0.924; TCGA ESCA -0.584; TCGA HNSC -0.481; TCGA KIRP -0.291; TCGA LUAD -0.439; TCGA LUSC -0.682; TCGA PAAD -0.637; TCGA PRAD -0.312; TCGA STAD -0.635
hsa-miR-590-3p
NCOA1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.063; TCGA BRCA -0.085; TCGA CESC -0.142; TCGA COAD -0.081; TCGA ESCA -0.1; TCGA HNSC -0.122; TCGA KIRC -0.214; TCGA KIRP -0.199; TCGA LGG -0.098; TCGA LUAD -0.13; TCGA PRAD -0.139; TCGA SARC -0.088; TCGA STAD -0.168; TCGA UCEC -0.08
hsa-miR-590-3p
FOXP2
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.794; TCGA BRCA -0.46; TCGA COAD -0.866; TCGA ESCA -0.631; TCGA HNSC -0.386; TCGA PAAD -0.336; TCGA PRAD -0.718; TCGA SARC -0.433; TCGA STAD -1.187; TCGA UCEC -0.502
hsa-miR-590-3p
MPDZ
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.323; TCGA BRCA -0.24; TCGA CESC -0.313; TCGA COAD -0.786; TCGA ESCA -0.464; TCGA HNSC -0.238; TCGA KIRC -0.306; TCGA KIRP -0.186; TCGA LGG -0.065; TCGA LUAD -0.206; TCGA LUSC -0.381; TCGA PAAD -0.277; TCGA PRAD -0.236; TCGA SARC -0.463; TCGA THCA -0.216; TCGA STAD -0.761; TCGA UCEC -0.254
hsa-miR-590-3p
TRAK2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.237; TCGA BRCA -0.115; TCGA CESC -0.151; TCGA COAD -0.11; TCGA ESCA -0.187; TCGA HNSC -0.071; TCGA KIRC -0.213; TCGA KIRP -0.134; TCGA LUAD -0.107; TCGA LUSC -0.238; TCGA PAAD -0.119; TCGA PRAD -0.083; TCGA SARC -0.149; TCGA STAD -0.234; TCGA UCEC -0.069
hsa-miR-590-3p
PKIA
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LGG; PAAD; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.149; TCGA BRCA -0.142; TCGA COAD -0.578; TCGA HNSC -0.315; TCGA KIRC -0.464; TCGA LGG -0.293; TCGA PAAD -0.21; TCGA THCA -0.191; TCGA STAD -0.592; TCGA UCEC -0.664
hsa-miR-590-3p
MIPOL1
10 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LGG; PAAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.095; TCGA CESC -0.298; TCGA ESCA -0.185; TCGA KIRC -0.33; TCGA KIRP -0.387; TCGA LGG -0.226; TCGA PAAD -0.176; TCGA SARC -0.479; TCGA STAD -0.306; TCGA UCEC -0.152
hsa-miR-590-3p
ADCYAP1
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.712; TCGA BRCA -0.297; TCGA COAD -1.038; TCGA ESCA -0.761; TCGA KIRC -0.23; TCGA LUAD -0.398; TCGA LUSC -0.384; TCGA PAAD -0.472; TCGA PRAD -0.257; TCGA SARC -0.706; TCGA STAD -0.85; TCGA UCEC -0.709
hsa-miR-590-3p
WDR26
10 cancers: BLCA; CESC; HNSC; KIRP; LGG; LIHC; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.054; TCGA CESC -0.062; TCGA HNSC -0.111; TCGA KIRP -0.062; TCGA LGG -0.071; TCGA LIHC -0.089; TCGA PRAD -0.059; TCGA SARC -0.113; TCGA STAD -0.166; TCGA UCEC -0.055
hsa-miR-590-3p
ZNF503
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.085; TCGA BRCA -0.16; TCGA COAD -0.224; TCGA ESCA -0.164; TCGA HNSC -0.168; TCGA KIRC -0.505; TCGA LIHC -0.196; TCGA LUSC -0.116; TCGA PAAD -0.167; TCGA STAD -0.232; TCGA UCEC -0.126
hsa-miR-590-3p
LRP2BP
9 cancers: BLCA; BRCA; CESC; LGG; LUAD; LUSC; SARC; THCA; STAD
MirTarget; miRanda
TCGA BLCA -0.092; TCGA BRCA -0.198; TCGA CESC -0.119; TCGA LGG -0.174; TCGA LUAD -0.291; TCGA LUSC -0.341; TCGA SARC -0.194; TCGA THCA -0.104; TCGA STAD -0.331
hsa-miR-590-3p
PABPC5
14 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.564; TCGA BRCA -0.345; TCGA COAD -0.584; TCGA ESCA -0.491; TCGA KIRC -0.314; TCGA LGG -0.415; TCGA LUAD -0.212; TCGA LUSC -0.651; TCGA PAAD -0.209; TCGA PRAD -0.245; TCGA SARC -0.607; TCGA THCA -0.128; TCGA STAD -0.742; TCGA UCEC -0.565
hsa-miR-590-3p
ZNF665
13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.26; TCGA BRCA -0.176; TCGA COAD -0.343; TCGA ESCA -0.294; TCGA KIRC -0.138; TCGA KIRP -0.213; TCGA LUAD -0.163; TCGA LUSC -0.437; TCGA PRAD -0.147; TCGA SARC -0.307; TCGA THCA -0.116; TCGA STAD -0.51; TCGA UCEC -0.163
hsa-miR-590-3p
TMEM106B
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.064; TCGA BRCA -0.072; TCGA CESC -0.129; TCGA HNSC -0.101; TCGA KIRC -0.11; TCGA LGG -0.088; TCGA PRAD -0.204; TCGA SARC -0.105; TCGA THCA -0.076; TCGA STAD -0.103; TCGA UCEC -0.243
hsa-miR-590-3p
TEAD1
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.266; TCGA BRCA -0.196; TCGA CESC -0.196; TCGA COAD -0.163; TCGA ESCA -0.197; TCGA HNSC -0.124; TCGA KIRC -0.166; TCGA KIRP -0.219; TCGA LGG -0.128; TCGA LUAD -0.114; TCGA LUSC -0.151; TCGA PAAD -0.299; TCGA PRAD -0.302; TCGA SARC -0.241; TCGA THCA -0.141; TCGA STAD -0.539; TCGA UCEC -0.181
hsa-miR-590-3p
AKAP6
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.775; TCGA BRCA -0.203; TCGA CESC -0.356; TCGA COAD -0.417; TCGA ESCA -0.618; TCGA HNSC -0.416; TCGA KIRC -0.346; TCGA LGG -0.194; TCGA LUAD -0.169; TCGA LUSC -0.374; TCGA PRAD -0.265; TCGA SARC -0.708; TCGA THCA -0.16; TCGA STAD -1.152; TCGA UCEC -0.233
hsa-miR-590-3p
CFL2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.444; TCGA BRCA -0.121; TCGA CESC -0.167; TCGA COAD -0.379; TCGA ESCA -0.312; TCGA KIRC -0.083; TCGA LUSC -0.225; TCGA PAAD -0.134; TCGA PRAD -0.288; TCGA SARC -0.298; TCGA STAD -0.819; TCGA UCEC -0.275
hsa-miR-590-3p
SEMA3D
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; LUAD; PAAD; PRAD; STAD
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.389; TCGA BRCA -0.497; TCGA CESC -0.591; TCGA COAD -0.909; TCGA HNSC -0.368; TCGA KIRC -0.635; TCGA LGG -0.305; TCGA LUAD -0.286; TCGA PAAD -0.346; TCGA PRAD -0.476; TCGA STAD -0.6
hsa-miR-590-3p
PCYOX1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.057; TCGA BRCA -0.139; TCGA CESC -0.128; TCGA COAD -0.073; TCGA ESCA -0.111; TCGA HNSC -0.149; TCGA KIRC -0.268; TCGA KIRP -0.322; TCGA LUAD -0.184; TCGA LUSC -0.184; TCGA PAAD -0.157; TCGA PRAD -0.168; TCGA SARC -0.166; TCGA THCA -0.156; TCGA STAD -0.235; TCGA UCEC -0.176
hsa-miR-590-3p
NBEAL1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
MirTarget; miRanda; mirMAP
TCGA BLCA -0.115; TCGA BRCA -0.246; TCGA CESC -0.227; TCGA COAD -0.13; TCGA ESCA -0.185; TCGA HNSC -0.259; TCGA KIRC -0.522; TCGA KIRP -0.512; TCGA LUAD -0.278; TCGA LUSC -0.293; TCGA PAAD -0.365; TCGA PRAD -0.31; TCGA SARC -0.365; TCGA THCA -0.198; TCGA STAD -0.112
hsa-miR-590-3p
DACT3
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.883; TCGA BRCA -0.293; TCGA CESC -0.449; TCGA COAD -0.756; TCGA ESCA -0.685; TCGA HNSC -0.345; TCGA LIHC -0.248; TCGA LUAD -0.262; TCGA LUSC -0.541; TCGA PAAD -0.291; TCGA PRAD -0.34; TCGA SARC -0.832; TCGA THCA -0.145; TCGA STAD -0.926; TCGA UCEC -0.742
hsa-miR-590-3p
POLK
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.125; TCGA BRCA -0.15; TCGA CESC -0.181; TCGA COAD -0.097; TCGA ESCA -0.143; TCGA KIRP -0.2; TCGA LUAD -0.078; TCGA LUSC -0.18; TCGA PAAD -0.146; TCGA PRAD -0.164; TCGA SARC -0.193; TCGA THCA -0.072; TCGA STAD -0.222; TCGA UCEC -0.105
hsa-miR-590-3p
BNIP3L
10 cancers: BLCA; BRCA; CESC; HNSC; LUAD; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.099; TCGA BRCA -0.188; TCGA CESC -0.175; TCGA HNSC -0.083; TCGA LUAD -0.093; TCGA PAAD -0.083; TCGA PRAD -0.147; TCGA THCA -0.051; TCGA STAD -0.111; TCGA UCEC -0.072
hsa-miR-590-3p
ABCA6
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.474; TCGA BRCA -0.592; TCGA CESC -0.253; TCGA COAD -0.716; TCGA ESCA -0.838; TCGA HNSC -0.18; TCGA KIRC -0.496; TCGA LUAD -0.336; TCGA LUSC -0.759; TCGA PAAD -0.358; TCGA PRAD -0.156; TCGA STAD -0.666; TCGA UCEC -0.26
hsa-miR-590-3p
ZC3H12C
10 cancers: BLCA; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.093; TCGA KIRC -0.098; TCGA KIRP -0.133; TCGA LUSC -0.181; TCGA PAAD -0.154; TCGA PRAD -0.136; TCGA SARC -0.199; TCGA THCA -0.085; TCGA STAD -0.272; TCGA UCEC -0.35
hsa-miR-590-3p
GLRB
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; PAAD; PRAD; THCA; STAD
MirTarget; PITA; miRanda
TCGA BLCA -0.228; TCGA BRCA -0.424; TCGA CESC -0.481; TCGA COAD -0.808; TCGA ESCA -0.33; TCGA HNSC -0.312; TCGA KIRC -0.695; TCGA LGG -0.305; TCGA PAAD -0.439; TCGA PRAD -0.281; TCGA THCA -0.262; TCGA STAD -0.769
hsa-miR-590-3p
ZEB2
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.431; TCGA BRCA -0.202; TCGA COAD -0.515; TCGA ESCA -0.3; TCGA HNSC -0.154; TCGA LUAD -0.181; TCGA LUSC -0.579; TCGA PAAD -0.263; TCGA PRAD -0.254; TCGA STAD -0.357; TCGA UCEC -0.255
hsa-miR-590-3p
DENND4C
14 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.066; TCGA BRCA -0.137; TCGA CESC -0.135; TCGA ESCA -0.134; TCGA KIRC -0.095; TCGA KIRP -0.096; TCGA LGG -0.115; TCGA LUAD -0.096; TCGA LUSC -0.155; TCGA PRAD -0.135; TCGA SARC -0.249; TCGA THCA -0.088; TCGA STAD -0.13; TCGA UCEC -0.129
hsa-miR-590-3p
ATE1
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA
MirTarget; miRanda; mirMAP
TCGA BLCA -0.168; TCGA BRCA -0.129; TCGA CESC -0.18; TCGA HNSC -0.137; TCGA KIRC -0.394; TCGA KIRP -0.493; TCGA LGG -0.167; TCGA LUAD -0.097; TCGA PAAD -0.2; TCGA PRAD -0.286; TCGA SARC -0.257; TCGA THCA -0.149
hsa-miR-590-3p
ATP8B2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.372; TCGA BRCA -0.234; TCGA CESC -0.204; TCGA COAD -0.493; TCGA ESCA -0.342; TCGA HNSC -0.141; TCGA LUAD -0.111; TCGA LUSC -0.267; TCGA PRAD -0.116; TCGA SARC -0.252; TCGA STAD -0.472; TCGA UCEC -0.3
hsa-miR-590-3p
FAM19A2
10 cancers: BLCA; BRCA; COAD; ESCA; LGG; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.311; TCGA BRCA -0.186; TCGA COAD -0.218; TCGA ESCA -0.335; TCGA LGG -0.629; TCGA LUAD -0.152; TCGA LUSC -0.246; TCGA PRAD -0.289; TCGA STAD -0.273; TCGA UCEC -0.306
hsa-miR-590-3p
CWF19L2
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.085; TCGA BRCA -0.068; TCGA CESC -0.108; TCGA ESCA -0.128; TCGA KIRC -0.19; TCGA KIRP -0.207; TCGA LGG -0.052; TCGA PAAD -0.076; TCGA PRAD -0.091; TCGA SARC -0.097; TCGA STAD -0.191; TCGA UCEC -0.208
hsa-miR-590-3p
MTMR10
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.135; TCGA BRCA -0.2; TCGA CESC -0.106; TCGA HNSC -0.094; TCGA KIRC -0.342; TCGA KIRP -0.092; TCGA LUAD -0.146; TCGA LUSC -0.087; TCGA PRAD -0.058; TCGA SARC -0.073; TCGA STAD -0.171; TCGA UCEC -0.125
hsa-miR-590-3p
PPP2R3A
11 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.117; TCGA COAD -0.266; TCGA HNSC -0.215; TCGA KIRC -0.258; TCGA KIRP -0.233; TCGA LUAD -0.122; TCGA PAAD -0.294; TCGA PRAD -0.113; TCGA THCA -0.085; TCGA STAD -0.514; TCGA UCEC -0.237
hsa-miR-590-3p
ACVR2A
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.097; TCGA BRCA -0.128; TCGA CESC -0.1; TCGA HNSC -0.109; TCGA KIRC -0.189; TCGA KIRP -0.073; TCGA LGG -0.129; TCGA LUAD -0.105; TCGA PAAD -0.117; TCGA PRAD -0.071; TCGA STAD -0.182; TCGA UCEC -0.194
hsa-miR-590-3p
EIF4E3
11 cancers: BLCA; BRCA; ESCA; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.216; TCGA BRCA -0.239; TCGA ESCA -0.246; TCGA KIRP -0.082; TCGA LUAD -0.174; TCGA LUSC -0.343; TCGA PAAD -0.096; TCGA PRAD -0.132; TCGA SARC -0.166; TCGA STAD -0.398; TCGA UCEC -0.153
hsa-miR-590-3p
GPHN
9 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LGG; LUAD; SARC; THCA
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.108; TCGA BRCA -0.071; TCGA CESC -0.095; TCGA ESCA -0.117; TCGA KIRC -0.344; TCGA LGG -0.155; TCGA LUAD -0.08; TCGA SARC -0.125; TCGA THCA -0.095
hsa-miR-590-3p
ABCD2
9 cancers: BLCA; BRCA; COAD; ESCA; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.349; TCGA BRCA -0.246; TCGA COAD -0.323; TCGA ESCA -0.436; TCGA LUSC -0.347; TCGA PRAD -0.378; TCGA SARC -0.258; TCGA STAD -0.294; TCGA UCEC -0.344
hsa-miR-590-3p
SH3GLB1
9 cancers: BLCA; CESC; HNSC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.073; TCGA CESC -0.066; TCGA HNSC -0.063; TCGA KIRP -0.077; TCGA LUSC -0.123; TCGA PAAD -0.129; TCGA PRAD -0.095; TCGA STAD -0.157; TCGA UCEC -0.078
hsa-miR-590-3p
DCAF8
10 cancers: BLCA; BRCA; ESCA; KIRC; LGG; LIHC; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.064; TCGA BRCA -0.078; TCGA ESCA -0.088; TCGA KIRC -0.067; TCGA LGG -0.054; TCGA LIHC -0.078; TCGA SARC -0.196; TCGA THCA -0.061; TCGA STAD -0.118; TCGA UCEC -0.07
hsa-miR-590-3p
EIF4A2
10 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.076; TCGA BRCA -0.055; TCGA CESC -0.122; TCGA KIRC -0.084; TCGA KIRP -0.115; TCGA LGG -0.092; TCGA SARC -0.176; TCGA THCA -0.05; TCGA STAD -0.129; TCGA UCEC -0.152
hsa-miR-590-3p
MXRA5
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.34; TCGA BRCA -0.101; TCGA COAD -0.599; TCGA ESCA -0.255; TCGA HNSC -0.447; TCGA KIRC -0.491; TCGA LUSC -0.341; TCGA PAAD -0.679; TCGA PRAD -0.268; TCGA UCEC -0.139
hsa-miR-590-3p
SYT15
13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.248; TCGA BRCA -0.262; TCGA COAD -0.364; TCGA ESCA -0.403; TCGA KIRC -0.415; TCGA KIRP -0.205; TCGA LGG -0.18; TCGA LUAD -0.362; TCGA LUSC -0.636; TCGA PRAD -0.214; TCGA SARC -0.278; TCGA STAD -0.666; TCGA UCEC -0.162
hsa-miR-590-3p
GPM6B
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; STAD
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.264; TCGA CESC -0.175; TCGA COAD -0.434; TCGA ESCA -0.335; TCGA HNSC -0.175; TCGA KIRC -0.942; TCGA LGG -0.135; TCGA LUAD -0.192; TCGA LUSC -0.412; TCGA PRAD -0.2; TCGA STAD -0.779
hsa-miR-590-3p
EIF4B
10 cancers: BLCA; BRCA; CESC; KIRP; LGG; LUAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.108; TCGA BRCA -0.157; TCGA CESC -0.079; TCGA KIRP -0.131; TCGA LGG -0.147; TCGA LUAD -0.081; TCGA SARC -0.133; TCGA THCA -0.052; TCGA STAD -0.081; TCGA UCEC -0.14
hsa-miR-590-3p
CTTNBP2
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LUAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.471; TCGA BRCA -0.65; TCGA CESC -0.439; TCGA COAD -0.252; TCGA HNSC -0.321; TCGA LGG -0.275; TCGA LUAD -0.278; TCGA PRAD -0.446; TCGA SARC -0.389; TCGA STAD -0.589; TCGA UCEC -0.188
hsa-miR-590-3p
ZYG11B
14 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.073; TCGA CESC -0.151; TCGA ESCA -0.137; TCGA HNSC -0.084; TCGA KIRC -0.157; TCGA KIRP -0.075; TCGA LUAD -0.059; TCGA LUSC -0.079; TCGA PAAD -0.093; TCGA PRAD -0.108; TCGA SARC -0.114; TCGA THCA -0.077; TCGA STAD -0.297; TCGA UCEC -0.169
hsa-miR-590-3p
RAB11FIP2
15 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.14; TCGA BRCA -0.151; TCGA CESC -0.165; TCGA COAD -0.15; TCGA KIRC -0.281; TCGA KIRP -0.234; TCGA LGG -0.155; TCGA LUAD -0.173; TCGA LUSC -0.215; TCGA PAAD -0.09; TCGA PRAD -0.188; TCGA SARC -0.154; TCGA THCA -0.084; TCGA STAD -0.237; TCGA UCEC -0.449
hsa-miR-590-3p
WWTR1
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD
MirTarget; miRanda; mirMAP
TCGA BLCA -0.312; TCGA CESC -0.246; TCGA COAD -0.574; TCGA ESCA -0.353; TCGA HNSC -0.156; TCGA KIRC -0.125; TCGA KIRP -0.361; TCGA LUAD -0.086; TCGA PAAD -0.426; TCGA PRAD -0.327; TCGA SARC -0.315; TCGA THCA -0.168; TCGA STAD -0.597
hsa-miR-590-3p
ARID4A
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.134; TCGA BRCA -0.153; TCGA CESC -0.158; TCGA COAD -0.064; TCGA ESCA -0.133; TCGA KIRC -0.077; TCGA KIRP -0.132; TCGA LGG -0.104; TCGA LUAD -0.143; TCGA LUSC -0.162; TCGA PRAD -0.118; TCGA SARC -0.202; TCGA STAD -0.224; TCGA UCEC -0.149
hsa-miR-590-3p
NDFIP1
11 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.098; TCGA BRCA -0.091; TCGA CESC -0.056; TCGA KIRC -0.163; TCGA KIRP -0.167; TCGA LGG -0.054; TCGA LIHC -0.123; TCGA LUAD -0.06; TCGA LUSC -0.096; TCGA THCA -0.066; TCGA UCEC -0.089
hsa-miR-590-3p
RUFY2
12 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.073; TCGA BRCA -0.11; TCGA CESC -0.087; TCGA ESCA -0.082; TCGA KIRP -0.189; TCGA LGG -0.082; TCGA LUAD -0.066; TCGA LUSC -0.085; TCGA PRAD -0.055; TCGA SARC -0.061; TCGA STAD -0.183; TCGA UCEC -0.099
hsa-miR-590-3p
CDC73
10 cancers: BLCA; CESC; ESCA; HNSC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.091; TCGA CESC -0.064; TCGA ESCA -0.086; TCGA HNSC -0.064; TCGA KIRP -0.186; TCGA PAAD -0.113; TCGA PRAD -0.095; TCGA SARC -0.188; TCGA STAD -0.068; TCGA UCEC -0.103
hsa-miR-590-3p
CHD9
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.173; TCGA BRCA -0.169; TCGA CESC -0.222; TCGA COAD -0.151; TCGA ESCA -0.125; TCGA HNSC -0.128; TCGA KIRC -0.132; TCGA KIRP -0.213; TCGA LGG -0.168; TCGA LUAD -0.175; TCGA LUSC -0.221; TCGA PAAD -0.125; TCGA PRAD -0.185; TCGA SARC -0.167; TCGA THCA -0.093; TCGA STAD -0.22; TCGA UCEC -0.152
hsa-miR-590-3p
SERINC1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.213; TCGA BRCA -0.159; TCGA CESC -0.175; TCGA COAD -0.13; TCGA ESCA -0.167; TCGA HNSC -0.128; TCGA KIRC -0.174; TCGA KIRP -0.209; TCGA LGG -0.067; TCGA LUAD -0.115; TCGA LUSC -0.259; TCGA PRAD -0.161; TCGA SARC -0.125; TCGA THCA -0.109; TCGA STAD -0.236; TCGA UCEC -0.302
hsa-miR-590-3p
TM9SF3
9 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; PAAD; THCA; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.065; TCGA CESC -0.087; TCGA HNSC -0.059; TCGA KIRC -0.131; TCGA KIRP -0.19; TCGA LGG -0.093; TCGA PAAD -0.122; TCGA THCA -0.053; TCGA UCEC -0.125
hsa-miR-590-3p
HEATR5A
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; STAD
MirTarget; miRanda; mirMAP
TCGA BLCA -0.102; TCGA BRCA -0.061; TCGA CESC -0.213; TCGA ESCA -0.139; TCGA HNSC -0.114; TCGA KIRC -0.301; TCGA KIRP -0.178; TCGA LUSC -0.125; TCGA PAAD -0.106; TCGA PRAD -0.141; TCGA STAD -0.081
hsa-miR-590-3p
AFF1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.083; TCGA BRCA -0.21; TCGA CESC -0.156; TCGA COAD -0.064; TCGA ESCA -0.195; TCGA HNSC -0.073; TCGA KIRC -0.159; TCGA KIRP -0.265; TCGA LUAD -0.137; TCGA LUSC -0.175; TCGA PAAD -0.116; TCGA SARC -0.257; TCGA THCA -0.139; TCGA STAD -0.199; TCGA UCEC -0.127
hsa-miR-590-3p
LATS1
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.121; TCGA BRCA -0.132; TCGA CESC -0.255; TCGA COAD -0.103; TCGA HNSC -0.16; TCGA KIRC -0.239; TCGA KIRP -0.408; TCGA LGG -0.126; TCGA LUAD -0.079; TCGA LUSC -0.088; TCGA PAAD -0.191; TCGA PRAD -0.27; TCGA SARC -0.292; TCGA STAD -0.151
hsa-miR-590-3p
IL33
10 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.743; TCGA BRCA -0.489; TCGA COAD -0.329; TCGA ESCA -0.523; TCGA LUAD -0.3; TCGA LUSC -0.518; TCGA PRAD -0.309; TCGA SARC -0.783; TCGA STAD -0.641; TCGA UCEC -0.496
hsa-miR-590-3p
TRIP12
9 cancers: BLCA; COAD; HNSC; KIRC; KIRP; PRAD; SARC; THCA; STAD
MirTarget; miRanda
TCGA BLCA -0.051; TCGA COAD -0.055; TCGA HNSC -0.142; TCGA KIRC -0.124; TCGA KIRP -0.178; TCGA PRAD -0.113; TCGA SARC -0.053; TCGA THCA -0.076; TCGA STAD -0.051
hsa-miR-590-3p
WT1
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; PAAD; PRAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.357; TCGA CESC -0.606; TCGA COAD -0.391; TCGA HNSC -0.306; TCGA KIRC -0.499; TCGA KIRP -0.481; TCGA PAAD -0.514; TCGA PRAD -0.588; TCGA UCEC -0.649
hsa-miR-590-3p
SPATA13
10 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUAD; LUSC; PAAD; SARC
MirTarget; miRNATAP
TCGA BLCA -0.134; TCGA BRCA -0.155; TCGA CESC -0.409; TCGA COAD -0.146; TCGA KIRC -0.362; TCGA KIRP -0.426; TCGA LUAD -0.169; TCGA LUSC -0.409; TCGA PAAD -0.191; TCGA SARC -0.26
hsa-miR-590-3p
PPP1R2
10 cancers: BLCA; CESC; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.063; TCGA CESC -0.076; TCGA HNSC -0.054; TCGA KIRC -0.113; TCGA KIRP -0.074; TCGA PAAD -0.058; TCGA PRAD -0.061; TCGA SARC -0.07; TCGA STAD -0.091; TCGA UCEC -0.118
hsa-miR-590-3p
RERG
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.566; TCGA BRCA -0.439; TCGA CESC -0.49; TCGA COAD -0.802; TCGA ESCA -0.23; TCGA HNSC -0.233; TCGA LUAD -0.289; TCGA LUSC -0.29; TCGA PAAD -0.328; TCGA PRAD -0.314; TCGA SARC -0.647; TCGA THCA -0.131; TCGA STAD -0.927; TCGA UCEC -0.811
hsa-miR-590-3p
SSBP2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.196; TCGA BRCA -0.174; TCGA CESC -0.207; TCGA COAD -0.406; TCGA ESCA -0.27; TCGA KIRP -0.218; TCGA LUAD -0.187; TCGA PRAD -0.133; TCGA SARC -0.256; TCGA STAD -0.547; TCGA UCEC -0.201
hsa-miR-590-3p
EP300
10 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.059; TCGA CESC -0.137; TCGA HNSC -0.125; TCGA KIRC -0.09; TCGA KIRP -0.141; TCGA LGG -0.112; TCGA LUAD -0.131; TCGA PAAD -0.102; TCGA PRAD -0.139; TCGA SARC -0.143
hsa-miR-590-3p
HRASLS5
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.793; TCGA BRCA -0.583; TCGA COAD -0.521; TCGA ESCA -0.796; TCGA HNSC -0.257; TCGA KIRC -0.377; TCGA LUSC -0.449; TCGA PAAD -0.327; TCGA PRAD -0.597; TCGA SARC -0.719; TCGA STAD -0.556; TCGA UCEC -0.26
hsa-miR-590-3p
SH3RF1
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC
MirTarget; PITA; miRanda
TCGA BLCA -0.082; TCGA BRCA -0.088; TCGA CESC -0.119; TCGA HNSC -0.129; TCGA KIRC -0.26; TCGA KIRP -0.154; TCGA LUAD -0.105; TCGA LUSC -0.117; TCGA PAAD -0.175; TCGA SARC -0.13
hsa-miR-590-3p
PCDH17
12 cancers: BLCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.167; TCGA CESC -0.226; TCGA COAD -0.408; TCGA HNSC -0.243; TCGA KIRP -0.468; TCGA LGG -0.143; TCGA LUAD -0.211; TCGA LUSC -0.456; TCGA PRAD -0.172; TCGA THCA -0.232; TCGA STAD -0.196; TCGA UCEC -0.27
hsa-miR-590-3p
SMAD5
12 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.076; TCGA BRCA -0.115; TCGA CESC -0.094; TCGA KIRC -0.056; TCGA KIRP -0.11; TCGA LGG -0.082; TCGA LUAD -0.087; TCGA PRAD -0.121; TCGA SARC -0.168; TCGA THCA -0.083; TCGA STAD -0.174; TCGA UCEC -0.22
hsa-miR-590-3p
PHC3
10 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LGG; LUAD; PRAD; SARC; STAD
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.092; TCGA BRCA -0.066; TCGA CESC -0.118; TCGA ESCA -0.135; TCGA KIRP -0.079; TCGA LGG -0.073; TCGA LUAD -0.076; TCGA PRAD -0.128; TCGA SARC -0.221; TCGA STAD -0.187
hsa-miR-590-3p
KANK1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.293; TCGA BRCA -0.153; TCGA CESC -0.21; TCGA COAD -0.115; TCGA ESCA -0.212; TCGA HNSC -0.184; TCGA KIRC -0.157; TCGA LGG -0.142; TCGA LUAD -0.18; TCGA LUSC -0.166; TCGA PRAD -0.264; TCGA SARC -0.613; TCGA STAD -0.321; TCGA UCEC -0.207
hsa-miR-590-3p
LNPEP
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.095; TCGA BRCA -0.158; TCGA COAD -0.141; TCGA ESCA -0.225; TCGA HNSC -0.115; TCGA KIRC -0.322; TCGA KIRP -0.49; TCGA LUAD -0.09; TCGA LUSC -0.165; TCGA PAAD -0.183; TCGA PRAD -0.298; TCGA SARC -0.215; TCGA STAD -0.294
hsa-miR-590-3p
ARIH1
9 cancers: BLCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD
MirTarget; miRanda; mirMAP
TCGA BLCA -0.068; TCGA HNSC -0.065; TCGA KIRC -0.059; TCGA KIRP -0.157; TCGA PAAD -0.082; TCGA PRAD -0.085; TCGA SARC -0.114; TCGA THCA -0.05; TCGA STAD -0.101
hsa-miR-590-3p
ASH1L
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.118; TCGA BRCA -0.097; TCGA CESC -0.192; TCGA COAD -0.096; TCGA ESCA -0.137; TCGA HNSC -0.144; TCGA KIRC -0.223; TCGA KIRP -0.26; TCGA LGG -0.102; TCGA LUAD -0.134; TCGA LUSC -0.071; TCGA PAAD -0.103; TCGA PRAD -0.188; TCGA SARC -0.308; TCGA THCA -0.103; TCGA STAD -0.194; TCGA UCEC -0.153
hsa-miR-590-3p
KITLG
13 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.269; TCGA BRCA -0.285; TCGA ESCA -0.243; TCGA KIRC -0.612; TCGA KIRP -0.5; TCGA LGG -0.09; TCGA LUAD -0.197; TCGA LUSC -0.159; TCGA PAAD -0.524; TCGA PRAD -0.267; TCGA SARC -0.26; TCGA STAD -0.28; TCGA UCEC -0.377
hsa-miR-590-3p
NECAB1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.481; TCGA BRCA -0.377; TCGA CESC -0.347; TCGA COAD -0.713; TCGA ESCA -0.511; TCGA KIRC -0.361; TCGA LUAD -0.325; TCGA LUSC -0.639; TCGA PAAD -0.213; TCGA PRAD -0.453; TCGA SARC -0.399; TCGA STAD -1.103; TCGA UCEC -0.739
hsa-miR-590-3p
ATP8B4
9 cancers: BLCA; BRCA; COAD; ESCA; LUSC; PAAD; SARC; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.371; TCGA BRCA -0.147; TCGA COAD -0.282; TCGA ESCA -0.27; TCGA LUSC -0.264; TCGA PAAD -0.238; TCGA SARC -0.385; TCGA STAD -0.225; TCGA UCEC -0.333
hsa-miR-590-3p
ANO6
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.195; TCGA BRCA -0.219; TCGA CESC -0.158; TCGA COAD -0.123; TCGA ESCA -0.247; TCGA HNSC -0.154; TCGA KIRP -0.237; TCGA LUAD -0.137; TCGA LUSC -0.292; TCGA PAAD -0.313; TCGA PRAD -0.343; TCGA SARC -0.178; TCGA THCA -0.179; TCGA STAD -0.265; TCGA UCEC -0.289
hsa-miR-590-3p
ST8SIA1
9 cancers: BLCA; COAD; ESCA; HNSC; LGG; LUSC; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.413; TCGA COAD -0.581; TCGA ESCA -0.446; TCGA HNSC -0.191; TCGA LGG -0.213; TCGA LUSC -0.178; TCGA PRAD -0.332; TCGA STAD -0.467; TCGA UCEC -0.506
hsa-miR-590-3p
PDE8B
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; mirMAP
TCGA BLCA -0.236; TCGA BRCA -0.525; TCGA CESC -0.487; TCGA COAD -0.331; TCGA ESCA -0.287; TCGA KIRC -0.845; TCGA KIRP -0.268; TCGA LGG -0.238; TCGA LUAD -0.331; TCGA LUSC -0.283; TCGA PAAD -0.237; TCGA PRAD -0.582; TCGA SARC -0.666; TCGA THCA -0.208; TCGA STAD -0.58; TCGA UCEC -0.543
hsa-miR-590-3p
SGIP1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.231; TCGA BRCA -0.121; TCGA CESC -0.311; TCGA COAD -0.52; TCGA ESCA -0.314; TCGA HNSC -0.224; TCGA KIRC -0.365; TCGA KIRP -0.549; TCGA LUAD -0.198; TCGA LUSC -0.583; TCGA PAAD -0.337; TCGA SARC -0.545; TCGA STAD -0.464; TCGA UCEC -0.269
hsa-miR-590-3p
GALNT13
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.553; TCGA CESC -0.478; TCGA COAD -0.67; TCGA ESCA -0.479; TCGA HNSC -0.437; TCGA KIRC -0.351; TCGA KIRP -0.471; TCGA LGG -0.608; TCGA PRAD -0.321; TCGA SARC -0.507; TCGA THCA -0.328; TCGA STAD -0.866; TCGA UCEC -0.539
hsa-miR-590-3p
RGS7BP
14 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.541; TCGA BRCA -0.358; TCGA COAD -0.766; TCGA ESCA -0.74; TCGA KIRC -0.622; TCGA KIRP -0.639; TCGA LGG -0.329; TCGA LUAD -0.496; TCGA LUSC -0.447; TCGA PAAD -0.32; TCGA PRAD -0.584; TCGA SARC -0.903; TCGA STAD -0.67; TCGA UCEC -0.284
hsa-miR-590-3p
ATF2
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.115; TCGA CESC -0.225; TCGA COAD -0.089; TCGA ESCA -0.117; TCGA HNSC -0.124; TCGA KIRC -0.133; TCGA KIRP -0.399; TCGA LGG -0.081; TCGA PAAD -0.185; TCGA PRAD -0.223; TCGA SARC -0.224; TCGA STAD -0.091
hsa-miR-590-3p
TMEM108
12 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.647; TCGA COAD -0.336; TCGA ESCA -0.351; TCGA HNSC -0.317; TCGA KIRP -0.772; TCGA LGG -0.219; TCGA LUAD -0.405; TCGA LUSC -0.41; TCGA PRAD -0.447; TCGA SARC -0.503; TCGA STAD -0.429; TCGA UCEC -0.528
hsa-miR-590-3p
VGLL3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.276; TCGA BRCA -0.251; TCGA CESC -0.408; TCGA COAD -0.721; TCGA ESCA -0.38; TCGA HNSC -0.38; TCGA KIRC -0.407; TCGA LUAD -0.24; TCGA LUSC -0.86; TCGA PAAD -0.611; TCGA STAD -0.501; TCGA UCEC -0.59
hsa-miR-590-3p
TM6SF1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.178; TCGA BRCA -0.128; TCGA CESC -0.126; TCGA COAD -0.457; TCGA ESCA -0.209; TCGA LUAD -0.184; TCGA LUSC -0.422; TCGA PAAD -0.226; TCGA PRAD -0.076; TCGA STAD -0.328; TCGA UCEC -0.25
hsa-miR-590-3p
EEF2K
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD
MirTarget; miRanda; mirMAP
TCGA BLCA -0.11; TCGA BRCA -0.129; TCGA CESC -0.086; TCGA ESCA -0.109; TCGA HNSC -0.058; TCGA LUAD -0.114; TCGA LUSC -0.072; TCGA PAAD -0.077; TCGA PRAD -0.095; TCGA SARC -0.149; TCGA STAD -0.066
hsa-miR-590-3p
TMEM170B
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; STAD; UCEC
MirTarget
TCGA BLCA -0.138; TCGA BRCA -0.163; TCGA CESC -0.25; TCGA COAD -0.242; TCGA HNSC -0.164; TCGA KIRC -0.094; TCGA LGG -0.2; TCGA LUAD -0.102; TCGA LUSC -0.179; TCGA PRAD -0.063; TCGA STAD -0.428; TCGA UCEC -0.232
hsa-miR-590-3p
SGMS1
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; UCEC
MirTarget; miRanda
TCGA BLCA -0.072; TCGA BRCA -0.072; TCGA ESCA -0.115; TCGA HNSC -0.09; TCGA KIRC -0.277; TCGA KIRP -0.245; TCGA LGG -0.109; TCGA LUAD -0.177; TCGA LUSC -0.169; TCGA UCEC -0.141
hsa-miR-590-3p
REV3L
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.212; TCGA BRCA -0.067; TCGA CESC -0.26; TCGA COAD -0.122; TCGA ESCA -0.135; TCGA KIRC -0.087; TCGA KIRP -0.161; TCGA LGG -0.084; TCGA LUAD -0.184; TCGA LUSC -0.166; TCGA PRAD -0.282; TCGA SARC -0.272; TCGA THCA -0.078; TCGA STAD -0.259; TCGA UCEC -0.222
hsa-miR-590-3p
PLXDC2
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.451; TCGA BRCA -0.068; TCGA COAD -0.569; TCGA ESCA -0.349; TCGA HNSC -0.286; TCGA LUAD -0.23; TCGA LUSC -0.533; TCGA PAAD -0.533; TCGA PRAD -0.129; TCGA STAD -0.408; TCGA UCEC -0.139
hsa-miR-590-3p
GULP1
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.361; TCGA BRCA -0.346; TCGA CESC -0.563; TCGA COAD -0.433; TCGA HNSC -0.299; TCGA KIRC -0.335; TCGA PAAD -0.347; TCGA PRAD -0.192; TCGA SARC -0.251; TCGA STAD -0.298; TCGA UCEC -0.237
hsa-miR-590-3p
DGKB
9 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LGG; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.932; TCGA COAD -0.562; TCGA ESCA -1.037; TCGA KIRC -0.275; TCGA KIRP -0.382; TCGA LGG -0.401; TCGA SARC -0.31; TCGA STAD -1.147; TCGA UCEC -0.752
hsa-miR-590-3p
ARPP19
9 cancers: BLCA; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.068; TCGA KIRC -0.09; TCGA KIRP -0.125; TCGA LGG -0.053; TCGA PAAD -0.084; TCGA PRAD -0.101; TCGA SARC -0.122; TCGA STAD -0.134; TCGA UCEC -0.078
hsa-miR-590-3p
FEM1C
10 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LUAD; LUSC; PRAD; SARC; STAD
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.102; TCGA BRCA -0.096; TCGA CESC -0.076; TCGA ESCA -0.131; TCGA KIRP -0.11; TCGA LUAD -0.104; TCGA LUSC -0.1; TCGA PRAD -0.113; TCGA SARC -0.093; TCGA STAD -0.169
hsa-miR-590-3p
ZNF407
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.121; TCGA BRCA -0.099; TCGA CESC -0.116; TCGA ESCA -0.106; TCGA HNSC -0.097; TCGA KIRC -0.148; TCGA KIRP -0.139; TCGA LGG -0.052; TCGA LUAD -0.12; TCGA LUSC -0.067; TCGA PRAD -0.128; TCGA SARC -0.23; TCGA THCA -0.087; TCGA STAD -0.156; TCGA UCEC -0.107
hsa-miR-590-3p
COBLL1
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; PAAD; SARC; THCA
MirTarget; miRanda; mirMAP
TCGA BLCA -0.219; TCGA BRCA -0.182; TCGA HNSC -0.192; TCGA KIRC -0.792; TCGA KIRP -0.524; TCGA LUAD -0.175; TCGA PAAD -0.154; TCGA SARC -0.47; TCGA THCA -0.118
hsa-miR-590-3p
IGF1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.846; TCGA BRCA -0.59; TCGA CESC -0.342; TCGA COAD -0.902; TCGA ESCA -0.61; TCGA HNSC -0.294; TCGA LUAD -0.218; TCGA LUSC -0.594; TCGA PAAD -0.517; TCGA STAD -0.707; TCGA UCEC -0.241
hsa-miR-590-3p
ATP10D
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.137; TCGA BRCA -0.143; TCGA CESC -0.182; TCGA COAD -0.224; TCGA HNSC -0.171; TCGA KIRC -0.256; TCGA KIRP -0.132; TCGA LUAD -0.108; TCGA LUSC -0.283; TCGA PAAD -0.131; TCGA PRAD -0.267; TCGA STAD -0.135; TCGA UCEC -0.252
hsa-miR-590-3p
DAAM1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.15; TCGA BRCA -0.119; TCGA CESC -0.244; TCGA COAD -0.129; TCGA ESCA -0.246; TCGA HNSC -0.196; TCGA KIRC -0.441; TCGA KIRP -0.351; TCGA LUAD -0.113; TCGA LUSC -0.213; TCGA PRAD -0.225; TCGA SARC -0.369; TCGA STAD -0.307; TCGA UCEC -0.137
hsa-miR-590-3p
SIRT1
11 cancers: BLCA; BRCA; CESC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.097; TCGA BRCA -0.067; TCGA CESC -0.188; TCGA KIRP -0.185; TCGA LGG -0.151; TCGA LUAD -0.068; TCGA LUSC -0.079; TCGA PRAD -0.117; TCGA SARC -0.127; TCGA STAD -0.159; TCGA UCEC -0.186
hsa-miR-590-3p
GCOM1
12 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.59; TCGA BRCA -0.387; TCGA CESC -0.385; TCGA KIRC -0.898; TCGA KIRP -0.418; TCGA LUAD -0.304; TCGA LUSC -0.768; TCGA PAAD -0.328; TCGA PRAD -0.484; TCGA SARC -0.479; TCGA STAD -0.198; TCGA UCEC -0.358
hsa-miR-590-3p
NRXN3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.554; TCGA BRCA -0.312; TCGA CESC -0.505; TCGA COAD -0.724; TCGA ESCA -0.701; TCGA HNSC -0.338; TCGA LGG -0.217; TCGA LUAD -0.407; TCGA PRAD -0.272; TCGA SARC -0.612; TCGA STAD -1.139; TCGA UCEC -0.231
hsa-miR-590-3p
FGL2
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUSC; PRAD; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.584; TCGA BRCA -0.126; TCGA COAD -0.351; TCGA ESCA -0.677; TCGA KIRC -0.29; TCGA KIRP -0.265; TCGA LUSC -0.423; TCGA PRAD -0.185; TCGA STAD -0.618; TCGA UCEC -0.291
hsa-miR-590-3p
SATB1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.218; TCGA BRCA -0.106; TCGA CESC -0.205; TCGA COAD -0.32; TCGA ESCA -0.17; TCGA HNSC -0.151; TCGA KIRC -0.336; TCGA KIRP -0.194; TCGA LGG -0.269; TCGA LUAD -0.282; TCGA LUSC -0.208; TCGA PRAD -0.214; TCGA THCA -0.115; TCGA STAD -0.438; TCGA UCEC -0.278
hsa-miR-590-3p
SLC8A1
11 cancers: BLCA; COAD; ESCA; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.398; TCGA COAD -0.452; TCGA ESCA -0.393; TCGA KIRP -0.217; TCGA LGG -0.134; TCGA LUAD -0.185; TCGA LUSC -0.274; TCGA PRAD -0.552; TCGA SARC -0.594; TCGA STAD -0.554; TCGA UCEC -0.435
hsa-miR-590-3p
ETV1
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.309; TCGA BRCA -0.271; TCGA CESC -0.374; TCGA COAD -0.231; TCGA HNSC -0.202; TCGA KIRP -0.323; TCGA LGG -0.377; TCGA LUAD -0.391; TCGA LUSC -0.493; TCGA PAAD -0.203; TCGA PRAD -0.252; TCGA THCA -0.186; TCGA STAD -0.347; TCGA UCEC -0.247
hsa-miR-590-3p
KIAA0408
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; STAD
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -1.001; TCGA BRCA -0.911; TCGA COAD -0.672; TCGA ESCA -1.249; TCGA HNSC -0.362; TCGA KIRC -0.348; TCGA LUAD -0.852; TCGA LUSC -1.068; TCGA PRAD -0.438; TCGA SARC -1.045; TCGA STAD -1.058
hsa-miR-590-3p
DNAJC13
9 cancers: BLCA; CESC; COAD; ESCA; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.063; TCGA CESC -0.101; TCGA COAD -0.083; TCGA ESCA -0.094; TCGA PAAD -0.145; TCGA PRAD -0.123; TCGA SARC -0.14; TCGA STAD -0.128; TCGA UCEC -0.083
hsa-miR-590-3p
H6PD
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.111; TCGA BRCA -0.176; TCGA CESC -0.118; TCGA ESCA -0.164; TCGA HNSC -0.079; TCGA LUAD -0.079; TCGA LUSC -0.167; TCGA PAAD -0.152; TCGA PRAD -0.102; TCGA STAD -0.141; TCGA UCEC -0.134
hsa-miR-590-3p
ECSCR
9 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUAD; LUSC; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.325; TCGA BRCA -0.338; TCGA COAD -0.403; TCGA ESCA -0.179; TCGA LIHC -0.383; TCGA LUAD -0.142; TCGA LUSC -0.563; TCGA STAD -0.202; TCGA UCEC -0.289
hsa-miR-590-3p
PCDH19
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; STAD
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.314; TCGA BRCA -0.576; TCGA CESC -0.475; TCGA COAD -0.735; TCGA HNSC -0.334; TCGA KIRC -0.386; TCGA KIRP -0.234; TCGA LGG -0.29; TCGA LUAD -0.193; TCGA PAAD -0.32; TCGA PRAD -0.179; TCGA STAD -0.623
hsa-miR-590-3p
MEGF10
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; PRAD; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.215; TCGA BRCA -0.141; TCGA CESC -0.488; TCGA COAD -0.442; TCGA HNSC -0.269; TCGA KIRC -0.362; TCGA PRAD -0.203; TCGA STAD -0.418; TCGA UCEC -0.517
hsa-miR-590-3p
SLC16A7
15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.364; TCGA BRCA -0.314; TCGA CESC -0.39; TCGA COAD -0.446; TCGA HNSC -0.406; TCGA KIRC -0.936; TCGA KIRP -0.658; TCGA LGG -0.263; TCGA LUAD -0.311; TCGA LUSC -0.392; TCGA PAAD -0.393; TCGA PRAD -0.429; TCGA SARC -0.406; TCGA STAD -0.447; TCGA UCEC -0.354
hsa-miR-590-3p
SEMA3C
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.2; TCGA BRCA -0.476; TCGA CESC -0.331; TCGA COAD -0.213; TCGA ESCA -0.233; TCGA HNSC -0.318; TCGA KIRP -0.432; TCGA LUSC -0.239; TCGA PAAD -0.621; TCGA PRAD -0.251; TCGA STAD -0.442; TCGA UCEC -0.355
hsa-miR-590-3p
CPEB4
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.261; TCGA BRCA -0.196; TCGA CESC -0.293; TCGA COAD -0.165; TCGA HNSC -0.228; TCGA KIRC -0.307; TCGA KIRP -0.185; TCGA LGG -0.166; TCGA LUAD -0.149; TCGA LUSC -0.331; TCGA PRAD -0.173; TCGA SARC -0.333; TCGA STAD -0.211; TCGA UCEC -0.128
hsa-miR-590-3p
CX3CL1
10 cancers: BLCA; BRCA; COAD; ESCA; LGG; LUAD; LUSC; PRAD; SARC; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.427; TCGA BRCA -0.144; TCGA COAD -0.159; TCGA ESCA -0.248; TCGA LGG -0.088; TCGA LUAD -0.331; TCGA LUSC -0.18; TCGA PRAD -0.27; TCGA SARC -0.555; TCGA UCEC -0.153
hsa-miR-590-3p
GPR155
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; SARC; STAD
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.29; TCGA BRCA -0.064; TCGA COAD -0.402; TCGA ESCA -0.386; TCGA HNSC -0.228; TCGA KIRC -0.406; TCGA KIRP -0.279; TCGA LGG -0.25; TCGA LUSC -0.141; TCGA SARC -0.158; TCGA STAD -0.446
hsa-miR-590-3p
FAM161B
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.278; TCGA BRCA -0.358; TCGA CESC -0.373; TCGA COAD -0.221; TCGA ESCA -0.298; TCGA KIRC -0.287; TCGA KIRP -0.357; TCGA LGG -0.113; TCGA LUAD -0.248; TCGA LUSC -0.178; TCGA PAAD -0.181; TCGA PRAD -0.257; TCGA SARC -0.299; TCGA THCA -0.139; TCGA STAD -0.246; TCGA UCEC -0.222
hsa-miR-590-3p
BMPR2
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.21; TCGA BRCA -0.133; TCGA CESC -0.18; TCGA COAD -0.242; TCGA ESCA -0.2; TCGA HNSC -0.195; TCGA KIRC -0.14; TCGA KIRP -0.219; TCGA LGG -0.106; TCGA LUAD -0.183; TCGA LUSC -0.329; TCGA PAAD -0.241; TCGA PRAD -0.173; TCGA SARC -0.205; TCGA THCA -0.122; TCGA STAD -0.23; TCGA UCEC -0.215
hsa-miR-590-3p
ATRX
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.122; TCGA BRCA -0.088; TCGA CESC -0.133; TCGA COAD -0.124; TCGA ESCA -0.082; TCGA HNSC -0.07; TCGA KIRC -0.183; TCGA KIRP -0.234; TCGA LGG -0.175; TCGA LUAD -0.151; TCGA LUSC -0.123; TCGA PAAD -0.148; TCGA PRAD -0.151; TCGA SARC -0.255; TCGA THCA -0.088; TCGA STAD -0.234; TCGA UCEC -0.122
hsa-miR-590-3p
RASAL2
11 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; SARC; THCA; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.087; TCGA CESC -0.224; TCGA HNSC -0.176; TCGA KIRC -0.13; TCGA KIRP -0.12; TCGA LGG -0.087; TCGA LUSC -0.281; TCGA PAAD -0.26; TCGA SARC -0.127; TCGA THCA -0.123; TCGA UCEC -0.142
hsa-miR-590-3p
KIAA2022
12 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.686; TCGA CESC -0.778; TCGA COAD -0.931; TCGA ESCA -0.971; TCGA KIRC -1.397; TCGA KIRP -0.963; TCGA LGG -0.363; TCGA LUAD -0.498; TCGA PRAD -0.23; TCGA SARC -1.134; TCGA STAD -1.196; TCGA UCEC -0.398
hsa-miR-590-3p
MMRN1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.946; TCGA BRCA -0.762; TCGA CESC -0.392; TCGA COAD -0.864; TCGA ESCA -0.661; TCGA KIRP -0.31; TCGA LUAD -0.469; TCGA LUSC -0.821; TCGA PRAD -0.371; TCGA SARC -0.544; TCGA STAD -0.711; TCGA UCEC -0.527
hsa-miR-590-3p
KLHL24
12 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.068; TCGA CESC -0.186; TCGA COAD -0.109; TCGA HNSC -0.156; TCGA KIRC -0.078; TCGA KIRP -0.079; TCGA LGG -0.091; TCGA LUAD -0.071; TCGA PRAD -0.059; TCGA SARC -0.141; TCGA STAD -0.181; TCGA UCEC -0.09
hsa-miR-590-3p
ANK2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.661; TCGA BRCA -0.408; TCGA CESC -0.29; TCGA COAD -0.857; TCGA ESCA -0.821; TCGA HNSC -0.346; TCGA KIRC -0.624; TCGA KIRP -0.395; TCGA LUAD -0.255; TCGA LUSC -0.593; TCGA PRAD -0.409; TCGA SARC -0.326; TCGA STAD -0.964; TCGA UCEC -0.414
hsa-miR-590-3p
UBR3
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.112; TCGA BRCA -0.058; TCGA CESC -0.108; TCGA ESCA -0.106; TCGA HNSC -0.16; TCGA KIRC -0.165; TCGA KIRP -0.233; TCGA LGG -0.104; TCGA LUAD -0.074; TCGA PRAD -0.147; TCGA SARC -0.215; TCGA THCA -0.099; TCGA STAD -0.172
hsa-miR-590-3p
DCN
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.809; TCGA BRCA -0.529; TCGA CESC -0.417; TCGA COAD -0.706; TCGA ESCA -0.506; TCGA HNSC -0.408; TCGA KIRC -1.007; TCGA LUAD -0.269; TCGA LUSC -0.679; TCGA PAAD -0.665; TCGA PRAD -0.213; TCGA STAD -0.557; TCGA UCEC -0.636
hsa-miR-590-3p
JAZF1
10 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.327; TCGA BRCA -0.087; TCGA COAD -0.391; TCGA ESCA -0.245; TCGA LUAD -0.144; TCGA LUSC -0.278; TCGA PRAD -0.326; TCGA THCA -0.099; TCGA STAD -0.391; TCGA UCEC -0.224
hsa-miR-590-3p
JMY
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.16; TCGA BRCA -0.109; TCGA CESC -0.197; TCGA COAD -0.146; TCGA ESCA -0.274; TCGA HNSC -0.096; TCGA KIRC -0.432; TCGA KIRP -0.25; TCGA LGG -0.148; TCGA LUAD -0.135; TCGA PRAD -0.073; TCGA SARC -0.294; TCGA THCA -0.099; TCGA STAD -0.367; TCGA UCEC -0.195
hsa-miR-590-3p
FMO2
11 cancers: BLCA; BRCA; CESC; COAD; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.573; TCGA BRCA -0.407; TCGA CESC -0.566; TCGA COAD -0.71; TCGA LUAD -0.437; TCGA LUSC -0.691; TCGA PAAD -0.54; TCGA PRAD -0.379; TCGA SARC -0.553; TCGA STAD -0.701; TCGA UCEC -0.583
hsa-miR-590-3p
PLN
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -1.326; TCGA BRCA -0.395; TCGA CESC -0.627; TCGA COAD -1.034; TCGA ESCA -1.151; TCGA HNSC -0.475; TCGA LIHC -0.518; TCGA LUAD -0.193; TCGA LUSC -0.848; TCGA PAAD -0.605; TCGA PRAD -0.436; TCGA SARC -1.052; TCGA THCA -0.256; TCGA STAD -1.306; TCGA UCEC -1.081
hsa-miR-590-3p
ZC3H6
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LGG; LUAD; LUSC; SARC; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.17; TCGA BRCA -0.188; TCGA CESC -0.126; TCGA ESCA -0.301; TCGA KIRC -0.07; TCGA LGG -0.08; TCGA LUAD -0.077; TCGA LUSC -0.128; TCGA SARC -0.167; TCGA STAD -0.379; TCGA UCEC -0.197
hsa-miR-590-3p
RASGRF2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.342; TCGA BRCA -0.359; TCGA CESC -0.188; TCGA COAD -0.193; TCGA ESCA -0.218; TCGA HNSC -0.323; TCGA KIRC -0.205; TCGA KIRP -0.339; TCGA LIHC -0.237; TCGA LUAD -0.137; TCGA LUSC -0.52; TCGA PAAD -0.442; TCGA PRAD -0.235; TCGA STAD -0.265; TCGA UCEC -0.264
hsa-miR-590-3p
SLAIN2
13 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.104; TCGA ESCA -0.081; TCGA HNSC -0.082; TCGA KIRC -0.087; TCGA KIRP -0.1; TCGA LUAD -0.056; TCGA LUSC -0.07; TCGA PAAD -0.09; TCGA PRAD -0.073; TCGA SARC -0.092; TCGA THCA -0.063; TCGA STAD -0.193; TCGA UCEC -0.069
hsa-miR-590-3p
HMGN5
10 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; SARC; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.257; TCGA CESC -0.376; TCGA HNSC -0.181; TCGA KIRC -0.322; TCGA KIRP -0.139; TCGA LGG -0.216; TCGA LUAD -0.116; TCGA SARC -0.377; TCGA STAD -0.149; TCGA UCEC -0.265
hsa-miR-590-3p
PDS5B
12 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; STAD; UCEC
MirTarget; miRanda; miRNATAP
TCGA BLCA -0.075; TCGA BRCA -0.068; TCGA CESC -0.155; TCGA COAD -0.071; TCGA KIRC -0.188; TCGA KIRP -0.188; TCGA LUAD -0.05; TCGA LUSC -0.094; TCGA PRAD -0.102; TCGA THCA -0.057; TCGA STAD -0.102; TCGA UCEC -0.226
hsa-miR-590-3p
MBNL2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP
TCGA BLCA -0.214; TCGA BRCA -0.115; TCGA CESC -0.23; TCGA COAD -0.131; TCGA ESCA -0.179; TCGA HNSC -0.171; TCGA KIRC -0.092; TCGA LUAD -0.09; TCGA LUSC -0.322; TCGA PAAD -0.168; TCGA PRAD -0.345; TCGA SARC -0.222; TCGA STAD -0.267; TCGA UCEC -0.276
hsa-miR-590-3p
WWC3
11 cancers: BLCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.13; TCGA COAD -0.156; TCGA ESCA -0.2; TCGA HNSC -0.091; TCGA LUAD -0.173; TCGA LUSC -0.193; TCGA PRAD -0.116; TCGA SARC -0.094; TCGA THCA -0.118; TCGA STAD -0.361; TCGA UCEC -0.12
hsa-miR-590-3p
MAN1A1
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.3; TCGA BRCA -0.232; TCGA CESC -0.248; TCGA HNSC -0.256; TCGA KIRC -0.495; TCGA KIRP -0.354; TCGA LUAD -0.127; TCGA LUSC -0.432; TCGA PAAD -0.232; TCGA PRAD -0.267; TCGA STAD -0.129; TCGA UCEC -0.342
hsa-miR-590-3p
DMXL1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.111; TCGA BRCA -0.196; TCGA CESC -0.158; TCGA COAD -0.076; TCGA ESCA -0.129; TCGA KIRC -0.151; TCGA KIRP -0.127; TCGA LGG -0.075; TCGA LUAD -0.12; TCGA LUSC -0.159; TCGA SARC -0.218; TCGA THCA -0.067; TCGA STAD -0.204; TCGA UCEC -0.086
hsa-miR-590-3p
ADD1
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.138; TCGA BRCA -0.153; TCGA ESCA -0.147; TCGA HNSC -0.084; TCGA KIRC -0.084; TCGA LUAD -0.109; TCGA LUSC -0.159; TCGA PRAD -0.081; TCGA SARC -0.094; TCGA THCA -0.064; TCGA STAD -0.186; TCGA UCEC -0.139
hsa-miR-590-3p
PREPL
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.065; TCGA BRCA -0.067; TCGA CESC -0.182; TCGA ESCA -0.113; TCGA HNSC -0.13; TCGA KIRC -0.265; TCGA KIRP -0.234; TCGA LUAD -0.109; TCGA PRAD -0.107; TCGA SARC -0.19; TCGA THCA -0.113; TCGA STAD -0.153; TCGA UCEC -0.142
hsa-miR-590-3p
CAND2
10 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LGG; PRAD; SARC; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.23; TCGA COAD -0.471; TCGA ESCA -0.373; TCGA KIRC -0.72; TCGA KIRP -0.202; TCGA LGG -0.096; TCGA PRAD -0.358; TCGA SARC -0.565; TCGA STAD -0.79; TCGA UCEC -0.145
hsa-miR-590-3p
FAM177A1
10 cancers: BLCA; ESCA; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; THCA; UCEC
MirTarget; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.087; TCGA ESCA -0.122; TCGA KIRC -0.057; TCGA KIRP -0.08; TCGA LUSC -0.108; TCGA PAAD -0.102; TCGA PRAD -0.074; TCGA SARC -0.079; TCGA THCA -0.063; TCGA UCEC -0.057
hsa-miR-590-3p
LTBP1
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
MirTarget; PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.281; TCGA COAD -0.593; TCGA ESCA -0.401; TCGA HNSC -0.211; TCGA KIRC -0.299; TCGA LUAD -0.129; TCGA LUSC -0.207; TCGA PAAD -0.556; TCGA PRAD -0.3; TCGA SARC -0.276; TCGA STAD -0.549; TCGA UCEC -0.248
hsa-miR-590-3p
RYBP
10 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
MirTarget; PITA; miRanda
TCGA BLCA -0.052; TCGA CESC -0.14; TCGA ESCA -0.09; TCGA KIRC -0.115; TCGA KIRP -0.087; TCGA LUAD -0.054; TCGA LUSC -0.117; TCGA PAAD -0.075; TCGA STAD -0.107; TCGA UCEC -0.176
hsa-miR-590-3p
MYCT1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BLCA -0.373; TCGA BRCA -0.355; TCGA CESC -0.292; TCGA COAD -0.401; TCGA ESCA -0.204; TCGA HNSC -0.138; TCGA KIRP -0.208; TCGA LUAD -0.219; TCGA LUSC -0.566; TCGA PRAD -0.105; TCGA SARC -0.139; TCGA THCA -0.138; TCGA STAD -0.322; TCGA UCEC -0.552
hsa-miR-590-3p
ZNF626
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; LUSC; SARC; THCA; STAD; UCEC
MirTarget; miRanda
TCGA BLCA -0.417; TCGA BRCA -0.128; TCGA CESC -0.218; TCGA COAD -0.526; TCGA HNSC -0.18; TCGA KIRC -0.129; TCGA LGG -0.148; TCGA LUSC -0.309; TCGA SARC -0.279; TCGA THCA -0.102; TCGA STAD -0.478; TCGA UCEC -0.334
hsa-miR-590-3p
SKIL
10 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; THCA
MirTarget; miRanda
TCGA BLCA -0.101; TCGA CESC -0.201; TCGA COAD -0.202; TCGA HNSC -0.196; TCGA KIRC -0.164; TCGA KIRP -0.315; TCGA LUSC -0.169; TCGA PAAD -0.222; TCGA PRAD -0.117; TCGA THCA -0.11
hsa-miR-590-3p
SENP7
9 cancers: BLCA; BRCA; CESC; COAD; KIRP; LGG; SARC; STAD; UCEC
MirTarget; PITA; miRanda; miRNATAP
TCGA BLCA -0.099; TCGA BRCA -0.111; TCGA CESC -0.16; TCGA COAD -0.114; TCGA KIRP -0.109; TCGA LGG -0.105; TCGA SARC -0.184; TCGA STAD -0.309; TCGA UCEC -0.182
hsa-miR-590-3p
APC
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.1; TCGA BRCA -0.118; TCGA CESC -0.166; TCGA COAD -0.102; TCGA ESCA -0.104; TCGA HNSC -0.078; TCGA KIRC -0.109; TCGA KIRP -0.197; TCGA LGG -0.111; TCGA LUAD -0.207; TCGA LUSC -0.189; TCGA PAAD -0.107; TCGA PRAD -0.166; TCGA SARC -0.125; TCGA THCA -0.084; TCGA STAD -0.228; TCGA UCEC -0.11
hsa-miR-590-3p
ARSB
10 cancers: BLCA; COAD; ESCA; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.184; TCGA COAD -0.198; TCGA ESCA -0.217; TCGA LGG -0.087; TCGA LUAD -0.057; TCGA LUSC -0.178; TCGA PAAD -0.16; TCGA PRAD -0.216; TCGA SARC -0.142; TCGA STAD -0.251
hsa-miR-590-3p
COL5A1
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.399; TCGA BRCA -0.099; TCGA CESC -0.316; TCGA COAD -0.508; TCGA HNSC -0.363; TCGA LIHC -0.245; TCGA LUSC -0.351; TCGA PAAD -0.578; TCGA PRAD -0.126; TCGA STAD -0.166; TCGA UCEC -0.296
hsa-miR-590-3p
GJA1
9 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; STAD
PITA; miRanda
TCGA BLCA -0.242; TCGA BRCA -0.277; TCGA COAD -0.396; TCGA HNSC -0.451; TCGA LUAD -0.164; TCGA LUSC -0.24; TCGA PAAD -0.42; TCGA PRAD -0.391; TCGA STAD -0.475
hsa-miR-590-3p
INSR
12 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.109; TCGA BRCA -0.081; TCGA CESC -0.228; TCGA HNSC -0.144; TCGA KIRP -0.099; TCGA LIHC -0.114; TCGA LUAD -0.161; TCGA LUSC -0.122; TCGA SARC -0.263; TCGA THCA -0.23; TCGA STAD -0.102; TCGA UCEC -0.204
hsa-miR-590-3p
ITGB3
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.5; TCGA BRCA -0.289; TCGA CESC -0.581; TCGA COAD -0.559; TCGA ESCA -0.451; TCGA HNSC -0.348; TCGA KIRC -0.32; TCGA KIRP -0.858; TCGA LUAD -0.196; TCGA LUSC -0.645; TCGA PAAD -0.362; TCGA PRAD -0.606; TCGA SARC -0.398; TCGA THCA -0.235; TCGA STAD -0.407; TCGA UCEC -0.345
hsa-miR-590-3p
SGCD
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.837; TCGA BRCA -0.463; TCGA CESC -0.522; TCGA COAD -0.849; TCGA ESCA -0.734; TCGA HNSC -0.724; TCGA KIRC -0.442; TCGA LUAD -0.385; TCGA LUSC -0.763; TCGA PAAD -0.551; TCGA SARC -0.298; TCGA STAD -0.801; TCGA UCEC -0.47
hsa-miR-590-3p
TIMP3
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.477; TCGA BRCA -0.388; TCGA CESC -0.477; TCGA COAD -0.609; TCGA ESCA -0.533; TCGA HNSC -0.458; TCGA KIRC -0.405; TCGA KIRP -0.303; TCGA LUAD -0.319; TCGA LUSC -0.791; TCGA PAAD -0.416; TCGA PRAD -0.258; TCGA THCA -0.205; TCGA STAD -0.539; TCGA UCEC -0.674
hsa-miR-590-3p
CHM
13 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.056; TCGA BRCA -0.105; TCGA CESC -0.117; TCGA COAD -0.071; TCGA KIRC -0.169; TCGA KIRP -0.264; TCGA LUSC -0.109; TCGA PAAD -0.101; TCGA PRAD -0.161; TCGA SARC -0.094; TCGA THCA -0.099; TCGA STAD -0.1; TCGA UCEC -0.134
hsa-miR-590-3p
EYA1
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; PRAD; SARC; STAD
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.643; TCGA BRCA -0.367; TCGA CESC -0.469; TCGA COAD -0.585; TCGA HNSC -0.379; TCGA LGG -0.518; TCGA PRAD -0.531; TCGA SARC -0.482; TCGA STAD -0.499
hsa-miR-590-3p
PLP1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -1.055; TCGA BRCA -0.575; TCGA CESC -0.358; TCGA COAD -1.24; TCGA ESCA -1.156; TCGA HNSC -0.513; TCGA KIRC -0.774; TCGA LUSC -0.405; TCGA PRAD -0.684; TCGA STAD -1.485; TCGA UCEC -0.921
hsa-miR-590-3p
ABAT
11 cancers: BLCA; BRCA; CESC; COAD; KIRC; LGG; LUAD; LUSC; SARC; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.268; TCGA BRCA -0.467; TCGA CESC -0.213; TCGA COAD -0.211; TCGA KIRC -0.573; TCGA LGG -0.301; TCGA LUAD -0.253; TCGA LUSC -0.202; TCGA SARC -0.241; TCGA STAD -0.175; TCGA UCEC -0.186
hsa-miR-590-3p
GABRB2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.417; TCGA BRCA -0.389; TCGA CESC -0.597; TCGA COAD -0.653; TCGA ESCA -0.491; TCGA HNSC -0.368; TCGA KIRC -1.008; TCGA KIRP -0.762; TCGA LGG -0.39; TCGA LUAD -0.319; TCGA LUSC -0.591; TCGA THCA -0.418; TCGA STAD -0.347; TCGA UCEC -0.362
hsa-miR-590-3p
GRIA3
10 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.485; TCGA BRCA -0.346; TCGA CESC -0.371; TCGA HNSC -0.328; TCGA LGG -0.297; TCGA LUSC -0.443; TCGA PRAD -0.274; TCGA SARC -0.626; TCGA STAD -0.472; TCGA UCEC -0.572
hsa-miR-590-3p
GUCY1A3
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.227; TCGA BRCA -0.097; TCGA CESC -0.367; TCGA COAD -0.774; TCGA ESCA -0.495; TCGA HNSC -0.215; TCGA LGG -0.321; TCGA LUAD -0.251; TCGA LUSC -0.448; TCGA PAAD -0.38; TCGA PRAD -0.158; TCGA SARC -0.342; TCGA THCA -0.13; TCGA STAD -0.645; TCGA UCEC -0.198
hsa-miR-590-3p
IGF2R
11 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA
PITA; miRanda
TCGA BLCA -0.069; TCGA CESC -0.125; TCGA COAD -0.08; TCGA HNSC -0.153; TCGA KIRC -0.127; TCGA KIRP -0.125; TCGA LUAD -0.102; TCGA LUSC -0.151; TCGA PAAD -0.118; TCGA PRAD -0.114; TCGA THCA -0.149
hsa-miR-590-3p
PGR
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD
PITA; mirMAP
TCGA BLCA -0.566; TCGA BRCA -1.11; TCGA CESC -0.497; TCGA COAD -0.866; TCGA ESCA -0.644; TCGA HNSC -0.273; TCGA KIRC -0.488; TCGA LUAD -0.432; TCGA LUSC -0.815; TCGA PAAD -0.353; TCGA PRAD -0.529; TCGA SARC -1.123; TCGA STAD -0.972
hsa-miR-590-3p
PTGER3
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.707; TCGA BRCA -0.747; TCGA CESC -0.585; TCGA COAD -0.955; TCGA ESCA -0.632; TCGA HNSC -0.569; TCGA KIRC -0.864; TCGA KIRP -1.026; TCGA LIHC -0.295; TCGA LUAD -0.276; TCGA LUSC -0.687; TCGA PAAD -0.39; TCGA PRAD -0.449; TCGA SARC -0.858; TCGA STAD -0.667; TCGA UCEC -1.187
hsa-miR-590-3p
PTGS1
9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; STAD
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.822; TCGA BRCA -0.1; TCGA COAD -0.447; TCGA ESCA -0.298; TCGA LUAD -0.215; TCGA LUSC -0.506; TCGA PAAD -0.268; TCGA PRAD -0.385; TCGA STAD -0.443
hsa-miR-590-3p
ITSN1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.177; TCGA BRCA -0.199; TCGA CESC -0.166; TCGA COAD -0.1; TCGA ESCA -0.091; TCGA HNSC -0.092; TCGA LUSC -0.152; TCGA PAAD -0.215; TCGA PRAD -0.168; TCGA SARC -0.121; TCGA THCA -0.057; TCGA STAD -0.216; TCGA UCEC -0.14
hsa-miR-590-3p
EBF3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.386; TCGA BRCA -0.484; TCGA CESC -0.356; TCGA COAD -0.561; TCGA ESCA -0.284; TCGA KIRP -0.35; TCGA LIHC -0.325; TCGA LUAD -0.337; TCGA LUSC -0.383; TCGA PAAD -0.297; TCGA STAD -0.552; TCGA UCEC -0.35
hsa-miR-590-3p
RYK
10 cancers: BLCA; CESC; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.053; TCGA CESC -0.083; TCGA KIRC -0.092; TCGA KIRP -0.128; TCGA PAAD -0.113; TCGA PRAD -0.068; TCGA SARC -0.122; TCGA THCA -0.055; TCGA STAD -0.178; TCGA UCEC -0.147
hsa-miR-590-3p
NTRK2
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.62; TCGA BRCA -0.631; TCGA COAD -0.65; TCGA HNSC -0.391; TCGA KIRC -1.004; TCGA KIRP -0.52; TCGA LGG -0.221; TCGA LUAD -0.393; TCGA PRAD -0.454; TCGA SARC -0.691; TCGA THCA -0.112; TCGA STAD -0.728; TCGA UCEC -0.53
hsa-miR-590-3p
PRDM2
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.079; TCGA BRCA -0.077; TCGA CESC -0.094; TCGA COAD -0.105; TCGA HNSC -0.063; TCGA KIRC -0.164; TCGA LUAD -0.087; TCGA LUSC -0.099; TCGA PRAD -0.119; TCGA STAD -0.164; TCGA UCEC -0.115
hsa-miR-590-3p
ENAH
10 cancers: BLCA; COAD; HNSC; LIHC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.162; TCGA COAD -0.211; TCGA HNSC -0.187; TCGA LIHC -0.166; TCGA PAAD -0.214; TCGA PRAD -0.157; TCGA SARC -0.308; TCGA THCA -0.143; TCGA STAD -0.368; TCGA UCEC -0.148
hsa-miR-590-3p
EML1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.425; TCGA BRCA -0.174; TCGA CESC -0.259; TCGA COAD -0.59; TCGA ESCA -0.372; TCGA HNSC -0.322; TCGA KIRP -0.134; TCGA LUAD -0.276; TCGA LUSC -0.38; TCGA PAAD -0.212; TCGA PRAD -0.16; TCGA SARC -0.217; TCGA STAD -0.788; TCGA UCEC -0.247
hsa-miR-590-3p
ZC3H12B
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.341; TCGA BRCA -0.272; TCGA CESC -0.272; TCGA COAD -0.185; TCGA ESCA -0.241; TCGA HNSC -0.208; TCGA KIRC -0.409; TCGA KIRP -0.298; TCGA LGG -0.348; TCGA LUAD -0.174; TCGA LUSC -0.35; TCGA PRAD -0.294; TCGA SARC -0.531; TCGA STAD -0.365; TCGA UCEC -0.519
hsa-miR-590-3p
KCNMA1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.705; TCGA BRCA -0.379; TCGA CESC -0.315; TCGA COAD -0.92; TCGA ESCA -1.024; TCGA LGG -0.122; TCGA LUSC -0.291; TCGA PRAD -0.451; TCGA SARC -0.466; TCGA STAD -1.239; TCGA UCEC -0.555
hsa-miR-590-3p
KIAA2026
12 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.062; TCGA COAD -0.06; TCGA ESCA -0.125; TCGA KIRC -0.163; TCGA KIRP -0.142; TCGA LGG -0.133; TCGA LUAD -0.093; TCGA LUSC -0.076; TCGA PRAD -0.116; TCGA SARC -0.163; TCGA STAD -0.185; TCGA UCEC -0.064
hsa-miR-590-3p
TNRC6B
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LGG; LUAD; PRAD; SARC; STAD
PITA; mirMAP; miRNATAP
TCGA BLCA -0.061; TCGA CESC -0.086; TCGA ESCA -0.127; TCGA HNSC -0.097; TCGA KIRC -0.099; TCGA LGG -0.119; TCGA LUAD -0.109; TCGA PRAD -0.109; TCGA SARC -0.106; TCGA STAD -0.184
hsa-miR-590-3p
AFF3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LIHC; LUAD; LUSC; SARC; STAD
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.79; TCGA BRCA -0.666; TCGA CESC -0.268; TCGA COAD -0.634; TCGA ESCA -0.501; TCGA LGG -0.302; TCGA LIHC -0.306; TCGA LUAD -0.513; TCGA LUSC -0.617; TCGA SARC -0.592; TCGA STAD -0.785
hsa-miR-590-3p
MSRB3
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.802; TCGA BRCA -0.455; TCGA CESC -0.49; TCGA COAD -0.832; TCGA ESCA -0.642; TCGA HNSC -0.368; TCGA KIRP -0.298; TCGA LIHC -0.176; TCGA LUAD -0.317; TCGA LUSC -0.68; TCGA PAAD -0.525; TCGA PRAD -0.487; TCGA SARC -0.607; TCGA THCA -0.161; TCGA STAD -0.954; TCGA UCEC -0.661
hsa-miR-590-3p
RHOBTB1
9 cancers: BLCA; BRCA; CESC; HNSC; LUSC; PAAD; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.192; TCGA BRCA -0.079; TCGA CESC -0.256; TCGA HNSC -0.314; TCGA LUSC -0.272; TCGA PAAD -0.214; TCGA THCA -0.118; TCGA STAD -0.093; TCGA UCEC -0.164
hsa-miR-590-3p
DIXDC1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.637; TCGA BRCA -0.338; TCGA CESC -0.343; TCGA COAD -0.345; TCGA ESCA -0.48; TCGA HNSC -0.212; TCGA KIRC -0.088; TCGA KIRP -0.152; TCGA LUAD -0.242; TCGA LUSC -0.387; TCGA PAAD -0.304; TCGA PRAD -0.27; TCGA SARC -0.473; TCGA THCA -0.133; TCGA STAD -0.755; TCGA UCEC -0.459
hsa-miR-590-3p
CHIC1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.209; TCGA BRCA -0.203; TCGA CESC -0.155; TCGA COAD -0.096; TCGA ESCA -0.193; TCGA KIRC -0.132; TCGA KIRP -0.108; TCGA LUAD -0.121; TCGA LUSC -0.085; TCGA PRAD -0.111; TCGA SARC -0.157; TCGA THCA -0.098; TCGA STAD -0.526; TCGA UCEC -0.137
hsa-miR-590-3p
INTS6
9 cancers: BLCA; CESC; HNSC; KIRP; LGG; PRAD; SARC; THCA; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.054; TCGA CESC -0.151; TCGA HNSC -0.063; TCGA KIRP -0.118; TCGA LGG -0.066; TCGA PRAD -0.131; TCGA SARC -0.076; TCGA THCA -0.054; TCGA UCEC -0.058
hsa-miR-590-3p
LTBP4
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.404; TCGA BRCA -0.433; TCGA CESC -0.224; TCGA ESCA -0.335; TCGA HNSC -0.115; TCGA KIRC -0.366; TCGA LUAD -0.289; TCGA LUSC -0.488; TCGA PRAD -0.138; TCGA SARC -0.209; TCGA STAD -0.389; TCGA UCEC -0.413
hsa-miR-590-3p
SEC24B
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUSC; PRAD; SARC; THCA; STAD
PITA; miRanda
TCGA BLCA -0.051; TCGA BRCA -0.06; TCGA CESC -0.073; TCGA HNSC -0.073; TCGA KIRC -0.08; TCGA KIRP -0.181; TCGA LUSC -0.069; TCGA PRAD -0.07; TCGA SARC -0.134; TCGA THCA -0.052; TCGA STAD -0.089
hsa-miR-590-3p
HIPK3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.288; TCGA BRCA -0.187; TCGA CESC -0.394; TCGA COAD -0.217; TCGA ESCA -0.27; TCGA HNSC -0.281; TCGA KIRC -0.339; TCGA KIRP -0.578; TCGA LUAD -0.185; TCGA LUSC -0.248; TCGA PAAD -0.333; TCGA PRAD -0.42; TCGA SARC -0.555; TCGA STAD -0.364
hsa-miR-590-3p
DACT1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.53; TCGA BRCA -0.224; TCGA CESC -0.524; TCGA COAD -0.545; TCGA ESCA -0.461; TCGA HNSC -0.483; TCGA KIRC -0.195; TCGA LUAD -0.135; TCGA LUSC -0.581; TCGA PAAD -0.447; TCGA PRAD -0.317; TCGA STAD -0.295; TCGA UCEC -0.286
hsa-miR-590-3p
CREBBP
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.092; TCGA BRCA -0.101; TCGA CESC -0.1; TCGA COAD -0.064; TCGA ESCA -0.085; TCGA HNSC -0.101; TCGA KIRP -0.103; TCGA LGG -0.145; TCGA LUAD -0.141; TCGA LUSC -0.102; TCGA PRAD -0.072; TCGA SARC -0.192; TCGA STAD -0.138; TCGA UCEC -0.071
hsa-miR-590-3p
CCDC85A
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.31; TCGA BRCA -0.508; TCGA CESC -0.315; TCGA COAD -0.556; TCGA ESCA -0.328; TCGA HNSC -0.336; TCGA KIRP -0.306; TCGA LGG -0.189; TCGA LIHC -0.29; TCGA LUAD -0.419; TCGA LUSC -0.707; TCGA PRAD -0.301; TCGA SARC -0.459; TCGA STAD -0.404; TCGA UCEC -0.75
hsa-miR-590-3p
MEGF9
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; PRAD; SARC; THCA; STAD
PITA; miRanda; miRNATAP
TCGA BLCA -0.125; TCGA BRCA -0.23; TCGA CESC -0.155; TCGA COAD -0.1; TCGA HNSC -0.102; TCGA KIRC -0.354; TCGA KIRP -0.319; TCGA LUAD -0.197; TCGA PRAD -0.138; TCGA SARC -0.154; TCGA THCA -0.23; TCGA STAD -0.227
hsa-miR-590-3p
STRN3
10 cancers: BLCA; BRCA; ESCA; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.086; TCGA BRCA -0.084; TCGA ESCA -0.095; TCGA KIRP -0.103; TCGA PAAD -0.089; TCGA PRAD -0.1; TCGA SARC -0.154; TCGA THCA -0.057; TCGA STAD -0.229; TCGA UCEC -0.059
hsa-miR-590-3p
TCF4
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.346; TCGA BRCA -0.27; TCGA CESC -0.263; TCGA COAD -0.524; TCGA HNSC -0.223; TCGA LGG -0.181; TCGA LUAD -0.174; TCGA LUSC -0.225; TCGA PAAD -0.244; TCGA PRAD -0.195; TCGA STAD -0.339; TCGA UCEC -0.256
hsa-miR-590-3p
ENTPD1
10 cancers: BLCA; COAD; ESCA; LIHC; LUSC; PAAD; SARC; THCA; STAD; UCEC
PITA; miRNATAP
TCGA BLCA -0.27; TCGA COAD -0.282; TCGA ESCA -0.171; TCGA LIHC -0.108; TCGA LUSC -0.196; TCGA PAAD -0.151; TCGA SARC -0.337; TCGA THCA -0.342; TCGA STAD -0.269; TCGA UCEC -0.233
hsa-miR-590-3p
CRTC1
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; THCA; STAD
PITA; miRanda
TCGA BLCA -0.128; TCGA BRCA -0.152; TCGA CESC -0.171; TCGA ESCA -0.134; TCGA KIRC -0.298; TCGA KIRP -0.174; TCGA LGG -0.198; TCGA LIHC -0.123; TCGA LUAD -0.186; TCGA LUSC -0.088; TCGA THCA -0.108; TCGA STAD -0.116
hsa-miR-590-3p
PTAR1
12 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
PITA; mirMAP; miRNATAP
TCGA BLCA -0.059; TCGA CESC -0.148; TCGA ESCA -0.094; TCGA KIRC -0.166; TCGA KIRP -0.106; TCGA LUAD -0.127; TCGA LUSC -0.079; TCGA PRAD -0.089; TCGA SARC -0.112; TCGA THCA -0.067; TCGA STAD -0.13; TCGA UCEC -0.183
hsa-miR-590-3p
PHACTR2
10 cancers: BLCA; CESC; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
PITA; mirMAP; miRNATAP
TCGA BLCA -0.116; TCGA CESC -0.123; TCGA HNSC -0.139; TCGA LUAD -0.103; TCGA LUSC -0.31; TCGA PAAD -0.218; TCGA PRAD -0.164; TCGA THCA -0.146; TCGA STAD -0.199; TCGA UCEC -0.082
hsa-miR-590-3p
PDE4D
10 cancers: BLCA; COAD; ESCA; KIRC; LGG; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.403; TCGA COAD -0.158; TCGA ESCA -0.229; TCGA KIRC -0.105; TCGA LGG -0.107; TCGA LUSC -0.225; TCGA PRAD -0.281; TCGA SARC -0.533; TCGA STAD -0.375; TCGA UCEC -0.265
hsa-miR-590-3p
PTPRM
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.138; TCGA BRCA -0.326; TCGA COAD -0.477; TCGA ESCA -0.305; TCGA HNSC -0.26; TCGA LGG -0.097; TCGA LIHC -0.178; TCGA LUAD -0.236; TCGA LUSC -0.517; TCGA PAAD -0.137; TCGA SARC -0.209; TCGA THCA -0.138; TCGA STAD -0.409; TCGA UCEC -0.2
hsa-miR-590-3p
PTPRB
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.248; TCGA BRCA -0.414; TCGA CESC -0.423; TCGA COAD -0.169; TCGA ESCA -0.281; TCGA HNSC -0.211; TCGA KIRC -0.34; TCGA KIRP -0.273; TCGA LUAD -0.265; TCGA LUSC -0.654; TCGA SARC -0.237; TCGA THCA -0.237; TCGA STAD -0.244; TCGA UCEC -0.343
hsa-miR-590-3p
ANGPT1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.267; TCGA BRCA -0.25; TCGA CESC -0.233; TCGA COAD -0.606; TCGA ESCA -0.283; TCGA HNSC -0.261; TCGA KIRC -0.428; TCGA KIRP -0.318; TCGA LUAD -0.399; TCGA LUSC -0.626; TCGA PAAD -0.435; TCGA PRAD -0.6; TCGA SARC -0.419; TCGA STAD -0.537; TCGA UCEC -0.47
hsa-miR-590-3p
DDX3X
9 cancers: BLCA; CESC; KIRC; KIRP; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.057; TCGA CESC -0.112; TCGA KIRC -0.081; TCGA KIRP -0.173; TCGA LUSC -0.083; TCGA PRAD -0.118; TCGA SARC -0.074; TCGA STAD -0.066; TCGA UCEC -0.084
hsa-miR-590-3p
DLG2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.697; TCGA BRCA -0.409; TCGA CESC -0.397; TCGA COAD -0.875; TCGA ESCA -0.658; TCGA HNSC -0.322; TCGA KIRC -0.656; TCGA KIRP -0.304; TCGA LGG -0.161; TCGA LUAD -0.235; TCGA LUSC -0.462; TCGA SARC -0.702; TCGA STAD -1.056; TCGA UCEC -0.607
hsa-miR-590-3p
ESRRG
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; STAD
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.34; TCGA BRCA -0.259; TCGA CESC -0.58; TCGA HNSC -0.277; TCGA KIRC -1.256; TCGA KIRP -0.486; TCGA LGG -0.259; TCGA LUAD -0.434; TCGA PRAD -0.192; TCGA SARC -0.367; TCGA STAD -0.314
hsa-miR-590-3p
GPC4
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.285; TCGA BRCA -0.173; TCGA CESC -0.435; TCGA ESCA -0.242; TCGA HNSC -0.282; TCGA KIRC -0.409; TCGA LUAD -0.361; TCGA PAAD -0.297; TCGA PRAD -0.266; TCGA SARC -0.379; TCGA THCA -0.147; TCGA STAD -0.235; TCGA UCEC -0.153
hsa-miR-590-3p
FOXF1
11 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.61; TCGA CESC -0.189; TCGA COAD -0.451; TCGA ESCA -0.463; TCGA LUAD -0.285; TCGA LUSC -0.587; TCGA PAAD -0.365; TCGA PRAD -0.374; TCGA SARC -0.725; TCGA STAD -0.667; TCGA UCEC -0.11
hsa-miR-590-3p
FOXO3
13 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; SARC; THCA; STAD
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.158; TCGA CESC -0.174; TCGA ESCA -0.094; TCGA HNSC -0.16; TCGA KIRC -0.105; TCGA KIRP -0.14; TCGA LGG -0.117; TCGA LUAD -0.108; TCGA LUSC -0.095; TCGA PAAD -0.098; TCGA SARC -0.124; TCGA THCA -0.062; TCGA STAD -0.147
hsa-miR-590-3p
MPPED2
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; STAD
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.272; TCGA BRCA -0.379; TCGA CESC -0.688; TCGA COAD -0.652; TCGA HNSC -0.431; TCGA KIRC -1.056; TCGA KIRP -0.851; TCGA LGG -0.088; TCGA LIHC -0.328; TCGA LUAD -0.23; TCGA PRAD -0.139; TCGA SARC -0.473; TCGA STAD -0.756
hsa-miR-590-3p
ARNT
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.06; TCGA BRCA -0.053; TCGA CESC -0.104; TCGA HNSC -0.11; TCGA KIRC -0.066; TCGA KIRP -0.057; TCGA LUSC -0.086; TCGA PAAD -0.099; TCGA PRAD -0.053; TCGA SARC -0.062; TCGA STAD -0.12; TCGA UCEC -0.116
hsa-miR-590-3p
CTGF
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.689; TCGA BRCA -0.261; TCGA CESC -0.391; TCGA COAD -0.396; TCGA ESCA -0.45; TCGA HNSC -0.338; TCGA KIRC -0.442; TCGA LUAD -0.189; TCGA LUSC -0.624; TCGA PAAD -0.441; TCGA STAD -0.275; TCGA UCEC -0.34
hsa-miR-590-3p
FGF7
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.838; TCGA BRCA -0.3; TCGA CESC -0.423; TCGA COAD -0.75; TCGA ESCA -0.672; TCGA HNSC -0.278; TCGA KIRC -0.369; TCGA LIHC -0.225; TCGA LUAD -0.154; TCGA LUSC -0.566; TCGA PAAD -0.488; TCGA PRAD -0.317; TCGA SARC -0.729; TCGA STAD -0.719; TCGA UCEC -0.692
hsa-miR-590-3p
GNS
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.129; TCGA BRCA -0.112; TCGA CESC -0.09; TCGA COAD -0.074; TCGA HNSC -0.075; TCGA KIRC -0.118; TCGA LUAD -0.097; TCGA LUSC -0.165; TCGA PAAD -0.084; TCGA PRAD -0.065; TCGA THCA -0.067; TCGA UCEC -0.106
hsa-miR-590-3p
HOXB2
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; PRAD; STAD
PITA; miRanda; miRNATAP
TCGA BLCA -0.362; TCGA BRCA -0.265; TCGA COAD -0.307; TCGA ESCA -0.264; TCGA HNSC -0.189; TCGA KIRC -0.26; TCGA KIRP -0.235; TCGA LIHC -0.168; TCGA PRAD -0.23; TCGA STAD -0.413
hsa-miR-590-3p
ITPKB
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.249; TCGA CESC -0.122; TCGA COAD -0.121; TCGA ESCA -0.304; TCGA HNSC -0.132; TCGA KIRC -0.371; TCGA KIRP -0.144; TCGA LUAD -0.225; TCGA PRAD -0.101; TCGA SARC -0.257; TCGA STAD -0.537; TCGA UCEC -0.309
hsa-miR-590-3p
LAMC1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.232; TCGA BRCA -0.174; TCGA CESC -0.143; TCGA COAD -0.267; TCGA ESCA -0.125; TCGA HNSC -0.164; TCGA KIRP -0.158; TCGA LIHC -0.163; TCGA LUSC -0.105; TCGA PAAD -0.277; TCGA PRAD -0.221; TCGA SARC -0.123; TCGA THCA -0.179; TCGA STAD -0.354; TCGA UCEC -0.115
hsa-miR-590-3p
LRP1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.388; TCGA BRCA -0.428; TCGA CESC -0.256; TCGA COAD -0.295; TCGA ESCA -0.252; TCGA HNSC -0.325; TCGA LUAD -0.253; TCGA LUSC -0.46; TCGA PAAD -0.398; TCGA PRAD -0.256; TCGA THCA -0.103; TCGA STAD -0.28; TCGA UCEC -0.281
hsa-miR-590-3p
LRP6
13 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.087; TCGA CESC -0.271; TCGA COAD -0.079; TCGA HNSC -0.091; TCGA KIRC -0.303; TCGA KIRP -0.279; TCGA LUAD -0.215; TCGA PAAD -0.151; TCGA PRAD -0.135; TCGA SARC -0.328; TCGA THCA -0.135; TCGA STAD -0.118; TCGA UCEC -0.121
hsa-miR-590-3p
MSN
10 cancers: BLCA; COAD; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.146; TCGA COAD -0.39; TCGA KIRP -0.128; TCGA LUAD -0.173; TCGA LUSC -0.251; TCGA PAAD -0.223; TCGA PRAD -0.225; TCGA THCA -0.107; TCGA STAD -0.189; TCGA UCEC -0.081
hsa-miR-590-3p
PCSK2
9 cancers: BLCA; COAD; ESCA; LGG; LUAD; LUSC; PRAD; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.631; TCGA COAD -0.787; TCGA ESCA -0.708; TCGA LGG -0.652; TCGA LUAD -0.73; TCGA LUSC -0.653; TCGA PRAD -0.748; TCGA STAD -1.215; TCGA UCEC -0.469
hsa-miR-590-3p
PPP1CB
10 cancers: BLCA; CESC; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.104; TCGA CESC -0.09; TCGA HNSC -0.114; TCGA KIRC -0.069; TCGA KIRP -0.135; TCGA PAAD -0.128; TCGA PRAD -0.085; TCGA SARC -0.185; TCGA STAD -0.247; TCGA UCEC -0.13
hsa-miR-590-3p
PRKCA
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.258; TCGA BRCA -0.092; TCGA CESC -0.344; TCGA ESCA -0.253; TCGA HNSC -0.16; TCGA KIRC -0.332; TCGA KIRP -0.171; TCGA LGG -0.153; TCGA LUAD -0.194; TCGA LUSC -0.369; TCGA PRAD -0.275; TCGA STAD -0.25; TCGA UCEC -0.27
hsa-miR-590-3p
RDX
12 cancers: BLCA; CESC; COAD; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.121; TCGA CESC -0.143; TCGA COAD -0.507; TCGA KIRC -0.103; TCGA KIRP -0.228; TCGA LUSC -0.132; TCGA PAAD -0.235; TCGA PRAD -0.146; TCGA SARC -0.176; TCGA THCA -0.087; TCGA STAD -0.379; TCGA UCEC -0.077
hsa-miR-590-3p
SMARCA2
13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.183; TCGA BRCA -0.112; TCGA COAD -0.11; TCGA ESCA -0.201; TCGA KIRC -0.345; TCGA KIRP -0.258; TCGA LGG -0.091; TCGA LUAD -0.214; TCGA PRAD -0.107; TCGA SARC -0.247; TCGA THCA -0.08; TCGA STAD -0.238; TCGA UCEC -0.255
hsa-miR-590-3p
SNX1
13 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.12; TCGA BRCA -0.186; TCGA CESC -0.084; TCGA ESCA -0.073; TCGA KIRC -0.074; TCGA LUAD -0.091; TCGA LUSC -0.057; TCGA PAAD -0.057; TCGA PRAD -0.096; TCGA SARC -0.105; TCGA THCA -0.107; TCGA STAD -0.175; TCGA UCEC -0.11
hsa-miR-590-3p
STIM1
10 cancers: BLCA; CESC; HNSC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD
PITA; miRanda
TCGA BLCA -0.112; TCGA CESC -0.082; TCGA HNSC -0.112; TCGA KIRP -0.103; TCGA LGG -0.082; TCGA LUAD -0.097; TCGA PRAD -0.055; TCGA SARC -0.178; TCGA THCA -0.147; TCGA STAD -0.154
hsa-miR-590-3p
TRPC1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.274; TCGA BRCA -0.259; TCGA CESC -0.411; TCGA COAD -0.454; TCGA ESCA -0.38; TCGA HNSC -0.177; TCGA LGG -0.146; TCGA LUSC -0.221; TCGA PAAD -0.227; TCGA PRAD -0.264; TCGA SARC -0.194; TCGA THCA -0.086; TCGA STAD -0.714; TCGA UCEC -0.436
hsa-miR-590-3p
GAS7
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.586; TCGA BRCA -0.354; TCGA CESC -0.294; TCGA COAD -0.604; TCGA ESCA -0.425; TCGA HNSC -0.305; TCGA LUAD -0.247; TCGA LUSC -0.656; TCGA PAAD -0.313; TCGA PRAD -0.237; TCGA STAD -0.498; TCGA UCEC -0.278
hsa-miR-590-3p
SLC25A12
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; PRAD; SARC; STAD
PITA; miRanda; miRNATAP
TCGA BLCA -0.248; TCGA BRCA -0.081; TCGA COAD -0.113; TCGA ESCA -0.224; TCGA KIRC -0.169; TCGA KIRP -0.085; TCGA LGG -0.124; TCGA PRAD -0.148; TCGA SARC -0.25; TCGA STAD -0.318
hsa-miR-590-3p
NRP1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.157; TCGA BRCA -0.208; TCGA CESC -0.149; TCGA COAD -0.406; TCGA ESCA -0.173; TCGA HNSC -0.139; TCGA LUAD -0.199; TCGA LUSC -0.472; TCGA PAAD -0.309; TCGA PRAD -0.104; TCGA THCA -0.113; TCGA STAD -0.17; TCGA UCEC -0.134
hsa-miR-590-3p
SPAG9
12 cancers: BLCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.111; TCGA CESC -0.116; TCGA ESCA -0.116; TCGA HNSC -0.083; TCGA LGG -0.079; TCGA LUAD -0.144; TCGA LUSC -0.106; TCGA PAAD -0.139; TCGA PRAD -0.097; TCGA THCA -0.111; TCGA STAD -0.191; TCGA UCEC -0.121
hsa-miR-590-3p
RHOB
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.301; TCGA BRCA -0.349; TCGA COAD -0.139; TCGA ESCA -0.18; TCGA HNSC -0.102; TCGA LGG -0.075; TCGA LUSC -0.277; TCGA PRAD -0.278; TCGA SARC -0.492; TCGA STAD -0.531; TCGA UCEC -0.255
hsa-miR-590-3p
JMJD1C
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.141; TCGA BRCA -0.059; TCGA CESC -0.212; TCGA COAD -0.054; TCGA ESCA -0.103; TCGA HNSC -0.105; TCGA KIRP -0.182; TCGA LGG -0.113; TCGA LUAD -0.111; TCGA LUSC -0.19; TCGA PRAD -0.123; TCGA SARC -0.134; TCGA STAD -0.18; TCGA UCEC -0.181
hsa-miR-590-3p
SPOCK1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; PAAD; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.538; TCGA BRCA -0.286; TCGA CESC -0.5; TCGA COAD -0.95; TCGA ESCA -0.456; TCGA HNSC -0.548; TCGA KIRP -0.311; TCGA LGG -0.166; TCGA PAAD -0.654; TCGA THCA -0.292; TCGA STAD -0.763; TCGA UCEC -0.349
hsa-miR-590-3p
TGFBR1
9 cancers: BLCA; COAD; KIRP; LUAD; LUSC; PAAD; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.139; TCGA COAD -0.198; TCGA KIRP -0.138; TCGA LUAD -0.077; TCGA LUSC -0.139; TCGA PAAD -0.208; TCGA THCA -0.154; TCGA STAD -0.316; TCGA UCEC -0.141
hsa-miR-590-3p
ANGPTL1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -1.04; TCGA BRCA -0.698; TCGA CESC -0.451; TCGA COAD -1.275; TCGA ESCA -1.004; TCGA HNSC -0.309; TCGA KIRC -1.181; TCGA LUAD -0.286; TCGA LUSC -0.914; TCGA PAAD -0.383; TCGA PRAD -0.545; TCGA SARC -0.687; TCGA STAD -1.334; TCGA UCEC -1.057
hsa-miR-590-3p
MAGI1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
PITA; miRanda
TCGA BLCA -0.209; TCGA BRCA -0.277; TCGA CESC -0.317; TCGA COAD -0.072; TCGA ESCA -0.202; TCGA HNSC -0.203; TCGA KIRC -0.492; TCGA KIRP -0.344; TCGA LGG -0.137; TCGA LUAD -0.253; TCGA LUSC -0.299; TCGA PAAD -0.133; TCGA PRAD -0.065; TCGA SARC -0.429; TCGA THCA -0.134; TCGA STAD -0.078
hsa-miR-590-3p
ZFP36L1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.212; TCGA BRCA -0.168; TCGA CESC -0.254; TCGA COAD -0.179; TCGA ESCA -0.123; TCGA HNSC -0.131; TCGA KIRP -0.21; TCGA LUAD -0.151; TCGA LUSC -0.129; TCGA PAAD -0.236; TCGA PRAD -0.265; TCGA SARC -0.117; TCGA STAD -0.189; TCGA UCEC -0.145
hsa-miR-590-3p
MECP2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; PRAD; SARC; THCA; STAD; UCEC
PITA; mirMAP
TCGA BLCA -0.072; TCGA BRCA -0.102; TCGA CESC -0.118; TCGA COAD -0.069; TCGA ESCA -0.118; TCGA KIRC -0.161; TCGA KIRP -0.147; TCGA LUAD -0.06; TCGA PRAD -0.106; TCGA SARC -0.132; TCGA THCA -0.073; TCGA STAD -0.212; TCGA UCEC -0.147
hsa-miR-590-3p
CA3
9 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.599; TCGA BRCA -0.407; TCGA CESC -0.427; TCGA HNSC -0.36; TCGA LUAD -0.327; TCGA LUSC -0.702; TCGA SARC -0.825; TCGA STAD -0.222; TCGA UCEC -0.637
hsa-miR-590-3p
SCARB2
11 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.073; TCGA COAD -0.075; TCGA ESCA -0.167; TCGA HNSC -0.075; TCGA KIRP -0.131; TCGA LUAD -0.063; TCGA LUSC -0.168; TCGA PAAD -0.108; TCGA THCA -0.093; TCGA STAD -0.069; TCGA UCEC -0.11
hsa-miR-590-3p
INPP5A
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.239; TCGA BRCA -0.101; TCGA CESC -0.144; TCGA ESCA -0.166; TCGA HNSC -0.144; TCGA KIRC -0.171; TCGA KIRP -0.063; TCGA LGG -0.102; TCGA LIHC -0.126; TCGA LUAD -0.129; TCGA LUSC -0.133; TCGA SARC -0.287; TCGA STAD -0.334; TCGA UCEC -0.286
hsa-miR-590-3p
IRS1
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.229; TCGA BRCA -0.429; TCGA CESC -0.247; TCGA COAD -0.191; TCGA HNSC -0.296; TCGA KIRC -0.37; TCGA KIRP -0.235; TCGA LGG -0.133; TCGA PAAD -0.335; TCGA PRAD -0.169; TCGA SARC -0.355; TCGA STAD -0.189; TCGA UCEC -0.366
hsa-miR-590-3p
MEF2A
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.17; TCGA CESC -0.185; TCGA COAD -0.12; TCGA ESCA -0.114; TCGA HNSC -0.111; TCGA KIRP -0.154; TCGA LUAD -0.103; TCGA LUSC -0.147; TCGA PAAD -0.098; TCGA PRAD -0.149; TCGA SARC -0.266; TCGA THCA -0.064; TCGA STAD -0.326; TCGA UCEC -0.193
hsa-miR-590-3p
RNF103
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; PAAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.07; TCGA BRCA -0.082; TCGA CESC -0.184; TCGA HNSC -0.086; TCGA KIRP -0.135; TCGA LGG -0.079; TCGA PAAD -0.096; TCGA SARC -0.257; TCGA STAD -0.097; TCGA UCEC -0.127
hsa-miR-590-3p
UST
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; PAAD; PRAD; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.18; TCGA BRCA -0.259; TCGA CESC -0.219; TCGA COAD -0.487; TCGA ESCA -0.343; TCGA HNSC -0.2; TCGA KIRC -0.522; TCGA LGG -0.211; TCGA LUAD -0.204; TCGA PAAD -0.303; TCGA PRAD -0.21; TCGA STAD -0.568; TCGA UCEC -0.666
hsa-miR-590-3p
CTDSP2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.124; TCGA BRCA -0.157; TCGA CESC -0.13; TCGA COAD -0.095; TCGA ESCA -0.084; TCGA HNSC -0.076; TCGA KIRC -0.142; TCGA KIRP -0.198; TCGA LUAD -0.111; TCGA LUSC -0.144; TCGA PAAD -0.155; TCGA PRAD -0.09; TCGA STAD -0.134; TCGA UCEC -0.152
hsa-miR-590-3p
TSHZ1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.197; TCGA BRCA -0.182; TCGA CESC -0.33; TCGA COAD -0.125; TCGA ESCA -0.148; TCGA HNSC -0.116; TCGA KIRC -0.107; TCGA LGG -0.19; TCGA LUAD -0.153; TCGA PRAD -0.09; TCGA SARC -0.269; TCGA STAD -0.371; TCGA UCEC -0.119
hsa-miR-590-3p
SPRY2
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.275; TCGA BRCA -0.343; TCGA CESC -0.331; TCGA HNSC -0.145; TCGA KIRC -0.23; TCGA KIRP -0.211; TCGA LUAD -0.22; TCGA LUSC -0.23; TCGA PAAD -0.104; TCGA PRAD -0.188; TCGA UCEC -0.252
hsa-miR-590-3p
MMP16
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.399; TCGA BRCA -0.393; TCGA CESC -0.392; TCGA COAD -0.601; TCGA ESCA -0.339; TCGA HNSC -0.56; TCGA KIRP -0.409; TCGA LGG -0.193; TCGA LUAD -0.266; TCGA LUSC -0.442; TCGA PAAD -0.42; TCGA PRAD -0.378; TCGA SARC -0.33; TCGA THCA -0.286; TCGA STAD -0.638; TCGA UCEC -0.488
hsa-miR-590-3p
LANCL1
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.107; TCGA BRCA -0.117; TCGA CESC -0.102; TCGA ESCA -0.157; TCGA HNSC -0.142; TCGA KIRC -0.239; TCGA KIRP -0.295; TCGA PRAD -0.095; TCGA SARC -0.267; TCGA STAD -0.151; TCGA UCEC -0.21
hsa-miR-590-3p
CAP2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.372; TCGA BRCA -0.143; TCGA CESC -0.319; TCGA COAD -0.441; TCGA ESCA -0.359; TCGA HNSC -0.318; TCGA LUSC -0.195; TCGA PAAD -0.254; TCGA PRAD -0.35; TCGA SARC -0.907; TCGA THCA -0.132; TCGA STAD -0.937; TCGA UCEC -0.247
hsa-miR-590-3p
APPBP2
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.051; TCGA BRCA -0.062; TCGA CESC -0.16; TCGA ESCA -0.118; TCGA HNSC -0.058; TCGA KIRC -0.097; TCGA LUAD -0.077; TCGA PRAD -0.094; TCGA SARC -0.089; TCGA THCA -0.076; TCGA STAD -0.148; TCGA UCEC -0.171
hsa-miR-590-3p
KHDRBS3
12 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; STAD
PITA; miRanda; mirMAP
TCGA BLCA -0.24; TCGA CESC -0.469; TCGA COAD -0.274; TCGA HNSC -0.208; TCGA KIRC -0.086; TCGA KIRP -0.135; TCGA LGG -0.186; TCGA LIHC -0.185; TCGA LUAD -0.251; TCGA PRAD -0.227; TCGA SARC -0.288; TCGA STAD -0.253
hsa-miR-590-3p
WASF3
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.307; TCGA BRCA -0.21; TCGA CESC -0.458; TCGA COAD -0.628; TCGA HNSC -0.267; TCGA KIRC -0.571; TCGA KIRP -0.581; TCGA LGG -0.238; TCGA LUAD -0.289; TCGA LUSC -0.476; TCGA PRAD -0.117; TCGA STAD -0.58; TCGA UCEC -0.45
hsa-miR-590-3p
HIVEP2
9 cancers: BLCA; CESC; COAD; HNSC; KIRP; LGG; LUSC; PAAD; STAD
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.079; TCGA CESC -0.089; TCGA COAD -0.139; TCGA HNSC -0.166; TCGA KIRP -0.135; TCGA LGG -0.135; TCGA LUSC -0.105; TCGA PAAD -0.168; TCGA STAD -0.232
hsa-miR-590-3p
AKAP13
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.251; TCGA BRCA -0.113; TCGA CESC -0.264; TCGA COAD -0.122; TCGA ESCA -0.147; TCGA HNSC -0.16; TCGA LUAD -0.246; TCGA LUSC -0.314; TCGA PAAD -0.142; TCGA PRAD -0.14; TCGA SARC -0.116; TCGA THCA -0.118; TCGA UCEC -0.142
hsa-miR-590-3p
SLC20A2
10 cancers: BLCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.113; TCGA HNSC -0.09; TCGA KIRC -0.428; TCGA KIRP -0.137; TCGA LUAD -0.11; TCGA PAAD -0.174; TCGA PRAD -0.114; TCGA SARC -0.357; TCGA STAD -0.182; TCGA UCEC -0.075
hsa-miR-590-3p
CALM1
9 cancers: BLCA; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; STAD
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.136; TCGA ESCA -0.104; TCGA HNSC -0.06; TCGA KIRC -0.166; TCGA LUAD -0.087; TCGA LUSC -0.126; TCGA PRAD -0.101; TCGA SARC -0.095; TCGA STAD -0.202
hsa-miR-590-3p
NR4A3
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.509; TCGA BRCA -0.181; TCGA COAD -0.402; TCGA ESCA -0.423; TCGA HNSC -0.197; TCGA KIRC -0.351; TCGA KIRP -0.312; TCGA LUAD -0.189; TCGA LUSC -0.67; TCGA PRAD -0.423; TCGA SARC -0.259; TCGA STAD -0.481; TCGA UCEC -0.362
hsa-miR-590-3p
TACC2
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.36; TCGA BRCA -0.084; TCGA CESC -0.147; TCGA ESCA -0.172; TCGA HNSC -0.207; TCGA KIRC -0.258; TCGA KIRP -0.111; TCGA LGG -0.211; TCGA LUAD -0.159; TCGA PRAD -0.052; TCGA SARC -0.444; TCGA STAD -0.32; TCGA UCEC -0.137
hsa-miR-590-3p
ADAMTS5
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.401; TCGA BRCA -0.48; TCGA CESC -0.611; TCGA COAD -0.338; TCGA ESCA -0.39; TCGA HNSC -0.386; TCGA KIRP -0.728; TCGA LGG -0.349; TCGA LUSC -0.467; TCGA PAAD -0.219; TCGA PRAD -0.455; TCGA STAD -0.286; TCGA UCEC -0.615
hsa-miR-590-3p
SLMAP
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.372; TCGA BRCA -0.087; TCGA CESC -0.181; TCGA COAD -0.089; TCGA ESCA -0.283; TCGA KIRC -0.259; TCGA KIRP -0.162; TCGA LUSC -0.08; TCGA PAAD -0.203; TCGA PRAD -0.247; TCGA SARC -0.679; TCGA STAD -0.509; TCGA UCEC -0.299
hsa-miR-590-3p
KLF12
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
PITA; mirMAP; miRNATAP
TCGA BLCA -0.281; TCGA CESC -0.274; TCGA COAD -0.44; TCGA ESCA -0.193; TCGA HNSC -0.129; TCGA KIRC -0.184; TCGA KIRP -0.127; TCGA LGG -0.225; TCGA LUAD -0.166; TCGA LUSC -0.264; TCGA PRAD -0.141; TCGA SARC -0.104; TCGA STAD -0.381; TCGA UCEC -0.286
hsa-miR-590-3p
ZFPM2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.762; TCGA BRCA -0.377; TCGA CESC -0.54; TCGA COAD -0.66; TCGA ESCA -0.586; TCGA HNSC -0.425; TCGA LGG -0.405; TCGA LUAD -0.258; TCGA LUSC -0.603; TCGA PAAD -0.506; TCGA PRAD -0.44; TCGA SARC -0.279; TCGA STAD -0.756; TCGA UCEC -0.752
hsa-miR-590-3p
GLUD2
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; PAAD; PRAD
PITA; miRanda
TCGA BLCA -0.095; TCGA BRCA -0.132; TCGA CESC -0.181; TCGA HNSC -0.104; TCGA KIRC -0.277; TCGA KIRP -0.36; TCGA LGG -0.218; TCGA PAAD -0.21; TCGA PRAD -0.127
hsa-miR-590-3p
MACF1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.159; TCGA BRCA -0.076; TCGA CESC -0.16; TCGA COAD -0.186; TCGA ESCA -0.167; TCGA HNSC -0.166; TCGA KIRC -0.2; TCGA KIRP -0.162; TCGA LUAD -0.235; TCGA LUSC -0.376; TCGA PAAD -0.097; TCGA PRAD -0.177; TCGA SARC -0.368; TCGA THCA -0.114; TCGA STAD -0.386; TCGA UCEC -0.198
hsa-miR-590-3p
RAB3GAP1
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.095; TCGA CESC -0.077; TCGA COAD -0.066; TCGA ESCA -0.109; TCGA HNSC -0.057; TCGA KIRC -0.077; TCGA KIRP -0.175; TCGA LUAD -0.065; TCGA PAAD -0.116; TCGA PRAD -0.152; TCGA SARC -0.227; TCGA THCA -0.089; TCGA STAD -0.136; TCGA UCEC -0.105
hsa-miR-590-3p
HBP1
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.091; TCGA BRCA -0.115; TCGA CESC -0.087; TCGA COAD -0.07; TCGA HNSC -0.087; TCGA KIRC -0.063; TCGA KIRP -0.1; TCGA SARC -0.092; TCGA THCA -0.059; TCGA STAD -0.138; TCGA UCEC -0.143
hsa-miR-590-3p
KCND2
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; PAAD; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.222; TCGA BRCA -0.348; TCGA CESC -0.492; TCGA COAD -0.755; TCGA ESCA -0.496; TCGA HNSC -0.51; TCGA LGG -0.224; TCGA PAAD -0.8; TCGA STAD -0.381; TCGA UCEC -0.382
hsa-miR-590-3p
GAB2
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.153; TCGA BRCA -0.118; TCGA CESC -0.343; TCGA ESCA -0.173; TCGA HNSC -0.193; TCGA LUAD -0.128; TCGA LUSC -0.366; TCGA PRAD -0.142; TCGA SARC -0.215; TCGA STAD -0.113; TCGA UCEC -0.238
hsa-miR-590-3p
NPTN
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.193; TCGA BRCA -0.068; TCGA CESC -0.084; TCGA ESCA -0.076; TCGA KIRC -0.17; TCGA KIRP -0.224; TCGA PAAD -0.145; TCGA PRAD -0.202; TCGA SARC -0.26; TCGA THCA -0.071; TCGA STAD -0.184; TCGA UCEC -0.169
hsa-miR-590-3p
TLL1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.42; TCGA BRCA -0.472; TCGA CESC -0.372; TCGA COAD -0.795; TCGA ESCA -0.361; TCGA HNSC -0.262; TCGA LGG -0.551; TCGA LUAD -0.161; TCGA LUSC -0.551; TCGA PAAD -0.46; TCGA PRAD -0.262; TCGA STAD -0.609; TCGA UCEC -0.572
hsa-miR-590-3p
FLRT2
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.579; TCGA BRCA -0.445; TCGA COAD -0.798; TCGA HNSC -0.356; TCGA KIRC -0.448; TCGA KIRP -0.417; TCGA LUSC -0.494; TCGA PAAD -0.546; TCGA PRAD -0.41; TCGA STAD -0.59; TCGA UCEC -0.605
hsa-miR-590-3p
PPARGC1A
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.754; TCGA BRCA -0.216; TCGA ESCA -0.577; TCGA HNSC -0.38; TCGA KIRC -0.796; TCGA KIRP -0.254; TCGA LGG -0.14; TCGA LUSC -0.586; TCGA PRAD -0.526; TCGA SARC -1.027; TCGA STAD -0.496; TCGA UCEC -0.51
hsa-miR-590-3p
FLRT3
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.262; TCGA BRCA -0.437; TCGA CESC -0.454; TCGA COAD -0.276; TCGA HNSC -0.432; TCGA KIRC -0.609; TCGA LGG -0.173; TCGA LUAD -0.372; TCGA LUSC -0.611; TCGA PAAD -0.415; TCGA PRAD -0.53; TCGA UCEC -0.362
hsa-miR-590-3p
BAZ2B
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.146; TCGA BRCA -0.156; TCGA CESC -0.164; TCGA COAD -0.095; TCGA ESCA -0.102; TCGA HNSC -0.121; TCGA KIRC -0.148; TCGA KIRP -0.096; TCGA LGG -0.064; TCGA LUAD -0.102; TCGA LUSC -0.122; TCGA PAAD -0.096; TCGA PRAD -0.105; TCGA SARC -0.215; TCGA THCA -0.075; TCGA STAD -0.178; TCGA UCEC -0.121
hsa-miR-590-3p
CLIC4
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.289; TCGA CESC -0.116; TCGA COAD -0.381; TCGA ESCA -0.24; TCGA HNSC -0.083; TCGA LUSC -0.228; TCGA PAAD -0.384; TCGA PRAD -0.265; TCGA SARC -0.209; TCGA STAD -0.531; TCGA UCEC -0.363
hsa-miR-590-3p
MKL2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.108; TCGA BRCA -0.233; TCGA CESC -0.158; TCGA COAD -0.075; TCGA ESCA -0.152; TCGA HNSC -0.094; TCGA KIRC -0.123; TCGA KIRP -0.112; TCGA LUAD -0.166; TCGA LUSC -0.147; TCGA PAAD -0.168; TCGA PRAD -0.117; TCGA SARC -0.137; TCGA THCA -0.102; TCGA STAD -0.207; TCGA UCEC -0.173
hsa-miR-590-3p
RNF11
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.125; TCGA BRCA -0.063; TCGA CESC -0.135; TCGA COAD -0.101; TCGA HNSC -0.145; TCGA KIRC -0.164; TCGA KIRP -0.153; TCGA LUSC -0.073; TCGA PAAD -0.118; TCGA PRAD -0.09; TCGA SARC -0.074; TCGA THCA -0.092; TCGA STAD -0.228; TCGA UCEC -0.22
hsa-miR-590-3p
LATS2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.304; TCGA BRCA -0.155; TCGA CESC -0.186; TCGA COAD -0.299; TCGA ESCA -0.196; TCGA HNSC -0.195; TCGA KIRC -0.102; TCGA KIRP -0.168; TCGA LUAD -0.101; TCGA LUSC -0.412; TCGA PAAD -0.313; TCGA PRAD -0.096; TCGA SARC -0.083; TCGA STAD -0.301; TCGA UCEC -0.214
hsa-miR-590-3p
SH3PXD2A
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.291; TCGA BRCA -0.123; TCGA CESC -0.134; TCGA COAD -0.212; TCGA ESCA -0.145; TCGA HNSC -0.169; TCGA LUAD -0.178; TCGA LUSC -0.173; TCGA PAAD -0.288; TCGA PRAD -0.296; TCGA STAD -0.295; TCGA UCEC -0.198
hsa-miR-590-3p
DNAJC6
9 cancers: BLCA; CESC; COAD; KIRC; KIRP; PRAD; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.274; TCGA CESC -0.309; TCGA COAD -0.256; TCGA KIRC -0.48; TCGA KIRP -0.335; TCGA PRAD -0.207; TCGA THCA -0.139; TCGA STAD -0.233; TCGA UCEC -0.227
hsa-miR-590-3p
ARNT2
10 cancers: BLCA; COAD; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD
PITA; miRanda; miRNATAP
TCGA BLCA -0.168; TCGA COAD -0.464; TCGA KIRC -0.714; TCGA KIRP -0.495; TCGA LGG -0.114; TCGA LUAD -0.335; TCGA LUSC -0.201; TCGA PRAD -0.198; TCGA SARC -0.489; TCGA STAD -0.353
hsa-miR-590-3p
SLITRK3
11 cancers: BLCA; COAD; ESCA; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.824; TCGA COAD -1.06; TCGA ESCA -1.35; TCGA LGG -0.215; TCGA LUAD -0.445; TCGA LUSC -0.319; TCGA PAAD -0.881; TCGA PRAD -0.91; TCGA SARC -0.823; TCGA STAD -1.423; TCGA UCEC -0.945
hsa-miR-590-3p
NLGN1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.59; TCGA BRCA -0.598; TCGA CESC -0.454; TCGA COAD -0.958; TCGA ESCA -0.694; TCGA HNSC -0.377; TCGA KIRP -0.2; TCGA LGG -0.234; TCGA LUAD -0.262; TCGA PRAD -0.364; TCGA SARC -0.632; TCGA STAD -1.161; TCGA UCEC -0.689
hsa-miR-590-3p
MLXIP
12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.188; TCGA CESC -0.116; TCGA ESCA -0.123; TCGA HNSC -0.126; TCGA KIRC -0.071; TCGA KIRP -0.178; TCGA LUAD -0.11; TCGA LUSC -0.143; TCGA PRAD -0.205; TCGA SARC -0.196; TCGA THCA -0.093; TCGA STAD -0.183
hsa-miR-590-3p
STK38L
10 cancers: BLCA; CESC; ESCA; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.109; TCGA CESC -0.248; TCGA ESCA -0.133; TCGA KIRC -0.129; TCGA KIRP -0.114; TCGA PAAD -0.223; TCGA PRAD -0.132; TCGA SARC -0.273; TCGA STAD -0.171; TCGA UCEC -0.199
hsa-miR-590-3p
SPG20
11 cancers: BLCA; BRCA; COAD; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.207; TCGA BRCA -0.141; TCGA COAD -0.582; TCGA LUAD -0.07; TCGA LUSC -0.172; TCGA PAAD -0.195; TCGA PRAD -0.254; TCGA SARC -0.106; TCGA THCA -0.059; TCGA STAD -0.562; TCGA UCEC -0.262
hsa-miR-590-3p
ARHGEF9
12 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.232; TCGA COAD -0.072; TCGA ESCA -0.272; TCGA KIRC -0.162; TCGA KIRP -0.09; TCGA LGG -0.166; TCGA LUAD -0.11; TCGA PRAD -0.172; TCGA SARC -0.386; TCGA THCA -0.076; TCGA STAD -0.239; TCGA UCEC -0.099
hsa-miR-590-3p
PLCB1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PRAD; SARC; THCA; STAD
PITA; miRanda; mirMAP
TCGA BLCA -0.221; TCGA BRCA -0.163; TCGA CESC -0.295; TCGA COAD -0.293; TCGA ESCA -0.208; TCGA HNSC -0.227; TCGA KIRC -0.137; TCGA KIRP -0.681; TCGA LGG -0.336; TCGA PRAD -0.216; TCGA SARC -0.303; TCGA THCA -0.177; TCGA STAD -0.434
hsa-miR-590-3p
ANKS1A
13 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.102; TCGA CESC -0.107; TCGA ESCA -0.15; TCGA HNSC -0.072; TCGA KIRC -0.29; TCGA KIRP -0.175; TCGA LUAD -0.151; TCGA LUSC -0.142; TCGA PRAD -0.098; TCGA SARC -0.189; TCGA THCA -0.072; TCGA STAD -0.263; TCGA UCEC -0.103
hsa-miR-590-3p
SASH1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.21; TCGA BRCA -0.267; TCGA CESC -0.348; TCGA COAD -0.153; TCGA ESCA -0.175; TCGA HNSC -0.287; TCGA KIRC -0.255; TCGA KIRP -0.25; TCGA LGG -0.124; TCGA LUAD -0.233; TCGA LUSC -0.323; TCGA PAAD -0.172; TCGA STAD -0.384; TCGA UCEC -0.185
hsa-miR-590-3p
ARHGEF12
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.143; TCGA BRCA -0.124; TCGA CESC -0.223; TCGA COAD -0.06; TCGA ESCA -0.117; TCGA HNSC -0.159; TCGA KIRC -0.228; TCGA KIRP -0.278; TCGA LUAD -0.159; TCGA LUSC -0.15; TCGA PAAD -0.165; TCGA PRAD -0.127; TCGA SARC -0.159; TCGA THCA -0.156; TCGA STAD -0.148; TCGA UCEC -0.1
hsa-miR-590-3p
RIMBP2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.415; TCGA BRCA -0.57; TCGA CESC -0.523; TCGA COAD -0.286; TCGA ESCA -0.504; TCGA HNSC -0.293; TCGA KIRC -1.149; TCGA KIRP -1.048; TCGA LGG -0.184; TCGA LUAD -0.39; TCGA PRAD -0.34; TCGA SARC -0.523; TCGA THCA -0.252; TCGA STAD -0.589; TCGA UCEC -0.468
hsa-miR-590-3p
MTMR9
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.123; TCGA BRCA -0.135; TCGA CESC -0.176; TCGA COAD -0.122; TCGA HNSC -0.074; TCGA KIRC -0.129; TCGA KIRP -0.065; TCGA LGG -0.137; TCGA LUAD -0.072; TCGA LUSC -0.136; TCGA SARC -0.159; TCGA STAD -0.259; TCGA UCEC -0.118
hsa-miR-590-3p
DST
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.234; TCGA BRCA -0.363; TCGA COAD -0.206; TCGA HNSC -0.115; TCGA KIRC -0.157; TCGA KIRP -0.143; TCGA LGG -0.094; TCGA LUAD -0.198; TCGA PAAD -0.172; TCGA PRAD -0.286; TCGA SARC -0.259; TCGA STAD -0.546; TCGA UCEC -0.331
hsa-miR-590-3p
EPC2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.099; TCGA BRCA -0.057; TCGA CESC -0.153; TCGA COAD -0.09; TCGA ESCA -0.095; TCGA KIRC -0.053; TCGA KIRP -0.188; TCGA LGG -0.119; TCGA LUAD -0.092; TCGA PRAD -0.175; TCGA SARC -0.259; TCGA THCA -0.073; TCGA STAD -0.146; TCGA UCEC -0.146
hsa-miR-590-3p
KLF13
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.13; TCGA BRCA -0.095; TCGA HNSC -0.145; TCGA KIRC -0.176; TCGA KIRP -0.118; TCGA LUAD -0.201; TCGA LUSC -0.332; TCGA PAAD -0.102; TCGA PRAD -0.212; TCGA UCEC -0.126
hsa-miR-590-3p
CNR1
9 cancers: BLCA; BRCA; COAD; LUAD; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.273; TCGA BRCA -0.301; TCGA COAD -0.873; TCGA LUAD -0.278; TCGA LUSC -0.373; TCGA PRAD -0.259; TCGA SARC -0.617; TCGA STAD -0.932; TCGA UCEC -0.318
hsa-miR-590-3p
KCTD3
9 cancers: BLCA; BRCA; CESC; KIRP; LGG; PAAD; SARC; THCA; UCEC
PITA; miRanda
TCGA BLCA -0.077; TCGA BRCA -0.112; TCGA CESC -0.101; TCGA KIRP -0.134; TCGA LGG -0.063; TCGA PAAD -0.104; TCGA SARC -0.214; TCGA THCA -0.11; TCGA UCEC -0.075
hsa-miR-590-3p
SUFU
11 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.057; TCGA BRCA -0.053; TCGA COAD -0.118; TCGA HNSC -0.087; TCGA LGG -0.124; TCGA LIHC -0.111; TCGA LUAD -0.107; TCGA LUSC -0.073; TCGA PAAD -0.093; TCGA STAD -0.084; TCGA UCEC -0.085
hsa-miR-590-3p
PDGFC
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LUSC; PAAD; PRAD; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.362; TCGA BRCA -0.277; TCGA CESC -0.352; TCGA COAD -0.622; TCGA HNSC -0.213; TCGA LGG -0.07; TCGA LUSC -0.256; TCGA PAAD -0.712; TCGA PRAD -0.313; TCGA THCA -0.11; TCGA STAD -0.313; TCGA UCEC -0.235
hsa-miR-590-3p
FAM8A1
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.125; TCGA BRCA -0.056; TCGA CESC -0.154; TCGA HNSC -0.079; TCGA KIRC -0.093; TCGA KIRP -0.135; TCGA LUAD -0.12; TCGA LUSC -0.111; TCGA PRAD -0.064; TCGA SARC -0.189; TCGA THCA -0.067; TCGA STAD -0.203; TCGA UCEC -0.213
hsa-miR-590-3p
LIMA1
9 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.102; TCGA BRCA -0.286; TCGA KIRC -0.174; TCGA KIRP -0.168; TCGA LGG -0.116; TCGA LUSC -0.103; TCGA PAAD -0.17; TCGA PRAD -0.122; TCGA UCEC -0.11
hsa-miR-590-3p
ARMCX3
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.107; TCGA BRCA -0.097; TCGA CESC -0.292; TCGA COAD -0.181; TCGA HNSC -0.139; TCGA KIRC -0.122; TCGA KIRP -0.136; TCGA LUAD -0.107; TCGA LUSC -0.118; TCGA SARC -0.081; TCGA THCA -0.335; TCGA STAD -0.174; TCGA UCEC -0.145
hsa-miR-590-3p
KLHL3
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.168; TCGA BRCA -0.335; TCGA COAD -0.388; TCGA ESCA -0.235; TCGA HNSC -0.162; TCGA KIRC -0.691; TCGA KIRP -0.544; TCGA LUSC -0.215; TCGA PRAD -0.211; TCGA SARC -0.129; TCGA STAD -0.345; TCGA UCEC -0.147
hsa-miR-590-3p
RNF111
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; PRAD; SARC; THCA
PITA; miRanda; mirMAP
TCGA BLCA -0.052; TCGA BRCA -0.075; TCGA CESC -0.09; TCGA HNSC -0.083; TCGA KIRC -0.079; TCGA KIRP -0.149; TCGA PRAD -0.158; TCGA SARC -0.064; TCGA THCA -0.064
hsa-miR-590-3p
PCDHB4
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.304; TCGA BRCA -0.352; TCGA CESC -0.349; TCGA COAD -0.581; TCGA ESCA -0.338; TCGA HNSC -0.453; TCGA KIRP -0.244; TCGA LUAD -0.214; TCGA LUSC -0.479; TCGA PRAD -0.149; TCGA SARC -0.409; TCGA THCA -0.165; TCGA STAD -0.647; TCGA UCEC -0.21
hsa-miR-590-3p
WNK1
11 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.065; TCGA CESC -0.127; TCGA COAD -0.079; TCGA HNSC -0.213; TCGA KIRC -0.295; TCGA KIRP -0.357; TCGA LUAD -0.204; TCGA LUSC -0.107; TCGA PRAD -0.108; TCGA SARC -0.083; TCGA STAD -0.155
hsa-miR-590-3p
FMN2
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.348; TCGA BRCA -0.396; TCGA COAD -1; TCGA ESCA -0.767; TCGA HNSC -0.397; TCGA KIRC -0.944; TCGA LGG -0.103; TCGA LUAD -0.279; TCGA LUSC -0.407; TCGA PRAD -0.588; TCGA STAD -1.134; TCGA UCEC -0.555
hsa-miR-590-3p
ANKRD50
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.248; TCGA BRCA -0.124; TCGA CESC -0.217; TCGA COAD -0.217; TCGA ESCA -0.137; TCGA HNSC -0.176; TCGA KIRC -0.089; TCGA KIRP -0.13; TCGA LGG -0.091; TCGA LUAD -0.141; TCGA LUSC -0.181; TCGA PAAD -0.366; TCGA PRAD -0.146; TCGA SARC -0.405; TCGA THCA -0.157; TCGA STAD -0.25; TCGA UCEC -0.153
hsa-miR-590-3p
PCDH9
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.454; TCGA BRCA -0.379; TCGA CESC -0.496; TCGA COAD -0.714; TCGA ESCA -0.804; TCGA HNSC -0.386; TCGA KIRC -1.021; TCGA KIRP -0.652; TCGA LUAD -0.258; TCGA LUSC -0.497; TCGA PAAD -0.303; TCGA PRAD -0.354; TCGA STAD -1.062; TCGA UCEC -0.475
hsa-miR-590-3p
HEG1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.287; TCGA BRCA -0.195; TCGA CESC -0.21; TCGA COAD -0.495; TCGA ESCA -0.276; TCGA HNSC -0.192; TCGA KIRC -0.13; TCGA KIRP -0.378; TCGA LUAD -0.268; TCGA LUSC -0.518; TCGA PAAD -0.389; TCGA PRAD -0.192; TCGA THCA -0.259; TCGA STAD -0.331; TCGA UCEC -0.265
hsa-miR-590-3p
SEMA6D
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.431; TCGA BRCA -0.548; TCGA HNSC -0.498; TCGA KIRC -0.97; TCGA KIRP -0.392; TCGA LUAD -0.36; TCGA PRAD -0.429; TCGA SARC -0.236; TCGA STAD -0.416; TCGA UCEC -0.406
hsa-miR-590-3p
CNTN3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.606; TCGA BRCA -0.508; TCGA CESC -0.345; TCGA COAD -0.371; TCGA ESCA -0.721; TCGA HNSC -0.495; TCGA KIRC -1.419; TCGA LGG -0.523; TCGA LUAD -0.329; TCGA LUSC -0.59; TCGA PRAD -0.142; TCGA THCA -0.332; TCGA STAD -0.674; TCGA UCEC -0.344
hsa-miR-590-3p
CACHD1
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.22; TCGA BRCA -0.329; TCGA CESC -0.333; TCGA COAD -0.161; TCGA HNSC -0.145; TCGA KIRC -0.213; TCGA KIRP -0.371; TCGA LUAD -0.43; TCGA LUSC -0.201; TCGA PAAD -0.198; TCGA PRAD -0.442; TCGA SARC -0.184; TCGA STAD -0.17; TCGA UCEC -0.154
hsa-miR-590-3p
PELI2
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.396; TCGA BRCA -0.405; TCGA CESC -0.278; TCGA COAD -0.182; TCGA HNSC -0.216; TCGA KIRC -0.478; TCGA LGG -0.131; TCGA LUAD -0.176; TCGA PAAD -0.194; TCGA PRAD -0.133; TCGA SARC -0.216; TCGA STAD -0.151; TCGA UCEC -0.235
hsa-miR-590-3p
AFAP1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.221; TCGA BRCA -0.055; TCGA CESC -0.155; TCGA COAD -0.205; TCGA ESCA -0.146; TCGA HNSC -0.13; TCGA KIRP -0.154; TCGA LGG -0.21; TCGA LIHC -0.154; TCGA LUSC -0.11; TCGA PAAD -0.236; TCGA PRAD -0.198; TCGA SARC -0.155; TCGA THCA -0.096; TCGA STAD -0.297; TCGA UCEC -0.211
hsa-miR-590-3p
TRIB2
9 cancers: BLCA; COAD; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.124; TCGA COAD -0.197; TCGA KIRC -0.144; TCGA KIRP -0.313; TCGA LGG -0.092; TCGA LUAD -0.132; TCGA PAAD -0.167; TCGA PRAD -0.108; TCGA UCEC -0.323
hsa-miR-590-3p
ITM2B
9 cancers: BLCA; BRCA; CESC; COAD; KIRC; LUAD; LUSC; PRAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.141; TCGA BRCA -0.144; TCGA CESC -0.147; TCGA COAD -0.082; TCGA KIRC -0.129; TCGA LUAD -0.123; TCGA LUSC -0.188; TCGA PRAD -0.119; TCGA UCEC -0.232
hsa-miR-590-3p
TSPYL2
10 cancers: BLCA; BRCA; COAD; ESCA; LGG; LUAD; PRAD; SARC; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.225; TCGA BRCA -0.161; TCGA COAD -0.161; TCGA ESCA -0.185; TCGA LGG -0.21; TCGA LUAD -0.09; TCGA PRAD -0.065; TCGA SARC -0.245; TCGA STAD -0.434; TCGA UCEC -0.134
hsa-miR-590-3p
XYLT1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.302; TCGA BRCA -0.207; TCGA CESC -0.484; TCGA COAD -0.193; TCGA ESCA -0.273; TCGA HNSC -0.22; TCGA KIRC -0.135; TCGA LGG -0.191; TCGA LUAD -0.177; TCGA LUSC -0.325; TCGA PAAD -0.281; TCGA PRAD -0.275; TCGA STAD -0.24; TCGA UCEC -0.528
hsa-miR-590-3p
HHIP
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD
PITA; miRanda; mirMAP
TCGA BLCA -0.407; TCGA CESC -0.403; TCGA COAD -0.833; TCGA HNSC -0.542; TCGA KIRC -0.758; TCGA LUAD -0.848; TCGA LUSC -0.83; TCGA PAAD -0.78; TCGA PRAD -0.476
hsa-miR-590-3p
REEP1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.774; TCGA BRCA -0.38; TCGA CESC -0.564; TCGA COAD -0.566; TCGA ESCA -0.559; TCGA HNSC -0.345; TCGA KIRC -0.163; TCGA LGG -0.292; TCGA LIHC -0.346; TCGA LUAD -0.268; TCGA LUSC -0.359; TCGA PRAD -0.396; TCGA SARC -0.975; TCGA STAD -1.022; TCGA UCEC -0.611
hsa-miR-590-3p
ATP10A
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD
PITA; miRanda
TCGA BLCA -0.323; TCGA BRCA -0.113; TCGA COAD -0.588; TCGA ESCA -0.392; TCGA HNSC -0.221; TCGA KIRC -0.146; TCGA LUAD -0.306; TCGA LUSC -0.693; TCGA PAAD -0.381; TCGA STAD -0.295
hsa-miR-590-3p
TTLL7
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; PRAD; SARC; THCA; STAD
PITA; miRanda; mirMAP
TCGA BLCA -0.401; TCGA CESC -0.593; TCGA COAD -0.652; TCGA ESCA -0.514; TCGA HNSC -0.21; TCGA PRAD -0.173; TCGA SARC -0.446; TCGA THCA -0.277; TCGA STAD -0.86
hsa-miR-590-3p
WWC2
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.179; TCGA BRCA -0.279; TCGA COAD -0.437; TCGA HNSC -0.147; TCGA KIRC -0.314; TCGA KIRP -0.335; TCGA LUAD -0.165; TCGA LUSC -0.51; TCGA PAAD -0.387; TCGA PRAD -0.269; TCGA THCA -0.16; TCGA STAD -0.208; TCGA UCEC -0.133
hsa-miR-590-3p
WDR19
9 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.056; TCGA BRCA -0.244; TCGA CESC -0.119; TCGA ESCA -0.096; TCGA KIRC -0.074; TCGA LUAD -0.102; TCGA THCA -0.075; TCGA STAD -0.175; TCGA UCEC -0.109
hsa-miR-590-3p
C1orf21
10 cancers: BLCA; BRCA; ESCA; HNSC; LGG; LUAD; LUSC; SARC; STAD; UCEC
PITA; mirMAP; miRNATAP
TCGA BLCA -0.285; TCGA BRCA -0.338; TCGA ESCA -0.193; TCGA HNSC -0.175; TCGA LGG -0.074; TCGA LUAD -0.255; TCGA LUSC -0.113; TCGA SARC -0.234; TCGA STAD -0.386; TCGA UCEC -0.279
hsa-miR-590-3p
SBF2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD
PITA; miRanda; mirMAP
TCGA BLCA -0.156; TCGA BRCA -0.165; TCGA CESC -0.212; TCGA COAD -0.052; TCGA ESCA -0.162; TCGA HNSC -0.099; TCGA KIRC -0.133; TCGA KIRP -0.233; TCGA LGG -0.146; TCGA LUSC -0.072; TCGA PAAD -0.198; TCGA PRAD -0.158; TCGA SARC -0.197; TCGA THCA -0.155; TCGA STAD -0.226
hsa-miR-590-3p
RNF146
11 cancers: BLCA; CESC; COAD; ESCA; KIRC; LGG; LUSC; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.074; TCGA CESC -0.151; TCGA COAD -0.074; TCGA ESCA -0.108; TCGA KIRC -0.062; TCGA LGG -0.088; TCGA LUSC -0.144; TCGA SARC -0.08; TCGA THCA -0.071; TCGA STAD -0.181; TCGA UCEC -0.15
hsa-miR-590-3p
TCF7L1
9 cancers: BLCA; COAD; KIRC; KIRP; LUAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.231; TCGA COAD -0.279; TCGA KIRC -0.243; TCGA KIRP -0.288; TCGA LUAD -0.226; TCGA PRAD -0.284; TCGA SARC -0.265; TCGA STAD -0.554; TCGA UCEC -0.168
hsa-miR-590-3p
THAP2
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.132; TCGA CESC -0.124; TCGA COAD -0.088; TCGA ESCA -0.155; TCGA HNSC -0.084; TCGA KIRC -0.082; TCGA LGG -0.097; TCGA LUSC -0.129; TCGA PRAD -0.069; TCGA SARC -0.108; TCGA STAD -0.208; TCGA UCEC -0.237
hsa-miR-590-3p
C1QTNF7
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.884; TCGA BRCA -0.851; TCGA CESC -0.593; TCGA COAD -0.895; TCGA ESCA -0.934; TCGA HNSC -0.496; TCGA KIRC -0.802; TCGA KIRP -0.419; TCGA LUAD -0.684; TCGA LUSC -1.013; TCGA PAAD -0.492; TCGA PRAD -0.277; TCGA SARC -0.757; TCGA STAD -1.005; TCGA UCEC -0.562
hsa-miR-590-3p
KBTBD7
12 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD
PITA; miRanda; mirMAP
TCGA BLCA -0.111; TCGA BRCA -0.094; TCGA CESC -0.324; TCGA COAD -0.14; TCGA KIRC -0.378; TCGA KIRP -0.38; TCGA LGG -0.21; TCGA LUAD -0.102; TCGA PRAD -0.344; TCGA SARC -0.346; TCGA THCA -0.196; TCGA STAD -0.093
hsa-miR-590-3p
FBXO30
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PRAD; SARC; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.144; TCGA CESC -0.132; TCGA COAD -0.073; TCGA ESCA -0.156; TCGA HNSC -0.078; TCGA KIRC -0.123; TCGA KIRP -0.109; TCGA PRAD -0.214; TCGA SARC -0.263; TCGA STAD -0.38; TCGA UCEC -0.139
hsa-miR-590-3p
BRMS1L
10 cancers: BLCA; CESC; KIRC; KIRP; LGG; PAAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.072; TCGA CESC -0.101; TCGA KIRC -0.269; TCGA KIRP -0.221; TCGA LGG -0.147; TCGA PAAD -0.082; TCGA SARC -0.098; TCGA THCA -0.06; TCGA STAD -0.182; TCGA UCEC -0.174
hsa-miR-590-3p
PHYHIPL
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; LUSC; PAAD; PRAD; SARC; STAD
PITA; miRanda; mirMAP
TCGA BLCA -0.354; TCGA BRCA -0.282; TCGA COAD -0.65; TCGA ESCA -0.375; TCGA KIRC -0.42; TCGA LGG -0.403; TCGA LUSC -0.267; TCGA PAAD -0.313; TCGA PRAD -0.188; TCGA SARC -0.677; TCGA STAD -0.657
hsa-miR-590-3p
PCDH7
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.567; TCGA BRCA -0.29; TCGA COAD -0.718; TCGA ESCA -0.35; TCGA HNSC -0.311; TCGA KIRC -0.569; TCGA KIRP -0.569; TCGA LGG -0.335; TCGA PAAD -0.561; TCGA PRAD -0.567; TCGA SARC -0.696; TCGA THCA -0.218; TCGA STAD -0.64; TCGA UCEC -0.266
hsa-miR-590-3p
FOXP1
9 cancers: BLCA; BRCA; ESCA; KIRC; LUAD; LUSC; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.197; TCGA BRCA -0.188; TCGA ESCA -0.216; TCGA KIRC -0.126; TCGA LUAD -0.191; TCGA LUSC -0.339; TCGA SARC -0.148; TCGA STAD -0.253; TCGA UCEC -0.114
hsa-miR-590-3p
JAM3
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.562; TCGA BRCA -0.373; TCGA CESC -0.287; TCGA COAD -0.47; TCGA ESCA -0.447; TCGA HNSC -0.312; TCGA KIRP -0.467; TCGA LIHC -0.193; TCGA LUAD -0.235; TCGA LUSC -0.419; TCGA PAAD -0.251; TCGA PRAD -0.186; TCGA SARC -0.287; TCGA THCA -0.116; TCGA STAD -0.681; TCGA UCEC -0.506
hsa-miR-590-3p
TANC1
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.129; TCGA BRCA -0.111; TCGA CESC -0.086; TCGA ESCA -0.129; TCGA HNSC -0.08; TCGA KIRC -0.249; TCGA KIRP -0.207; TCGA LUAD -0.085; TCGA LUSC -0.089; TCGA PAAD -0.26; TCGA PRAD -0.127; TCGA SARC -0.441; TCGA THCA -0.113; TCGA STAD -0.23; TCGA UCEC -0.098
hsa-miR-590-3p
GNG7
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.534; TCGA BRCA -0.235; TCGA COAD -0.322; TCGA ESCA -0.363; TCGA KIRC -0.565; TCGA KIRP -0.252; TCGA LIHC -0.337; TCGA LUAD -0.224; TCGA LUSC -0.399; TCGA SARC -0.388; TCGA STAD -0.514; TCGA UCEC -0.586
hsa-miR-590-3p
STARD13
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.458; TCGA BRCA -0.284; TCGA CESC -0.285; TCGA COAD -0.231; TCGA ESCA -0.362; TCGA HNSC -0.178; TCGA KIRP -0.207; TCGA LUAD -0.199; TCGA LUSC -0.62; TCGA PAAD -0.182; TCGA PRAD -0.129; TCGA STAD -0.395; TCGA UCEC -0.2
hsa-miR-590-3p
SLC2A13
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LGG; LUAD; LUSC; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.223; TCGA BRCA -0.089; TCGA CESC -0.469; TCGA ESCA -0.172; TCGA KIRC -0.273; TCGA LGG -0.36; TCGA LUAD -0.167; TCGA LUSC -0.226; TCGA SARC -0.263; TCGA THCA -0.181; TCGA STAD -0.179; TCGA UCEC -0.226
hsa-miR-590-3p
GNG2
9 cancers: BLCA; BRCA; COAD; LGG; LUAD; LUSC; PRAD; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.166; TCGA BRCA -0.176; TCGA COAD -0.303; TCGA LGG -0.155; TCGA LUAD -0.094; TCGA LUSC -0.398; TCGA PRAD -0.126; TCGA STAD -0.205; TCGA UCEC -0.154
hsa-miR-590-3p
ANTXR2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.558; TCGA BRCA -0.236; TCGA CESC -0.336; TCGA COAD -0.119; TCGA ESCA -0.355; TCGA LUAD -0.116; TCGA LUSC -0.416; TCGA PAAD -0.388; TCGA PRAD -0.162; TCGA SARC -0.127; TCGA STAD -0.559; TCGA UCEC -0.553
hsa-miR-590-3p
KCNE4
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.71; TCGA BRCA -0.284; TCGA CESC -0.347; TCGA COAD -0.579; TCGA ESCA -0.381; TCGA HNSC -0.219; TCGA LUSC -0.175; TCGA PAAD -0.371; TCGA PRAD -0.331; TCGA SARC -0.535; TCGA STAD -0.577; TCGA UCEC -0.537
hsa-miR-590-3p
CASC4
12 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.117; TCGA BRCA -0.112; TCGA CESC -0.216; TCGA HNSC -0.087; TCGA KIRP -0.138; TCGA LUSC -0.095; TCGA PAAD -0.153; TCGA PRAD -0.099; TCGA SARC -0.103; TCGA THCA -0.106; TCGA STAD -0.099; TCGA UCEC -0.161
hsa-miR-590-3p
KCTD12
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.357; TCGA BRCA -0.25; TCGA CESC -0.197; TCGA COAD -0.311; TCGA ESCA -0.357; TCGA HNSC -0.173; TCGA KIRC -0.248; TCGA LUAD -0.293; TCGA LUSC -0.528; TCGA STAD -0.399; TCGA UCEC -0.563
hsa-miR-590-3p
SON
15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.071; TCGA CESC -0.1; TCGA COAD -0.059; TCGA ESCA -0.071; TCGA HNSC -0.107; TCGA KIRC -0.152; TCGA KIRP -0.232; TCGA LGG -0.058; TCGA LUAD -0.104; TCGA LUSC -0.118; TCGA PRAD -0.112; TCGA SARC -0.165; TCGA THCA -0.059; TCGA STAD -0.099; TCGA UCEC -0.092
hsa-miR-590-3p
STXBP5
10 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; THCA; STAD
PITA; miRanda
TCGA BLCA -0.067; TCGA CESC -0.229; TCGA HNSC -0.171; TCGA KIRC -0.078; TCGA KIRP -0.18; TCGA LGG -0.135; TCGA LUSC -0.167; TCGA PRAD -0.098; TCGA THCA -0.09; TCGA STAD -0.087
hsa-miR-590-3p
TNFRSF19
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.22; TCGA BRCA -0.225; TCGA CESC -0.445; TCGA COAD -0.61; TCGA HNSC -0.227; TCGA KIRC -0.261; TCGA KIRP -0.17; TCGA LUAD -0.256; TCGA LUSC -0.383; TCGA PAAD -0.216; TCGA UCEC -0.282
hsa-miR-590-3p
LRFN5
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.869; TCGA BRCA -0.519; TCGA CESC -0.423; TCGA COAD -0.711; TCGA ESCA -0.566; TCGA HNSC -0.3; TCGA LGG -0.393; TCGA LUAD -0.165; TCGA LUSC -0.496; TCGA PAAD -0.359; TCGA PRAD -0.48; TCGA STAD -0.743; TCGA UCEC -0.654
hsa-miR-590-3p
MAMDC2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.805; TCGA BRCA -0.741; TCGA CESC -0.497; TCGA COAD -1.229; TCGA ESCA -0.809; TCGA HNSC -0.426; TCGA KIRC -0.84; TCGA LIHC -0.252; TCGA LUAD -0.72; TCGA LUSC -0.885; TCGA PAAD -0.332; TCGA PRAD -0.462; TCGA SARC -0.639; TCGA STAD -1.304; TCGA UCEC -1.054
hsa-miR-590-3p
CAMK1D
9 cancers: BLCA; CESC; COAD; HNSC; LGG; LUAD; PAAD; PRAD; STAD
PITA; miRanda
TCGA BLCA -0.155; TCGA CESC -0.206; TCGA COAD -0.215; TCGA HNSC -0.107; TCGA LGG -0.105; TCGA LUAD -0.138; TCGA PAAD -0.22; TCGA PRAD -0.345; TCGA STAD -0.429
hsa-miR-590-3p
CNTN4
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.605; TCGA BRCA -0.494; TCGA CESC -0.603; TCGA COAD -0.677; TCGA ESCA -0.482; TCGA HNSC -0.564; TCGA KIRC -0.36; TCGA LGG -0.415; TCGA LUAD -0.411; TCGA LUSC -0.546; TCGA PAAD -0.396; TCGA PRAD -0.243; TCGA SARC -0.773; TCGA STAD -0.553; TCGA UCEC -0.461
hsa-miR-590-3p
STX12
9 cancers: BLCA; HNSC; KIRC; LUSC; PAAD; PRAD; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.109; TCGA HNSC -0.051; TCGA KIRC -0.077; TCGA LUSC -0.193; TCGA PAAD -0.08; TCGA PRAD -0.072; TCGA THCA -0.09; TCGA STAD -0.059; TCGA UCEC -0.138
hsa-miR-590-3p
SPTBN1
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.112; TCGA BRCA -0.167; TCGA CESC -0.091; TCGA HNSC -0.165; TCGA KIRC -0.273; TCGA KIRP -0.251; TCGA LUAD -0.173; TCGA LUSC -0.284; TCGA PAAD -0.199; TCGA PRAD -0.217; TCGA THCA -0.117; TCGA UCEC -0.147
hsa-miR-590-3p
KY
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.813; TCGA BRCA -0.52; TCGA CESC -0.584; TCGA COAD -0.298; TCGA ESCA -0.58; TCGA HNSC -0.53; TCGA KIRC -0.527; TCGA LUAD -0.207; TCGA LUSC -0.334; TCGA PRAD -0.733; TCGA SARC -0.934; TCGA STAD -0.958; TCGA UCEC -0.677
hsa-miR-590-3p
VPS13B
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.082; TCGA BRCA -0.063; TCGA CESC -0.163; TCGA COAD -0.122; TCGA ESCA -0.134; TCGA HNSC -0.095; TCGA KIRC -0.125; TCGA KIRP -0.24; TCGA LGG -0.094; TCGA LIHC -0.106; TCGA LUAD -0.127; TCGA LUSC -0.08; TCGA PRAD -0.093; TCGA SARC -0.214; TCGA THCA -0.083; TCGA STAD -0.147; TCGA UCEC -0.17
hsa-miR-590-3p
CPEB2
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; miRNATAP
TCGA BLCA -0.242; TCGA BRCA -0.294; TCGA ESCA -0.176; TCGA HNSC -0.219; TCGA KIRP -0.207; TCGA LUAD -0.101; TCGA LUSC -0.263; TCGA PRAD -0.129; TCGA SARC -0.181; TCGA THCA -0.075; TCGA STAD -0.266; TCGA UCEC -0.223
hsa-miR-590-3p
HECTD2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; LUSC; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.193; TCGA BRCA -0.19; TCGA CESC -0.269; TCGA COAD -0.292; TCGA ESCA -0.202; TCGA KIRP -0.141; TCGA LGG -0.132; TCGA LUSC -0.103; TCGA PRAD -0.252; TCGA SARC -0.203; TCGA THCA -0.098; TCGA STAD -0.488; TCGA UCEC -0.214
hsa-miR-590-3p
NHS
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; PAAD; PRAD; SARC; STAD
PITA; miRanda; mirMAP
TCGA BLCA -0.13; TCGA BRCA -0.212; TCGA CESC -0.194; TCGA COAD -0.159; TCGA ESCA -0.248; TCGA LUAD -0.141; TCGA PAAD -0.248; TCGA PRAD -0.347; TCGA SARC -0.496; TCGA STAD -0.16
hsa-miR-590-3p
NRK
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.486; TCGA BRCA -0.416; TCGA CESC -0.541; TCGA COAD -1.062; TCGA ESCA -0.975; TCGA HNSC -0.532; TCGA KIRC -1.586; TCGA KIRP -0.699; TCGA PAAD -0.917; TCGA PRAD -0.404; TCGA SARC -1.001; TCGA STAD -1.076; TCGA UCEC -0.647
hsa-miR-590-3p
LRRK2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda; mirMAP; miRNATAP
TCGA BLCA -0.453; TCGA BRCA -0.206; TCGA CESC -0.25; TCGA COAD -0.603; TCGA ESCA -0.429; TCGA LUAD -0.627; TCGA LUSC -0.689; TCGA PAAD -0.291; TCGA PRAD -0.359; TCGA SARC -0.379; TCGA THCA -0.4; TCGA STAD -0.578; TCGA UCEC -0.392
hsa-miR-590-3p
CXCL12
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; STAD; UCEC
PITA; miRanda; mirMAP
TCGA BLCA -0.607; TCGA BRCA -0.387; TCGA CESC -0.287; TCGA COAD -0.502; TCGA ESCA -0.374; TCGA HNSC -0.24; TCGA KIRC -0.448; TCGA LUAD -0.196; TCGA LUSC -0.645; TCGA STAD -0.511; TCGA UCEC -0.662
hsa-miR-590-3p
THRA
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
PITA; miRanda
TCGA BLCA -0.335; TCGA BRCA -0.21; TCGA CESC -0.205; TCGA ESCA -0.179; TCGA HNSC -0.135; TCGA KIRC -0.264; TCGA KIRP -0.1; TCGA LGG -0.197; TCGA LUAD -0.206; TCGA LUSC -0.196; TCGA PRAD -0.102; TCGA SARC -0.29; TCGA THCA -0.07; TCGA STAD -0.112; TCGA UCEC -0.187
hsa-miR-590-3p
ITGB1
12 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.161; TCGA BRCA -0.056; TCGA COAD -0.175; TCGA ESCA -0.108; TCGA KIRP -0.167; TCGA LUSC -0.203; TCGA PAAD -0.333; TCGA PRAD -0.175; TCGA SARC -0.121; TCGA THCA -0.085; TCGA STAD -0.303; TCGA UCEC -0.127
hsa-miR-590-3p
DMD
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.681; TCGA BRCA -0.238; TCGA COAD -0.491; TCGA ESCA -0.437; TCGA HNSC -0.183; TCGA KIRP -0.19; TCGA LUAD -0.224; TCGA LUSC -0.23; TCGA PAAD -0.256; TCGA PRAD -0.498; TCGA SARC -0.589; TCGA STAD -0.94; TCGA UCEC -0.614
hsa-miR-590-3p
UBR1
14 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.168; TCGA BRCA -0.13; TCGA CESC -0.146; TCGA HNSC -0.073; TCGA KIRC -0.191; TCGA KIRP -0.205; TCGA LUAD -0.089; TCGA LUSC -0.136; TCGA PAAD -0.123; TCGA PRAD -0.145; TCGA SARC -0.283; TCGA THCA -0.063; TCGA STAD -0.138; TCGA UCEC -0.11
hsa-miR-590-3p
NLGN3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.283; TCGA BRCA -0.234; TCGA CESC -0.25; TCGA COAD -0.28; TCGA ESCA -0.285; TCGA KIRC -0.362; TCGA LGG -0.229; TCGA LUAD -0.191; TCGA PAAD -0.212; TCGA PRAD -0.321; TCGA SARC -0.368; TCGA STAD -0.436; TCGA UCEC -0.376
hsa-miR-590-3p
FN1
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.459; TCGA CESC -0.337; TCGA COAD -0.812; TCGA ESCA -0.426; TCGA HNSC -0.413; TCGA LUAD -0.14; TCGA LUSC -0.633; TCGA PAAD -0.686; TCGA PRAD -0.213; TCGA SARC -0.177; TCGA STAD -0.473; TCGA UCEC -0.215
hsa-miR-590-3p
ITFG1
11 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; UCEC
miRanda; mirMAP
TCGA BLCA -0.098; TCGA ESCA -0.089; TCGA HNSC -0.1; TCGA KIRC -0.15; TCGA KIRP -0.163; TCGA LUAD -0.052; TCGA LUSC -0.092; TCGA PRAD -0.107; TCGA SARC -0.073; TCGA THCA -0.099; TCGA UCEC -0.082
hsa-miR-590-3p
WISP1
11 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.229; TCGA CESC -0.314; TCGA COAD -0.567; TCGA ESCA -0.283; TCGA KIRC -0.204; TCGA KIRP -0.245; TCGA LUSC -0.281; TCGA PAAD -0.578; TCGA PRAD -0.2; TCGA STAD -0.176; TCGA UCEC -0.254
hsa-miR-590-3p
KIF1B
9 cancers: BLCA; ESCA; HNSC; KIRC; LUAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.07; TCGA ESCA -0.13; TCGA HNSC -0.178; TCGA KIRC -0.176; TCGA LUAD -0.058; TCGA PRAD -0.095; TCGA THCA -0.097; TCGA STAD -0.246; TCGA UCEC -0.061
hsa-miR-590-3p
MFAP4
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.901; TCGA BRCA -0.711; TCGA CESC -0.581; TCGA COAD -0.842; TCGA ESCA -0.659; TCGA HNSC -0.498; TCGA KIRC -0.578; TCGA LUAD -0.509; TCGA LUSC -0.909; TCGA PAAD -0.444; TCGA PRAD -0.164; TCGA SARC -0.498; TCGA STAD -0.743; TCGA UCEC -0.748
hsa-miR-590-3p
MOXD1
12 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.495; TCGA CESC -0.368; TCGA COAD -0.8; TCGA ESCA -0.426; TCGA KIRC -0.851; TCGA KIRP -0.425; TCGA LUAD -0.167; TCGA LUSC -0.306; TCGA PAAD -0.572; TCGA PRAD -0.194; TCGA STAD -0.521; TCGA UCEC -0.473
hsa-miR-590-3p
ZNF876P
9 cancers: BLCA; BRCA; ESCA; LGG; LUSC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.136; TCGA BRCA -0.1; TCGA ESCA -0.303; TCGA LGG -0.198; TCGA LUSC -0.189; TCGA SARC -0.246; TCGA THCA -0.067; TCGA STAD -0.395; TCGA UCEC -0.173
hsa-miR-590-3p
GFRA1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.801; TCGA BRCA -0.876; TCGA CESC -0.328; TCGA COAD -0.829; TCGA ESCA -0.789; TCGA HNSC -0.407; TCGA KIRC -0.509; TCGA LGG -0.649; TCGA LUAD -0.605; TCGA LUSC -0.76; TCGA PRAD -0.324; TCGA STAD -1.121; TCGA UCEC -0.854
hsa-miR-590-3p
SLITRK6
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LUAD; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.269; TCGA BRCA -0.44; TCGA CESC -0.605; TCGA HNSC -0.614; TCGA KIRP -0.338; TCGA LGG -0.226; TCGA LUAD -0.456; TCGA PAAD -0.627; TCGA PRAD -0.448; TCGA STAD -0.748
hsa-miR-590-3p
SCUBE3
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.576; TCGA COAD -0.569; TCGA ESCA -0.343; TCGA HNSC -0.387; TCGA KIRC -0.549; TCGA KIRP -0.416; TCGA LGG -0.128; TCGA LUAD -0.211; TCGA PAAD -0.721; TCGA PRAD -0.527; TCGA SARC -0.562; TCGA STAD -0.318
hsa-miR-590-3p
TPM1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.558; TCGA BRCA -0.112; TCGA CESC -0.27; TCGA COAD -0.197; TCGA ESCA -0.395; TCGA HNSC -0.23; TCGA LIHC -0.215; TCGA LUSC -0.268; TCGA PAAD -0.386; TCGA PRAD -0.369; TCGA SARC -0.568; TCGA THCA -0.096; TCGA STAD -0.673; TCGA UCEC -0.398
hsa-miR-590-3p
ARHGEF10
11 cancers: BLCA; BRCA; CESC; LIHC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.234; TCGA BRCA -0.179; TCGA CESC -0.164; TCGA LIHC -0.207; TCGA LUAD -0.139; TCGA LUSC -0.375; TCGA PAAD -0.098; TCGA SARC -0.189; TCGA THCA -0.109; TCGA STAD -0.372; TCGA UCEC -0.237
hsa-miR-590-3p
VEZF1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.129; TCGA BRCA -0.123; TCGA CESC -0.162; TCGA COAD -0.061; TCGA ESCA -0.114; TCGA KIRC -0.17; TCGA KIRP -0.123; TCGA LUAD -0.129; TCGA LUSC -0.072; TCGA PAAD -0.075; TCGA PRAD -0.096; TCGA SARC -0.103; TCGA THCA -0.074; TCGA STAD -0.177; TCGA UCEC -0.107
hsa-miR-590-3p
ALPK3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PRAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.387; TCGA BRCA -0.232; TCGA CESC -0.458; TCGA COAD -0.361; TCGA ESCA -0.239; TCGA HNSC -0.285; TCGA KIRC -0.228; TCGA LUSC -0.447; TCGA PRAD -0.117; TCGA SARC -0.379; TCGA THCA -0.158; TCGA STAD -0.585
hsa-miR-590-3p
BACE1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.226; TCGA BRCA -0.118; TCGA CESC -0.194; TCGA COAD -0.221; TCGA ESCA -0.194; TCGA HNSC -0.136; TCGA KIRC -0.118; TCGA KIRP -0.167; TCGA LIHC -0.083; TCGA LUAD -0.191; TCGA LUSC -0.224; TCGA PAAD -0.184; TCGA PRAD -0.051; TCGA THCA -0.118; TCGA STAD -0.361; TCGA UCEC -0.113
hsa-miR-590-3p
PTCH1
11 cancers: BLCA; COAD; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.181; TCGA COAD -0.219; TCGA KIRC -0.415; TCGA KIRP -0.423; TCGA LGG -0.243; TCGA LUAD -0.298; TCGA LUSC -0.169; TCGA PAAD -0.178; TCGA PRAD -0.089; TCGA STAD -0.158; TCGA UCEC -0.127
hsa-miR-590-3p
ETS2
9 cancers: BLCA; BRCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.134; TCGA BRCA -0.112; TCGA HNSC -0.089; TCGA LUAD -0.15; TCGA LUSC -0.17; TCGA PRAD -0.24; TCGA SARC -0.232; TCGA STAD -0.111; TCGA UCEC -0.168
hsa-miR-590-3p
LRRFIP1
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.169; TCGA BRCA -0.055; TCGA CESC -0.113; TCGA HNSC -0.128; TCGA KIRC -0.121; TCGA KIRP -0.171; TCGA LUAD -0.142; TCGA LUSC -0.266; TCGA PAAD -0.156; TCGA PRAD -0.134; TCGA SARC -0.127; TCGA STAD -0.077; TCGA UCEC -0.064
hsa-miR-590-3p
BTBD7
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.06; TCGA BRCA -0.122; TCGA CESC -0.159; TCGA ESCA -0.097; TCGA HNSC -0.108; TCGA KIRC -0.116; TCGA LUAD -0.099; TCGA LUSC -0.071; TCGA PAAD -0.117; TCGA PRAD -0.104; TCGA SARC -0.165; TCGA THCA -0.095; TCGA STAD -0.138; TCGA UCEC -0.072
hsa-miR-590-3p
SETD2
10 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.059; TCGA CESC -0.118; TCGA ESCA -0.082; TCGA KIRC -0.229; TCGA KIRP -0.141; TCGA LUAD -0.108; TCGA LUSC -0.062; TCGA PRAD -0.072; TCGA SARC -0.141; TCGA STAD -0.08
hsa-miR-590-3p
TMEM132B
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.324; TCGA BRCA -0.258; TCGA CESC -0.25; TCGA COAD -0.438; TCGA ESCA -0.376; TCGA HNSC -0.299; TCGA KIRP -0.424; TCGA LGG -0.379; TCGA LUAD -0.22; TCGA PRAD -0.27; TCGA THCA -0.174; TCGA STAD -0.663; TCGA UCEC -0.306
hsa-miR-590-3p
FAM114A2
9 cancers: BLCA; BRCA; KIRP; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.101; TCGA BRCA -0.118; TCGA KIRP -0.114; TCGA LUAD -0.058; TCGA LUSC -0.121; TCGA PAAD -0.082; TCGA SARC -0.092; TCGA STAD -0.101; TCGA UCEC -0.132
hsa-miR-590-3p
NPAS3
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; LUAD; LUSC; PRAD; STAD
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.262; TCGA BRCA -0.171; TCGA COAD -0.644; TCGA ESCA -0.433; TCGA KIRC -0.285; TCGA LGG -0.152; TCGA LUAD -0.236; TCGA LUSC -0.349; TCGA PRAD -0.144; TCGA STAD -0.737
hsa-miR-590-3p
SWAP70
12 cancers: BLCA; BRCA; CESC; COAD; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.058; TCGA BRCA -0.089; TCGA CESC -0.141; TCGA COAD -0.107; TCGA KIRP -0.148; TCGA LUAD -0.1; TCGA LUSC -0.133; TCGA PAAD -0.111; TCGA PRAD -0.085; TCGA THCA -0.094; TCGA STAD -0.093; TCGA UCEC -0.106
hsa-miR-590-3p
CACNA1G
11 cancers: BLCA; BRCA; CESC; HNSC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.23; TCGA BRCA -0.629; TCGA CESC -0.268; TCGA HNSC -0.406; TCGA LGG -0.195; TCGA LUAD -0.438; TCGA LUSC -0.288; TCGA PRAD -0.224; TCGA SARC -0.479; TCGA STAD -0.426; TCGA UCEC -0.388
hsa-miR-590-3p
NACC2
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; SARC; STAD
miRanda; miRNATAP
TCGA BLCA -0.271; TCGA BRCA -0.144; TCGA COAD -0.095; TCGA ESCA -0.263; TCGA HNSC -0.116; TCGA KIRC -0.217; TCGA KIRP -0.295; TCGA LGG -0.078; TCGA LUSC -0.166; TCGA PRAD -0.348; TCGA SARC -0.287; TCGA STAD -0.458
hsa-miR-590-3p
ACSS3
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.578; TCGA BRCA -0.375; TCGA CESC -0.596; TCGA COAD -0.853; TCGA ESCA -0.391; TCGA HNSC -0.425; TCGA KIRC -0.483; TCGA LUAD -0.253; TCGA LUSC -0.746; TCGA PAAD -0.465; TCGA PRAD -0.473; TCGA SARC -0.337; TCGA THCA -0.225; TCGA STAD -0.413; TCGA UCEC -0.441
hsa-miR-590-3p
NRG2
11 cancers: BLCA; BRCA; CESC; ESCA; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.549; TCGA BRCA -0.256; TCGA CESC -0.446; TCGA ESCA -0.348; TCGA LGG -0.168; TCGA LUAD -0.18; TCGA LUSC -0.401; TCGA PRAD -0.563; TCGA SARC -0.466; TCGA STAD -0.749; TCGA UCEC -0.265
hsa-miR-590-3p
MAPK4
11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.788; TCGA COAD -0.88; TCGA ESCA -0.724; TCGA HNSC -0.284; TCGA KIRC -1.669; TCGA KIRP -0.404; TCGA LUAD -0.307; TCGA LUSC -0.528; TCGA SARC -1.561; TCGA STAD -1.517; TCGA UCEC -0.531
hsa-miR-590-3p
ARMCX2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.155; TCGA BRCA -0.202; TCGA CESC -0.413; TCGA COAD -0.536; TCGA ESCA -0.263; TCGA HNSC -0.222; TCGA KIRC -0.211; TCGA KIRP -0.18; TCGA LUAD -0.154; TCGA LUSC -0.251; TCGA PRAD -0.235; TCGA THCA -0.191; TCGA STAD -0.521; TCGA UCEC -0.289
hsa-miR-590-3p
LPP
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.433; TCGA BRCA -0.161; TCGA CESC -0.153; TCGA COAD -0.275; TCGA ESCA -0.372; TCGA HNSC -0.211; TCGA KIRC -0.156; TCGA KIRP -0.179; TCGA LUAD -0.139; TCGA PAAD -0.447; TCGA PRAD -0.386; TCGA SARC -0.665; TCGA STAD -0.731; TCGA UCEC -0.122
hsa-miR-590-3p
SMAD7
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; UCEC
miRanda
TCGA BLCA -0.223; TCGA BRCA -0.104; TCGA CESC -0.142; TCGA COAD -0.201; TCGA ESCA -0.134; TCGA KIRC -0.079; TCGA KIRP -0.143; TCGA LGG -0.125; TCGA LUAD -0.166; TCGA LUSC -0.44; TCGA PAAD -0.105; TCGA PRAD -0.135; TCGA UCEC -0.229
hsa-miR-590-3p
PCDHB16
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.217; TCGA BRCA -0.212; TCGA COAD -0.548; TCGA ESCA -0.302; TCGA HNSC -0.377; TCGA LIHC -0.248; TCGA LUAD -0.142; TCGA LUSC -0.388; TCGA PAAD -0.215; TCGA STAD -0.362; TCGA UCEC -0.143
hsa-miR-590-3p
PDE1A
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.804; TCGA BRCA -0.426; TCGA CESC -0.407; TCGA COAD -0.789; TCGA ESCA -0.496; TCGA HNSC -0.287; TCGA KIRC -0.925; TCGA KIRP -0.867; TCGA LUAD -0.151; TCGA LUSC -0.517; TCGA PAAD -0.404; TCGA SARC -0.609; TCGA STAD -0.57; TCGA UCEC -0.331
hsa-miR-590-3p
PHKB
9 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.14; TCGA ESCA -0.098; TCGA HNSC -0.074; TCGA KIRC -0.242; TCGA KIRP -0.136; TCGA LUAD -0.119; TCGA LUSC -0.073; TCGA SARC -0.069; TCGA STAD -0.055
hsa-miR-590-3p
CAST
11 cancers: BLCA; BRCA; CESC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.164; TCGA BRCA -0.082; TCGA CESC -0.107; TCGA KIRP -0.076; TCGA LUAD -0.089; TCGA LUSC -0.179; TCGA PAAD -0.147; TCGA PRAD -0.15; TCGA SARC -0.076; TCGA STAD -0.191; TCGA UCEC -0.145
hsa-miR-590-3p
PLXDC1
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.17; TCGA BRCA -0.24; TCGA CESC -0.169; TCGA COAD -0.357; TCGA HNSC -0.198; TCGA LIHC -0.394; TCGA LUAD -0.142; TCGA LUSC -0.263; TCGA PAAD -0.161; TCGA STAD -0.197; TCGA UCEC -0.259
hsa-miR-590-3p
CYTH3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.135; TCGA BRCA -0.148; TCGA CESC -0.195; TCGA COAD -0.165; TCGA ESCA -0.23; TCGA HNSC -0.139; TCGA KIRC -0.161; TCGA LUAD -0.234; TCGA LUSC -0.261; TCGA PAAD -0.321; TCGA SARC -0.11; TCGA STAD -0.284; TCGA UCEC -0.165
hsa-miR-590-3p
SORBS2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.667; TCGA BRCA -0.199; TCGA CESC -0.521; TCGA COAD -0.311; TCGA ESCA -0.43; TCGA HNSC -0.309; TCGA KIRC -0.126; TCGA LUAD -0.395; TCGA LUSC -0.592; TCGA PRAD -0.241; TCGA SARC -0.289; TCGA STAD -0.695
hsa-miR-590-3p
MACROD2
12 cancers: BLCA; BRCA; CESC; COAD; KIRC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.246; TCGA BRCA -0.19; TCGA CESC -0.281; TCGA COAD -0.287; TCGA KIRC -0.251; TCGA LGG -0.151; TCGA LUAD -0.506; TCGA LUSC -0.564; TCGA PRAD -0.259; TCGA SARC -0.491; TCGA STAD -0.413; TCGA UCEC -0.204
hsa-miR-590-3p
CALD1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.598; TCGA BRCA -0.128; TCGA CESC -0.263; TCGA COAD -0.683; TCGA ESCA -0.565; TCGA HNSC -0.221; TCGA LUAD -0.155; TCGA LUSC -0.426; TCGA PAAD -0.487; TCGA PRAD -0.384; TCGA SARC -0.504; TCGA THCA -0.089; TCGA STAD -0.903; TCGA UCEC -0.467
hsa-miR-590-3p
RALGAPA1
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUSC; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.091; TCGA BRCA -0.113; TCGA CESC -0.125; TCGA ESCA -0.171; TCGA KIRC -0.189; TCGA KIRP -0.13; TCGA LGG -0.143; TCGA LUSC -0.115; TCGA SARC -0.154; TCGA STAD -0.199
hsa-miR-590-3p
GNPDA2
12 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LGG; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.116; TCGA BRCA -0.134; TCGA CESC -0.108; TCGA COAD -0.08; TCGA KIRC -0.104; TCGA KIRP -0.141; TCGA LGG -0.116; TCGA PRAD -0.088; TCGA SARC -0.136; TCGA THCA -0.061; TCGA STAD -0.245; TCGA UCEC -0.205
hsa-miR-590-3p
GLI3
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.303; TCGA BRCA -0.345; TCGA COAD -0.793; TCGA ESCA -0.363; TCGA HNSC -0.186; TCGA LUAD -0.279; TCGA LUSC -0.303; TCGA PAAD -0.465; TCGA PRAD -0.357; TCGA STAD -0.667; TCGA UCEC -0.49
hsa-miR-590-3p
KIAA1191
11 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LUSC; PAAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.064; TCGA CESC -0.073; TCGA ESCA -0.139; TCGA KIRC -0.116; TCGA KIRP -0.165; TCGA LUSC -0.051; TCGA PAAD -0.06; TCGA SARC -0.178; TCGA THCA -0.056; TCGA STAD -0.106; TCGA UCEC -0.074
hsa-miR-590-3p
AVPR1A
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.329; TCGA BRCA -0.286; TCGA CESC -0.528; TCGA COAD -0.501; TCGA ESCA -0.286; TCGA HNSC -0.346; TCGA KIRC -0.46; TCGA KIRP -0.814; TCGA LUSC -0.42; TCGA PAAD -0.478; TCGA PRAD -0.409; TCGA SARC -0.251; TCGA STAD -0.473; TCGA UCEC -0.617
hsa-miR-590-3p
TGFBR2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.299; TCGA BRCA -0.338; TCGA CESC -0.258; TCGA COAD -0.192; TCGA ESCA -0.271; TCGA HNSC -0.151; TCGA KIRC -0.227; TCGA KIRP -0.244; TCGA LUAD -0.299; TCGA LUSC -0.612; TCGA PAAD -0.242; TCGA PRAD -0.217; TCGA STAD -0.2; TCGA UCEC -0.352
hsa-miR-590-3p
MEIS2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.461; TCGA BRCA -0.297; TCGA CESC -0.381; TCGA COAD -0.578; TCGA ESCA -0.19; TCGA HNSC -0.137; TCGA KIRC -0.362; TCGA LGG -0.119; TCGA LUAD -0.137; TCGA PAAD -0.334; TCGA PRAD -0.479; TCGA SARC -0.587; TCGA STAD -0.377; TCGA UCEC -0.228
hsa-miR-590-3p
PCDH20
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.615; TCGA BRCA -0.381; TCGA CESC -0.781; TCGA COAD -0.595; TCGA ESCA -0.753; TCGA HNSC -0.446; TCGA KIRC -0.973; TCGA LGG -0.609; TCGA LUAD -0.638; TCGA LUSC -0.519; TCGA PRAD -0.32; TCGA SARC -1.3; TCGA STAD -1.022; TCGA UCEC -0.77
hsa-miR-590-3p
GPM6A
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.626; TCGA BRCA -0.566; TCGA CESC -0.456; TCGA COAD -1.435; TCGA ESCA -1.316; TCGA KIRC -0.645; TCGA KIRP -0.291; TCGA LGG -0.259; TCGA LUAD -0.481; TCGA LUSC -0.904; TCGA PRAD -0.43; TCGA SARC -0.511; TCGA STAD -1.246; TCGA UCEC -1.053
hsa-miR-590-3p
ALDH1A3
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUSC; PAAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.208; TCGA BRCA -0.137; TCGA CESC -0.332; TCGA COAD -0.564; TCGA ESCA -0.346; TCGA KIRC -0.287; TCGA LUSC -0.305; TCGA PAAD -0.6; TCGA THCA -0.259; TCGA STAD -0.401; TCGA UCEC -0.342
hsa-miR-590-3p
DTNA
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.846; TCGA CESC -0.316; TCGA COAD -0.876; TCGA ESCA -0.639; TCGA HNSC -0.44; TCGA LIHC -0.396; TCGA LUAD -0.198; TCGA LUSC -0.365; TCGA PRAD -0.395; TCGA SARC -0.629; TCGA STAD -0.967; TCGA UCEC -0.574
hsa-miR-590-3p
ELF2
9 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LUSC; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.052; TCGA BRCA -0.054; TCGA CESC -0.103; TCGA ESCA -0.075; TCGA KIRP -0.096; TCGA LUSC -0.055; TCGA SARC -0.2; TCGA STAD -0.116; TCGA UCEC -0.06
hsa-miR-590-3p
NID1
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.313; TCGA BRCA -0.204; TCGA CESC -0.406; TCGA COAD -0.335; TCGA HNSC -0.404; TCGA LUAD -0.133; TCGA LUSC -0.262; TCGA PAAD -0.315; TCGA PRAD -0.361; TCGA SARC -0.158; TCGA THCA -0.211; TCGA STAD -0.339; TCGA UCEC -0.289
hsa-miR-590-3p
GNB5
11 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.156; TCGA BRCA -0.131; TCGA COAD -0.141; TCGA KIRC -0.291; TCGA KIRP -0.21; TCGA LGG -0.161; TCGA PAAD -0.075; TCGA PRAD -0.148; TCGA SARC -0.228; TCGA THCA -0.066; TCGA STAD -0.209
hsa-miR-590-3p
RECK
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.401; TCGA BRCA -0.368; TCGA CESC -0.314; TCGA COAD -0.479; TCGA ESCA -0.4; TCGA HNSC -0.243; TCGA KIRC -0.162; TCGA KIRP -0.128; TCGA LUAD -0.212; TCGA LUSC -0.549; TCGA PAAD -0.305; TCGA PRAD -0.066; TCGA STAD -0.549; TCGA UCEC -0.461
hsa-miR-590-3p
SCN3A
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.339; TCGA BRCA -0.591; TCGA COAD -0.538; TCGA ESCA -0.299; TCGA KIRC -0.796; TCGA KIRP -0.637; TCGA LGG -0.455; TCGA LUSC -0.239; TCGA PRAD -0.293; TCGA SARC -0.754; TCGA STAD -0.405; TCGA UCEC -0.377
hsa-miR-590-3p
PTRF
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.46; TCGA BRCA -0.333; TCGA COAD -0.427; TCGA ESCA -0.316; TCGA HNSC -0.131; TCGA LIHC -0.215; TCGA LUAD -0.255; TCGA LUSC -0.394; TCGA PAAD -0.294; TCGA PRAD -0.317; TCGA SARC -0.102; TCGA STAD -0.611; TCGA UCEC -0.494
hsa-miR-590-3p
SULF1
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.437; TCGA CESC -0.277; TCGA COAD -0.773; TCGA ESCA -0.367; TCGA HNSC -0.405; TCGA LUSC -0.195; TCGA PAAD -0.703; TCGA PRAD -0.221; TCGA SARC -0.316; TCGA STAD -0.245
hsa-miR-590-3p
CHL1
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LGG; LUSC; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.56; TCGA BRCA -0.659; TCGA COAD -0.732; TCGA HNSC -0.767; TCGA KIRC -1.199; TCGA LGG -0.15; TCGA LUSC -0.378; TCGA PRAD -0.326; TCGA STAD -0.56; TCGA UCEC -0.464
hsa-miR-590-3p
EDNRB
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.412; TCGA BRCA -0.367; TCGA CESC -0.293; TCGA COAD -0.307; TCGA HNSC -0.193; TCGA LUAD -0.369; TCGA LUSC -0.826; TCGA PRAD -0.376; TCGA SARC -0.225; TCGA THCA -0.231; TCGA STAD -0.243; TCGA UCEC -0.409
hsa-miR-590-3p
OSR2
9 cancers: BLCA; BRCA; CESC; KIRC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.234; TCGA BRCA -0.205; TCGA CESC -0.249; TCGA KIRC -0.216; TCGA PAAD -0.385; TCGA PRAD -0.109; TCGA SARC -0.361; TCGA STAD -0.152; TCGA UCEC -0.519
hsa-miR-590-3p
SHE
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.391; TCGA BRCA -0.407; TCGA CESC -0.326; TCGA COAD -0.529; TCGA ESCA -0.286; TCGA HNSC -0.156; TCGA KIRC -0.26; TCGA KIRP -0.219; TCGA LUAD -0.566; TCGA LUSC -0.71; TCGA PAAD -0.178; TCGA PRAD -0.159; TCGA SARC -0.167; TCGA THCA -0.182; TCGA STAD -0.417; TCGA UCEC -0.45
hsa-miR-590-3p
FAT4
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.61; TCGA BRCA -0.465; TCGA CESC -0.493; TCGA COAD -0.668; TCGA ESCA -0.439; TCGA HNSC -0.341; TCGA KIRC -0.221; TCGA KIRP -0.531; TCGA LUAD -0.441; TCGA LUSC -0.674; TCGA PAAD -0.442; TCGA PRAD -0.471; TCGA SARC -0.371; TCGA THCA -0.148; TCGA STAD -0.571; TCGA UCEC -0.282
hsa-miR-590-3p
PROS1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.402; TCGA BRCA -0.35; TCGA CESC -0.455; TCGA COAD -0.192; TCGA ESCA -0.336; TCGA HNSC -0.415; TCGA LUAD -0.2; TCGA LUSC -0.404; TCGA PAAD -0.301; TCGA PRAD -0.133; TCGA SARC -0.343; TCGA STAD -0.429; TCGA UCEC -0.45
hsa-miR-590-3p
RELN
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; SARC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.679; TCGA BRCA -0.639; TCGA CESC -0.566; TCGA COAD -1.177; TCGA ESCA -0.563; TCGA HNSC -0.381; TCGA KIRC -0.779; TCGA LUSC -0.644; TCGA SARC -0.56; TCGA STAD -0.788; TCGA UCEC -0.627
hsa-miR-590-3p
PLSCR4
13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.433; TCGA BRCA -0.44; TCGA COAD -0.208; TCGA ESCA -0.308; TCGA KIRC -0.118; TCGA KIRP -0.194; TCGA LUAD -0.281; TCGA LUSC -0.448; TCGA PAAD -0.316; TCGA PRAD -0.339; TCGA SARC -0.265; TCGA STAD -0.558; TCGA UCEC -0.554
hsa-miR-590-3p
PCMTD1
10 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LUSC; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.095; TCGA CESC -0.129; TCGA COAD -0.122; TCGA ESCA -0.118; TCGA KIRC -0.171; TCGA KIRP -0.105; TCGA LUSC -0.139; TCGA SARC -0.289; TCGA STAD -0.286; TCGA UCEC -0.155
hsa-miR-590-3p
RSU1
9 cancers: BLCA; CESC; COAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.156; TCGA CESC -0.128; TCGA COAD -0.083; TCGA LUSC -0.197; TCGA PAAD -0.202; TCGA PRAD -0.138; TCGA SARC -0.109; TCGA STAD -0.169; TCGA UCEC -0.079
hsa-miR-590-3p
PRKAR1A
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.084; TCGA BRCA -0.077; TCGA CESC -0.118; TCGA COAD -0.09; TCGA ESCA -0.101; TCGA HNSC -0.076; TCGA KIRC -0.183; TCGA KIRP -0.153; TCGA LUAD -0.137; TCGA LUSC -0.156; TCGA PRAD -0.158; TCGA SARC -0.074; TCGA THCA -0.109; TCGA STAD -0.163; TCGA UCEC -0.203
hsa-miR-590-3p
FHL1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -1.001; TCGA BRCA -0.636; TCGA CESC -0.536; TCGA COAD -0.774; TCGA ESCA -0.724; TCGA HNSC -0.312; TCGA LGG -0.104; TCGA LUAD -0.455; TCGA LUSC -0.766; TCGA PRAD -0.495; TCGA SARC -0.601; TCGA STAD -1.134; TCGA UCEC -0.71
hsa-miR-590-3p
CHN2
10 cancers: BLCA; BRCA; CESC; KIRC; LUAD; LUSC; PRAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.255; TCGA BRCA -0.25; TCGA CESC -0.216; TCGA KIRC -0.485; TCGA LUAD -0.186; TCGA LUSC -0.229; TCGA PRAD -0.124; TCGA SARC -0.163; TCGA THCA -0.211; TCGA UCEC -0.16
hsa-miR-590-3p
PPM1K
11 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUSC; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.18; TCGA CESC -0.202; TCGA COAD -0.154; TCGA ESCA -0.199; TCGA KIRC -0.427; TCGA KIRP -0.25; TCGA LGG -0.074; TCGA LUSC -0.248; TCGA SARC -0.201; TCGA STAD -0.342; TCGA UCEC -0.256
hsa-miR-590-3p
HSPG2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.395; TCGA BRCA -0.276; TCGA CESC -0.2; TCGA COAD -0.324; TCGA ESCA -0.273; TCGA HNSC -0.267; TCGA KIRP -0.287; TCGA LIHC -0.18; TCGA LUAD -0.256; TCGA LUSC -0.274; TCGA PAAD -0.311; TCGA PRAD -0.259; TCGA SARC -0.24; TCGA THCA -0.241; TCGA STAD -0.335; TCGA UCEC -0.165
hsa-miR-590-3p
KLF11
10 cancers: BLCA; CESC; COAD; ESCA; KIRC; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.111; TCGA CESC -0.09; TCGA COAD -0.091; TCGA ESCA -0.167; TCGA KIRC -0.124; TCGA LUSC -0.122; TCGA PRAD -0.168; TCGA SARC -0.165; TCGA STAD -0.287; TCGA UCEC -0.251
hsa-miR-590-3p
ARHGEF15
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.246; TCGA BRCA -0.384; TCGA CESC -0.242; TCGA COAD -0.37; TCGA ESCA -0.211; TCGA HNSC -0.132; TCGA LIHC -0.299; TCGA LUAD -0.269; TCGA LUSC -0.61; TCGA THCA -0.175; TCGA STAD -0.227; TCGA UCEC -0.336
hsa-miR-590-3p
MYO9A
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.213; TCGA BRCA -0.202; TCGA CESC -0.26; TCGA COAD -0.191; TCGA ESCA -0.262; TCGA HNSC -0.214; TCGA KIRC -0.354; TCGA KIRP -0.453; TCGA LGG -0.125; TCGA LUAD -0.255; TCGA LUSC -0.217; TCGA PAAD -0.309; TCGA PRAD -0.312; TCGA SARC -0.398; TCGA THCA -0.15; TCGA STAD -0.392; TCGA UCEC -0.097
hsa-miR-590-3p
LRRC2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.745; TCGA BRCA -0.419; TCGA CESC -0.264; TCGA COAD -0.214; TCGA ESCA -0.369; TCGA HNSC -0.344; TCGA KIRC -1.033; TCGA KIRP -0.471; TCGA LUAD -0.207; TCGA LUSC -0.488; TCGA PRAD -0.321; TCGA SARC -0.496; TCGA STAD -0.52; TCGA UCEC -0.606
hsa-miR-590-3p
TTC3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.099; TCGA BRCA -0.062; TCGA CESC -0.145; TCGA COAD -0.055; TCGA ESCA -0.105; TCGA HNSC -0.081; TCGA KIRC -0.136; TCGA KIRP -0.214; TCGA LGG -0.25; TCGA LUAD -0.099; TCGA SARC -0.083; TCGA THCA -0.113; TCGA STAD -0.15; TCGA UCEC -0.121
hsa-miR-590-3p
ATF7
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.131; TCGA BRCA -0.133; TCGA CESC -0.145; TCGA COAD -0.095; TCGA ESCA -0.102; TCGA HNSC -0.135; TCGA KIRP -0.104; TCGA LUAD -0.151; TCGA LUSC -0.103; TCGA PAAD -0.158; TCGA PRAD -0.103; TCGA SARC -0.214; TCGA THCA -0.077; TCGA STAD -0.198
hsa-miR-590-3p
PPP1R12A
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.247; TCGA BRCA -0.057; TCGA CESC -0.112; TCGA COAD -0.082; TCGA ESCA -0.203; TCGA KIRP -0.122; TCGA LGG -0.081; TCGA PAAD -0.094; TCGA PRAD -0.22; TCGA SARC -0.389; TCGA STAD -0.385; TCGA UCEC -0.197
hsa-miR-590-3p
MXI1
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LGG; PAAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.144; TCGA BRCA -0.138; TCGA CESC -0.113; TCGA ESCA -0.181; TCGA HNSC -0.095; TCGA KIRP -0.115; TCGA LGG -0.138; TCGA PAAD -0.116; TCGA SARC -0.239; TCGA THCA -0.072; TCGA STAD -0.322; TCGA UCEC -0.236
hsa-miR-590-3p
SETD3
9 cancers: BLCA; ESCA; HNSC; KIRC; LUAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.092; TCGA ESCA -0.097; TCGA HNSC -0.057; TCGA KIRC -0.159; TCGA LUAD -0.051; TCGA SARC -0.056; TCGA THCA -0.055; TCGA STAD -0.122; TCGA UCEC -0.093
hsa-miR-590-3p
WDR82
9 cancers: BLCA; CESC; ESCA; LGG; LUAD; PAAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.077; TCGA CESC -0.097; TCGA ESCA -0.074; TCGA LGG -0.054; TCGA LUAD -0.062; TCGA PAAD -0.089; TCGA PRAD -0.114; TCGA SARC -0.146; TCGA STAD -0.069
hsa-miR-590-3p
GLIS3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.234; TCGA BRCA -0.127; TCGA CESC -0.378; TCGA COAD -0.388; TCGA ESCA -0.255; TCGA HNSC -0.286; TCGA KIRC -0.272; TCGA KIRP -0.224; TCGA LUAD -0.19; TCGA LUSC -0.354; TCGA PAAD -0.359; TCGA PRAD -0.251; TCGA SARC -0.224; TCGA STAD -0.195
hsa-miR-590-3p
ESR1
9 cancers: BLCA; BRCA; CESC; COAD; KIRC; LUSC; PRAD; SARC; STAD
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.241; TCGA BRCA -0.88; TCGA CESC -0.464; TCGA COAD -0.497; TCGA KIRC -0.299; TCGA LUSC -0.447; TCGA PRAD -0.285; TCGA SARC -0.548; TCGA STAD -0.354
hsa-miR-590-3p
COL4A3
11 cancers: BLCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.347; TCGA COAD -0.41; TCGA ESCA -0.397; TCGA KIRC -0.8; TCGA KIRP -0.47; TCGA LGG -0.164; TCGA LUAD -0.454; TCGA LUSC -0.74; TCGA PRAD -0.135; TCGA STAD -0.481; TCGA UCEC -0.394
hsa-miR-590-3p
ZNF445
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; SARC; STAD
miRanda
TCGA BLCA -0.05; TCGA BRCA -0.079; TCGA CESC -0.144; TCGA ESCA -0.13; TCGA KIRC -0.225; TCGA KIRP -0.127; TCGA LGG -0.108; TCGA LUAD -0.103; TCGA SARC -0.222; TCGA STAD -0.176
hsa-miR-590-3p
TXNDC15
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LIHC; LUAD; LUSC; SARC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.171; TCGA BRCA -0.094; TCGA CESC -0.079; TCGA COAD -0.134; TCGA ESCA -0.149; TCGA KIRP -0.146; TCGA LIHC -0.061; TCGA LUAD -0.068; TCGA LUSC -0.158; TCGA SARC -0.081; TCGA STAD -0.145; TCGA UCEC -0.149
hsa-miR-590-3p
FBXL5
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.147; TCGA BRCA -0.182; TCGA CESC -0.07; TCGA COAD -0.093; TCGA ESCA -0.113; TCGA LUSC -0.114; TCGA PRAD -0.103; TCGA SARC -0.12; TCGA STAD -0.184; TCGA UCEC -0.123
hsa-miR-590-3p
ABI3BP
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.814; TCGA BRCA -0.435; TCGA COAD -0.668; TCGA ESCA -0.97; TCGA HNSC -0.254; TCGA LUAD -0.325; TCGA LUSC -0.842; TCGA PAAD -0.442; TCGA PRAD -0.161; TCGA SARC -0.26; TCGA STAD -0.933; TCGA UCEC -0.496
hsa-miR-590-3p
ACTN1
10 cancers: BLCA; COAD; ESCA; LIHC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.333; TCGA COAD -0.174; TCGA ESCA -0.272; TCGA LIHC -0.1; TCGA LUSC -0.235; TCGA PAAD -0.219; TCGA PRAD -0.292; TCGA SARC -0.41; TCGA STAD -0.48; TCGA UCEC -0.152
hsa-miR-590-3p
RAI2
18 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.659; TCGA BRCA -0.584; TCGA CESC -0.364; TCGA COAD -0.549; TCGA ESCA -0.476; TCGA HNSC -0.298; TCGA KIRC -0.353; TCGA KIRP -0.239; TCGA LGG -0.194; TCGA LIHC -0.23; TCGA LUAD -0.368; TCGA LUSC -0.635; TCGA PAAD -0.171; TCGA PRAD -0.204; TCGA SARC -0.502; TCGA THCA -0.089; TCGA STAD -0.61; TCGA UCEC -0.186
hsa-miR-590-3p
FILIP1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.855; TCGA BRCA -0.223; TCGA CESC -0.376; TCGA COAD -0.691; TCGA ESCA -0.496; TCGA HNSC -0.331; TCGA KIRP -0.229; TCGA LUAD -0.378; TCGA LUSC -0.574; TCGA PAAD -0.34; TCGA PRAD -0.45; TCGA SARC -0.602; TCGA THCA -0.172; TCGA STAD -0.991; TCGA UCEC -0.372
hsa-miR-590-3p
KIDINS220
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.096; TCGA BRCA -0.057; TCGA CESC -0.164; TCGA COAD -0.116; TCGA ESCA -0.083; TCGA HNSC -0.14; TCGA KIRC -0.16; TCGA KIRP -0.186; TCGA LGG -0.126; TCGA LUAD -0.14; TCGA LUSC -0.11; TCGA PAAD -0.163; TCGA PRAD -0.142; TCGA SARC -0.203; TCGA THCA -0.133; TCGA STAD -0.212; TCGA UCEC -0.167
hsa-miR-590-3p
EPM2A
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.307; TCGA BRCA -0.066; TCGA CESC -0.112; TCGA COAD -0.15; TCGA ESCA -0.341; TCGA HNSC -0.106; TCGA KIRC -0.405; TCGA LUAD -0.075; TCGA PRAD -0.183; TCGA SARC -0.286; TCGA STAD -0.549; TCGA UCEC -0.259
hsa-miR-590-3p
SNRK
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.139; TCGA BRCA -0.143; TCGA CESC -0.158; TCGA COAD -0.088; TCGA ESCA -0.127; TCGA HNSC -0.097; TCGA KIRC -0.19; TCGA KIRP -0.195; TCGA LGG -0.075; TCGA LUAD -0.122; TCGA LUSC -0.278; TCGA PAAD -0.083; TCGA PRAD -0.072; TCGA SARC -0.209; TCGA THCA -0.111; TCGA STAD -0.237; TCGA UCEC -0.195
hsa-miR-590-3p
RSF1
13 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.077; TCGA CESC -0.185; TCGA COAD -0.06; TCGA HNSC -0.079; TCGA KIRC -0.162; TCGA KIRP -0.318; TCGA LGG -0.146; TCGA PAAD -0.125; TCGA PRAD -0.134; TCGA SARC -0.209; TCGA THCA -0.117; TCGA STAD -0.152; TCGA UCEC -0.095
hsa-miR-590-3p
CDKN1C
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.296; TCGA BRCA -0.363; TCGA CESC -0.207; TCGA COAD -0.328; TCGA HNSC -0.254; TCGA KIRC -0.476; TCGA LUAD -0.147; TCGA LUSC -0.325; TCGA PAAD -0.159; TCGA PRAD -0.104; TCGA STAD -0.456; TCGA UCEC -0.23
hsa-miR-590-3p
ZNF578
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LGG; LUSC; SARC; STAD
miRanda
TCGA BLCA -0.196; TCGA BRCA -0.153; TCGA CESC -0.219; TCGA ESCA -0.293; TCGA HNSC -0.214; TCGA KIRC -0.435; TCGA LGG -0.21; TCGA LUSC -0.341; TCGA SARC -0.253; TCGA STAD -0.257
hsa-miR-590-3p
EBF1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.518; TCGA BRCA -0.463; TCGA CESC -0.285; TCGA COAD -0.413; TCGA ESCA -0.199; TCGA HNSC -0.204; TCGA LIHC -0.303; TCGA LUAD -0.129; TCGA LUSC -0.459; TCGA PRAD -0.151; TCGA STAD -0.449; TCGA UCEC -0.283
hsa-miR-590-3p
CYP39A1
9 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; STAD; UCEC
miRanda
TCGA BLCA -0.435; TCGA CESC -0.501; TCGA ESCA -0.415; TCGA HNSC -0.469; TCGA KIRC -0.939; TCGA KIRP -0.473; TCGA LUSC -0.49; TCGA STAD -0.658; TCGA UCEC -0.245
hsa-miR-590-3p
ANKRD42
10 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.05; TCGA BRCA -0.149; TCGA CESC -0.155; TCGA KIRC -0.072; TCGA KIRP -0.112; TCGA LUAD -0.088; TCGA LUSC -0.106; TCGA PRAD -0.08; TCGA THCA -0.102; TCGA STAD -0.074
hsa-miR-590-3p
CCDC80
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.693; TCGA BRCA -0.429; TCGA CESC -0.363; TCGA COAD -0.829; TCGA ESCA -0.726; TCGA HNSC -0.411; TCGA KIRP -0.29; TCGA LGG -0.106; TCGA LIHC -0.383; TCGA LUAD -0.142; TCGA LUSC -0.49; TCGA PAAD -0.639; TCGA PRAD -0.24; TCGA STAD -0.772; TCGA UCEC -0.496
hsa-miR-590-3p
KLHL5
9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.21; TCGA BRCA -0.099; TCGA COAD -0.411; TCGA KIRC -0.102; TCGA KIRP -0.245; TCGA PAAD -0.157; TCGA PRAD -0.343; TCGA STAD -0.381; TCGA UCEC -0.117
hsa-miR-590-3p
WDR47
11 cancers: BLCA; CESC; COAD; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.069; TCGA CESC -0.171; TCGA COAD -0.124; TCGA KIRC -0.096; TCGA KIRP -0.213; TCGA LUAD -0.107; TCGA PAAD -0.17; TCGA PRAD -0.164; TCGA SARC -0.172; TCGA STAD -0.242; TCGA UCEC -0.115
hsa-miR-590-3p
ARHGAP24
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.424; TCGA BRCA -0.213; TCGA CESC -0.229; TCGA COAD -0.322; TCGA HNSC -0.185; TCGA KIRC -0.517; TCGA KIRP -0.131; TCGA LUAD -0.212; TCGA LUSC -0.156; TCGA PAAD -0.14; TCGA PRAD -0.271; TCGA STAD -0.273; TCGA UCEC -0.297
hsa-miR-590-3p
MPRIP
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.129; TCGA BRCA -0.084; TCGA CESC -0.112; TCGA COAD -0.102; TCGA HNSC -0.108; TCGA KIRC -0.087; TCGA KIRP -0.143; TCGA LIHC -0.105; TCGA LUAD -0.116; TCGA LUSC -0.145; TCGA SARC -0.224; TCGA THCA -0.067; TCGA STAD -0.182; TCGA UCEC -0.107
hsa-miR-590-3p
CELF2
11 cancers: BLCA; BRCA; COAD; ESCA; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.519; TCGA BRCA -0.136; TCGA COAD -0.111; TCGA ESCA -0.442; TCGA LGG -0.078; TCGA LUAD -0.23; TCGA LUSC -0.514; TCGA PRAD -0.293; TCGA SARC -0.132; TCGA STAD -0.531; TCGA UCEC -0.216
hsa-miR-590-3p
SNURF
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.569; TCGA BRCA -0.329; TCGA COAD -0.756; TCGA ESCA -0.734; TCGA HNSC -0.387; TCGA KIRC -0.716; TCGA KIRP -0.91; TCGA LGG -0.143; TCGA PRAD -0.483; TCGA SARC -0.416; TCGA UCEC -0.349
hsa-miR-590-3p
NCAM1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -1.052; TCGA BRCA -0.362; TCGA CESC -0.569; TCGA COAD -0.705; TCGA ESCA -0.863; TCGA HNSC -0.443; TCGA KIRP -0.287; TCGA LGG -0.197; TCGA LUAD -0.35; TCGA PRAD -0.562; TCGA SARC -0.686; TCGA STAD -0.929; TCGA UCEC -0.787
hsa-miR-590-3p
ATP6V1G2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.186; TCGA BRCA -0.195; TCGA CESC -0.272; TCGA COAD -0.396; TCGA ESCA -0.36; TCGA KIRC -0.394; TCGA KIRP -0.195; TCGA LGG -0.397; TCGA LUAD -0.1; TCGA THCA -0.131; TCGA STAD -0.58; TCGA UCEC -0.27
hsa-miR-590-3p
EYA4
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.364; TCGA BRCA -0.342; TCGA COAD -0.565; TCGA ESCA -0.466; TCGA HNSC -0.384; TCGA KIRC -1.259; TCGA KIRP -0.49; TCGA LUAD -0.238; TCGA LUSC -0.502; TCGA PAAD -0.515; TCGA PRAD -0.541; TCGA THCA -0.441; TCGA STAD -0.443; TCGA UCEC -0.451
hsa-miR-590-3p
EVI5
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.067; TCGA BRCA -0.076; TCGA CESC -0.176; TCGA ESCA -0.098; TCGA HNSC -0.07; TCGA KIRC -0.125; TCGA KIRP -0.112; TCGA LUAD -0.074; TCGA LUSC -0.135; TCGA PAAD -0.093; TCGA PRAD -0.082; TCGA THCA -0.083; TCGA STAD -0.132; TCGA UCEC -0.137
hsa-miR-590-3p
IQGAP1
12 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
miRanda; mirMAP
TCGA BLCA -0.15; TCGA CESC -0.134; TCGA HNSC -0.11; TCGA KIRC -0.066; TCGA KIRP -0.246; TCGA LUAD -0.153; TCGA LUSC -0.104; TCGA PAAD -0.148; TCGA PRAD -0.178; TCGA SARC -0.193; TCGA THCA -0.077; TCGA UCEC -0.109
hsa-miR-590-3p
COL4A3BP
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.119; TCGA BRCA -0.214; TCGA CESC -0.137; TCGA COAD -0.051; TCGA ESCA -0.174; TCGA LGG -0.057; TCGA LUAD -0.17; TCGA LUSC -0.209; TCGA PAAD -0.112; TCGA PRAD -0.143; TCGA SARC -0.145; TCGA THCA -0.118; TCGA STAD -0.16; TCGA UCEC -0.079
hsa-miR-590-3p
SLC46A3
9 cancers: BLCA; BRCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.274; TCGA BRCA -0.132; TCGA HNSC -0.133; TCGA LUAD -0.117; TCGA LUSC -0.383; TCGA PAAD -0.188; TCGA PRAD -0.195; TCGA THCA -0.098; TCGA STAD -0.215
hsa-miR-590-3p
TJP1
14 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.138; TCGA BRCA -0.123; TCGA CESC -0.163; TCGA HNSC -0.149; TCGA KIRC -0.186; TCGA KIRP -0.095; TCGA LUAD -0.13; TCGA LUSC -0.177; TCGA PAAD -0.2; TCGA PRAD -0.103; TCGA SARC -0.194; TCGA THCA -0.119; TCGA STAD -0.3; TCGA UCEC -0.129
hsa-miR-590-3p
AOX1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.919; TCGA BRCA -0.533; TCGA CESC -0.332; TCGA COAD -0.683; TCGA ESCA -0.61; TCGA HNSC -0.23; TCGA LUAD -0.313; TCGA LUSC -0.839; TCGA PRAD -0.671; TCGA STAD -0.774; TCGA UCEC -0.574
hsa-miR-590-3p
ABCC9
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.64; TCGA BRCA -0.372; TCGA CESC -0.436; TCGA COAD -0.717; TCGA ESCA -0.709; TCGA HNSC -0.392; TCGA KIRC -0.155; TCGA LGG -0.107; TCGA LUAD -0.194; TCGA LUSC -0.654; TCGA PAAD -0.41; TCGA PRAD -0.441; TCGA SARC -0.536; TCGA STAD -0.916; TCGA UCEC -0.295
hsa-miR-590-3p
COL6A3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.528; TCGA BRCA -0.244; TCGA CESC -0.393; TCGA COAD -0.622; TCGA ESCA -0.318; TCGA HNSC -0.383; TCGA LUAD -0.113; TCGA LUSC -0.441; TCGA PAAD -0.64; TCGA PRAD -0.302; TCGA STAD -0.314; TCGA UCEC -0.301
hsa-miR-590-3p
WSCD1
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LGG; LIHC; LUAD; LUSC; PRAD; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.407; TCGA BRCA -0.511; TCGA CESC -0.293; TCGA ESCA -0.265; TCGA KIRC -0.213; TCGA LGG -0.156; TCGA LIHC -0.422; TCGA LUAD -0.296; TCGA LUSC -0.434; TCGA PRAD -0.126; TCGA STAD -0.395; TCGA UCEC -0.547
hsa-miR-590-3p
TSLP
11 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.381; TCGA BRCA -0.512; TCGA COAD -0.278; TCGA KIRC -0.458; TCGA KIRP -0.366; TCGA LUAD -0.245; TCGA PAAD -0.262; TCGA PRAD -0.397; TCGA SARC -0.325; TCGA STAD -0.675; TCGA UCEC -0.478
hsa-miR-590-3p
SYNJ1
12 cancers: BLCA; CESC; COAD; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.06; TCGA CESC -0.106; TCGA COAD -0.06; TCGA KIRC -0.143; TCGA KIRP -0.2; TCGA LGG -0.126; TCGA LUAD -0.136; TCGA LUSC -0.173; TCGA PRAD -0.108; TCGA SARC -0.144; TCGA STAD -0.134; TCGA UCEC -0.063
hsa-miR-590-3p
USP25
11 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.1; TCGA CESC -0.095; TCGA ESCA -0.124; TCGA KIRC -0.173; TCGA KIRP -0.176; TCGA LUAD -0.062; TCGA LUSC -0.159; TCGA PAAD -0.108; TCGA PRAD -0.101; TCGA STAD -0.156; TCGA UCEC -0.126
hsa-miR-590-3p
PKIG
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.43; TCGA BRCA -0.096; TCGA CESC -0.147; TCGA COAD -0.15; TCGA ESCA -0.266; TCGA HNSC -0.11; TCGA LUSC -0.303; TCGA SARC -0.185; TCGA STAD -0.385; TCGA UCEC -0.231
hsa-miR-590-3p
NPHP1
9 cancers: BLCA; BRCA; CESC; COAD; LUSC; PAAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.141; TCGA BRCA -0.208; TCGA CESC -0.307; TCGA COAD -0.22; TCGA LUSC -0.159; TCGA PAAD -0.155; TCGA THCA -0.063; TCGA STAD -0.32; TCGA UCEC -0.131
hsa-miR-590-3p
TAPT1
10 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LUAD; LUSC; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.064; TCGA BRCA -0.158; TCGA KIRC -0.175; TCGA KIRP -0.086; TCGA LGG -0.135; TCGA LUAD -0.192; TCGA LUSC -0.147; TCGA SARC -0.159; TCGA STAD -0.1; TCGA UCEC -0.146
hsa-miR-590-3p
BCL6
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; PAAD; SARC; STAD
miRanda
TCGA BLCA -0.129; TCGA BRCA -0.186; TCGA COAD -0.168; TCGA ESCA -0.226; TCGA HNSC -0.159; TCGA LUAD -0.096; TCGA PAAD -0.157; TCGA SARC -0.144; TCGA STAD -0.318
hsa-miR-590-3p
MAPK10
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.317; TCGA BRCA -0.323; TCGA COAD -0.669; TCGA ESCA -0.436; TCGA KIRC -0.401; TCGA KIRP -0.152; TCGA LGG -0.166; TCGA LUAD -0.487; TCGA SARC -1.068; TCGA THCA -0.134; TCGA STAD -0.773; TCGA UCEC -0.481
hsa-miR-590-3p
KCTD15
9 cancers: BLCA; COAD; KIRP; LIHC; LUAD; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.199; TCGA COAD -0.275; TCGA KIRP -0.395; TCGA LIHC -0.322; TCGA LUAD -0.171; TCGA PAAD -0.125; TCGA SARC -0.463; TCGA STAD -0.459; TCGA UCEC -0.333
hsa-miR-590-3p
VLDLR
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.341; TCGA BRCA -0.129; TCGA CESC -0.251; TCGA COAD -0.416; TCGA ESCA -0.387; TCGA HNSC -0.137; TCGA KIRP -0.125; TCGA LUAD -0.153; TCGA PRAD -0.183; TCGA SARC -0.597; TCGA STAD -0.654
hsa-miR-590-3p
FAM179B
13 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.066; TCGA BRCA -0.188; TCGA CESC -0.142; TCGA COAD -0.138; TCGA KIRC -0.186; TCGA KIRP -0.175; TCGA LUAD -0.077; TCGA LUSC -0.094; TCGA PRAD -0.11; TCGA SARC -0.1; TCGA THCA -0.068; TCGA STAD -0.205; TCGA UCEC -0.219
hsa-miR-590-3p
FGF14
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.55; TCGA BRCA -0.437; TCGA CESC -0.538; TCGA COAD -0.821; TCGA ESCA -0.775; TCGA HNSC -0.428; TCGA LGG -0.302; TCGA LUAD -0.434; TCGA LUSC -0.689; TCGA PAAD -0.364; TCGA STAD -0.88; TCGA UCEC -0.423
hsa-miR-590-3p
FABP4
12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.743; TCGA BRCA -1.029; TCGA COAD -1.027; TCGA HNSC -0.666; TCGA KIRC -0.405; TCGA LIHC -0.394; TCGA LUAD -0.54; TCGA LUSC -1.176; TCGA PRAD -0.398; TCGA SARC -0.389; TCGA STAD -0.861; TCGA UCEC -0.373
hsa-miR-590-3p
CLASP1
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.059; TCGA COAD -0.054; TCGA ESCA -0.103; TCGA HNSC -0.091; TCGA KIRC -0.079; TCGA KIRP -0.211; TCGA LGG -0.082; TCGA PAAD -0.083; TCGA PRAD -0.16; TCGA SARC -0.194; TCGA THCA -0.086; TCGA STAD -0.191
hsa-miR-590-3p
CPEB3
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; SARC; STAD
miRanda
TCGA BLCA -0.231; TCGA BRCA -0.193; TCGA CESC -0.135; TCGA ESCA -0.154; TCGA KIRC -0.427; TCGA KIRP -0.223; TCGA LGG -0.28; TCGA LUAD -0.12; TCGA LUSC -0.226; TCGA SARC -0.161; TCGA STAD -0.206
hsa-miR-590-3p
CDH2
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.367; TCGA CESC -0.461; TCGA COAD -0.898; TCGA ESCA -0.437; TCGA HNSC -0.351; TCGA PRAD -0.288; TCGA THCA -0.759; TCGA STAD -0.397; TCGA UCEC -0.367
hsa-miR-590-3p
GNAO1
11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.672; TCGA COAD -0.892; TCGA ESCA -0.598; TCGA HNSC -0.172; TCGA KIRC -0.248; TCGA LGG -0.173; TCGA LUAD -0.28; TCGA PRAD -0.485; TCGA SARC -0.929; TCGA STAD -1.083; TCGA UCEC -0.419
hsa-miR-590-3p
STK33
11 cancers: BLCA; CESC; COAD; KIRC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.198; TCGA CESC -0.458; TCGA COAD -0.698; TCGA KIRC -0.89; TCGA LUAD -0.27; TCGA LUSC -0.307; TCGA PRAD -0.448; TCGA SARC -0.56; TCGA THCA -0.095; TCGA STAD -0.537; TCGA UCEC -0.212
hsa-miR-590-3p
TBCEL
13 cancers: BLCA; CESC; COAD; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.099; TCGA CESC -0.143; TCGA COAD -0.207; TCGA KIRC -0.214; TCGA KIRP -0.193; TCGA LGG -0.071; TCGA LUAD -0.071; TCGA LUSC -0.158; TCGA PAAD -0.197; TCGA PRAD -0.093; TCGA SARC -0.193; TCGA STAD -0.3; TCGA UCEC -0.15
hsa-miR-590-3p
DPYSL3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.65; TCGA BRCA -0.186; TCGA CESC -0.403; TCGA COAD -0.76; TCGA ESCA -0.47; TCGA HNSC -0.183; TCGA LGG -0.158; TCGA LUAD -0.152; TCGA LUSC -0.232; TCGA PAAD -0.401; TCGA PRAD -0.319; TCGA SARC -0.332; TCGA STAD -0.798; TCGA UCEC -0.457
hsa-miR-590-3p
PALLD
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.58; TCGA BRCA -0.17; TCGA CESC -0.199; TCGA COAD -0.443; TCGA ESCA -0.441; TCGA HNSC -0.204; TCGA KIRC -0.302; TCGA LIHC -0.17; TCGA LUSC -0.191; TCGA PAAD -0.352; TCGA PRAD -0.399; TCGA SARC -0.593; TCGA STAD -0.709; TCGA UCEC -0.355
hsa-miR-590-3p
RAB23
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.453; TCGA CESC -0.224; TCGA COAD -0.252; TCGA ESCA -0.253; TCGA HNSC -0.088; TCGA KIRP -0.106; TCGA PAAD -0.327; TCGA PRAD -0.222; TCGA SARC -0.318; TCGA STAD -0.616; TCGA UCEC -0.387
hsa-miR-590-3p
PKD2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.265; TCGA BRCA -0.271; TCGA CESC -0.285; TCGA COAD -0.407; TCGA ESCA -0.297; TCGA KIRC -0.158; TCGA KIRP -0.196; TCGA LUAD -0.149; TCGA LUSC -0.207; TCGA PAAD -0.338; TCGA PRAD -0.193; TCGA SARC -0.222; TCGA THCA -0.104; TCGA STAD -0.571; TCGA UCEC -0.317
hsa-miR-590-3p
B3GALT2
9 cancers: BLCA; BRCA; KIRC; LGG; LUAD; LUSC; PRAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.473; TCGA BRCA -0.156; TCGA KIRC -0.461; TCGA LGG -0.261; TCGA LUAD -0.453; TCGA LUSC -0.402; TCGA PRAD -0.569; TCGA SARC -0.529; TCGA STAD -0.209
hsa-miR-590-3p
VPS13D
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.115; TCGA BRCA -0.118; TCGA CESC -0.085; TCGA ESCA -0.172; TCGA HNSC -0.147; TCGA KIRC -0.375; TCGA KIRP -0.141; TCGA LGG -0.07; TCGA LUAD -0.162; TCGA LUSC -0.181; TCGA PRAD -0.152; TCGA SARC -0.069; TCGA STAD -0.196; TCGA UCEC -0.052
hsa-miR-590-3p
WDR44
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.102; TCGA BRCA -0.061; TCGA CESC -0.111; TCGA ESCA -0.14; TCGA HNSC -0.073; TCGA KIRP -0.117; TCGA LUAD -0.07; TCGA PAAD -0.103; TCGA PRAD -0.149; TCGA SARC -0.226; TCGA THCA -0.079; TCGA STAD -0.102; TCGA UCEC -0.147
hsa-miR-590-3p
KCNB1
11 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.935; TCGA BRCA -0.402; TCGA COAD -0.862; TCGA ESCA -1.106; TCGA KIRP -0.417; TCGA LGG -0.402; TCGA LUAD -0.465; TCGA PRAD -0.552; TCGA SARC -0.812; TCGA STAD -1.615; TCGA UCEC -0.85
hsa-miR-590-3p
ROBO1
9 cancers: BLCA; COAD; HNSC; KIRP; LGG; LUAD; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.154; TCGA COAD -0.43; TCGA HNSC -0.136; TCGA KIRP -0.343; TCGA LGG -0.331; TCGA LUAD -0.12; TCGA PAAD -0.301; TCGA PRAD -0.318; TCGA STAD -0.349
hsa-miR-590-3p
DYNC2H1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.357; TCGA BRCA -0.342; TCGA CESC -0.295; TCGA COAD -0.551; TCGA ESCA -0.21; TCGA HNSC -0.199; TCGA KIRC -0.26; TCGA KIRP -0.276; TCGA LUAD -0.329; TCGA LUSC -0.307; TCGA PAAD -0.345; TCGA PRAD -0.199; TCGA SARC -0.166; TCGA THCA -0.131; TCGA STAD -0.534; TCGA UCEC -0.328
hsa-miR-590-3p
SORBS1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -1.015; TCGA BRCA -0.533; TCGA CESC -0.605; TCGA COAD -0.546; TCGA ESCA -0.887; TCGA HNSC -0.405; TCGA KIRP -0.274; TCGA LUAD -0.4; TCGA LUSC -0.628; TCGA PAAD -0.286; TCGA PRAD -0.611; TCGA SARC -1.109; TCGA THCA -0.196; TCGA STAD -1.12; TCGA UCEC -0.645
hsa-miR-590-3p
DGKH
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LIHC; PAAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.126; TCGA CESC -0.256; TCGA COAD -0.098; TCGA ESCA -0.233; TCGA HNSC -0.13; TCGA KIRC -0.187; TCGA LGG -0.101; TCGA LIHC -0.185; TCGA PAAD -0.367; TCGA PRAD -0.246; TCGA SARC -0.198; TCGA STAD -0.276
hsa-miR-590-3p
DPP8
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.105; TCGA BRCA -0.122; TCGA CESC -0.171; TCGA COAD -0.075; TCGA HNSC -0.146; TCGA KIRC -0.249; TCGA KIRP -0.365; TCGA LGG -0.112; TCGA PAAD -0.213; TCGA PRAD -0.26; TCGA SARC -0.217; TCGA THCA -0.133; TCGA STAD -0.14
hsa-miR-590-3p
PBRM1
10 cancers: BLCA; CESC; HNSC; KIRC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.061; TCGA CESC -0.159; TCGA HNSC -0.075; TCGA KIRC -0.195; TCGA LUAD -0.109; TCGA PAAD -0.097; TCGA PRAD -0.113; TCGA SARC -0.172; TCGA STAD -0.146; TCGA UCEC -0.129
hsa-miR-590-3p
CDK14
11 cancers: BLCA; BRCA; CESC; COAD; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.18; TCGA BRCA -0.135; TCGA CESC -0.26; TCGA COAD -0.579; TCGA LGG -0.066; TCGA LUAD -0.164; TCGA LUSC -0.293; TCGA PAAD -0.288; TCGA PRAD -0.089; TCGA STAD -0.302; TCGA UCEC -0.201
hsa-miR-590-3p
UACA
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.112; TCGA BRCA -0.128; TCGA CESC -0.189; TCGA ESCA -0.145; TCGA HNSC -0.109; TCGA KIRP -0.117; TCGA LUAD -0.131; TCGA LUSC -0.264; TCGA PAAD -0.274; TCGA THCA -0.146; TCGA STAD -0.232
hsa-miR-590-3p
SVEP1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.462; TCGA BRCA -0.723; TCGA CESC -0.388; TCGA COAD -0.621; TCGA ESCA -0.443; TCGA HNSC -0.433; TCGA KIRC -0.608; TCGA LUAD -0.49; TCGA LUSC -0.66; TCGA PAAD -0.545; TCGA PRAD -0.222; TCGA STAD -0.605; TCGA UCEC -0.206
hsa-miR-590-3p
COL3A1
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.471; TCGA BRCA -0.2; TCGA CESC -0.494; TCGA COAD -0.644; TCGA HNSC -0.461; TCGA LUSC -0.36; TCGA PAAD -0.664; TCGA PRAD -0.13; TCGA STAD -0.17; TCGA UCEC -0.312
hsa-miR-590-3p
TNIK
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.24; TCGA BRCA -0.132; TCGA CESC -0.431; TCGA ESCA -0.394; TCGA HNSC -0.161; TCGA LGG -0.122; TCGA LUAD -0.326; TCGA LUSC -0.331; TCGA PAAD -0.246; TCGA PRAD -0.37; TCGA SARC -0.249; TCGA THCA -0.165; TCGA UCEC -0.324
hsa-miR-590-3p
VAMP2
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LGG; LUAD; LUSC; STAD; UCEC
miRanda
TCGA BLCA -0.126; TCGA BRCA -0.236; TCGA COAD -0.092; TCGA HNSC -0.062; TCGA KIRC -0.281; TCGA LGG -0.117; TCGA LUAD -0.169; TCGA LUSC -0.192; TCGA STAD -0.192; TCGA UCEC -0.182
hsa-miR-590-3p
PARK2
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.675; TCGA BRCA -0.375; TCGA CESC -0.463; TCGA COAD -0.248; TCGA ESCA -0.674; TCGA HNSC -0.354; TCGA KIRC -0.456; TCGA KIRP -0.238; TCGA LGG -0.171; TCGA LIHC -0.222; TCGA LUAD -0.195; TCGA LUSC -0.276; TCGA PRAD -0.126; TCGA SARC -0.337; TCGA THCA -0.113; TCGA STAD -0.696; TCGA UCEC -0.257
hsa-miR-590-3p
LRIG1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; LUAD; PAAD; SARC; STAD
miRanda
TCGA BLCA -0.396; TCGA BRCA -0.318; TCGA CESC -0.278; TCGA COAD -0.168; TCGA ESCA -0.285; TCGA KIRP -0.121; TCGA LGG -0.304; TCGA LUAD -0.248; TCGA PAAD -0.202; TCGA SARC -0.337; TCGA STAD -0.358
hsa-miR-590-3p
UBE2Q2
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.181; TCGA BRCA -0.055; TCGA CESC -0.089; TCGA COAD -0.117; TCGA HNSC -0.108; TCGA KIRC -0.074; TCGA KIRP -0.111; TCGA LGG -0.077; TCGA LUSC -0.082; TCGA PAAD -0.149; TCGA PRAD -0.075; TCGA SARC -0.066; TCGA STAD -0.281; TCGA UCEC -0.08
hsa-miR-590-3p
LGI2
11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.425; TCGA COAD -0.523; TCGA ESCA -0.683; TCGA HNSC -0.188; TCGA KIRC -0.846; TCGA KIRP -0.515; TCGA LIHC -0.326; TCGA PRAD -0.141; TCGA SARC -0.469; TCGA STAD -0.63; TCGA UCEC -0.694
hsa-miR-590-3p
PAM
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.292; TCGA BRCA -0.096; TCGA CESC -0.318; TCGA COAD -0.303; TCGA ESCA -0.355; TCGA HNSC -0.181; TCGA KIRP -0.16; TCGA LUAD -0.159; TCGA LUSC -0.299; TCGA PAAD -0.211; TCGA PRAD -0.221; TCGA THCA -0.12; TCGA STAD -0.364
hsa-miR-590-3p
TCP11L2
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.146; TCGA BRCA -0.257; TCGA CESC -0.33; TCGA ESCA -0.154; TCGA HNSC -0.211; TCGA KIRC -0.139; TCGA KIRP -0.316; TCGA LUAD -0.163; TCGA LUSC -0.22; TCGA PRAD -0.173; TCGA SARC -0.197; TCGA STAD -0.357
hsa-miR-590-3p
FAM172A
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.181; TCGA BRCA -0.198; TCGA CESC -0.204; TCGA COAD -0.14; TCGA ESCA -0.139; TCGA KIRC -0.074; TCGA KIRP -0.169; TCGA LIHC -0.094; TCGA LUAD -0.127; TCGA LUSC -0.067; TCGA PRAD -0.149; TCGA SARC -0.23; TCGA THCA -0.096; TCGA STAD -0.355; TCGA UCEC -0.218
hsa-miR-590-3p
FRMD6
10 cancers: BLCA; BRCA; COAD; HNSC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.238; TCGA BRCA -0.317; TCGA COAD -0.603; TCGA HNSC -0.199; TCGA KIRP -0.185; TCGA PAAD -0.527; TCGA PRAD -0.444; TCGA SARC -0.314; TCGA STAD -0.598; TCGA UCEC -0.553
hsa-miR-590-3p
MAP3K12
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.282; TCGA BRCA -0.314; TCGA CESC -0.225; TCGA COAD -0.431; TCGA ESCA -0.204; TCGA LGG -0.06; TCGA LUAD -0.107; TCGA LUSC -0.234; TCGA PRAD -0.121; TCGA SARC -0.198; TCGA STAD -0.111; TCGA UCEC -0.218
hsa-miR-590-3p
CAPN2
10 cancers: BLCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.144; TCGA KIRC -0.184; TCGA KIRP -0.217; TCGA LIHC -0.223; TCGA LUAD -0.099; TCGA LUSC -0.208; TCGA PAAD -0.153; TCGA PRAD -0.069; TCGA SARC -0.14; TCGA UCEC -0.114
hsa-miR-590-3p
SPATA18
11 cancers: BLCA; BRCA; CESC; ESCA; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.19; TCGA BRCA -0.479; TCGA CESC -0.218; TCGA ESCA -0.279; TCGA LUAD -0.53; TCGA LUSC -0.568; TCGA PAAD -0.207; TCGA PRAD -0.392; TCGA SARC -0.319; TCGA THCA -0.366; TCGA STAD -0.16
hsa-miR-590-3p
ZNF175
9 cancers: BLCA; BRCA; CESC; COAD; KIRP; LUAD; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.135; TCGA BRCA -0.222; TCGA CESC -0.201; TCGA COAD -0.206; TCGA KIRP -0.127; TCGA LUAD -0.138; TCGA PAAD -0.152; TCGA STAD -0.193; TCGA UCEC -0.193
hsa-miR-590-3p
MEIS1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; PAAD; PRAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.385; TCGA BRCA -0.217; TCGA CESC -0.309; TCGA COAD -0.688; TCGA ESCA -0.228; TCGA LUAD -0.207; TCGA PAAD -0.323; TCGA PRAD -0.381; TCGA SARC -0.598; TCGA STAD -0.72
hsa-miR-590-3p
OMD
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -1.066; TCGA BRCA -0.651; TCGA CESC -0.519; TCGA COAD -1.191; TCGA ESCA -0.962; TCGA HNSC -0.747; TCGA KIRC -0.607; TCGA LUAD -0.344; TCGA LUSC -1.012; TCGA PAAD -0.901; TCGA PRAD -0.28; TCGA STAD -0.981; TCGA UCEC -0.743
hsa-miR-590-3p
PDZRN3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.793; TCGA BRCA -0.306; TCGA CESC -0.546; TCGA COAD -0.463; TCGA ESCA -0.506; TCGA HNSC -0.361; TCGA KIRC -0.659; TCGA LUAD -0.284; TCGA LUSC -0.619; TCGA PAAD -0.174; TCGA PRAD -0.084; TCGA SARC -0.742; TCGA STAD -0.871; TCGA UCEC -0.427
hsa-miR-590-3p
ITPR1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.363; TCGA BRCA -0.441; TCGA CESC -0.273; TCGA COAD -0.473; TCGA ESCA -0.558; TCGA KIRC -0.279; TCGA KIRP -0.531; TCGA LUAD -0.17; TCGA LUSC -0.415; TCGA PRAD -0.577; TCGA SARC -0.714; TCGA STAD -0.49; TCGA UCEC -0.476
hsa-miR-590-3p
ANKRD6
14 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.113; TCGA BRCA -0.121; TCGA CESC -0.212; TCGA COAD -0.462; TCGA KIRC -0.085; TCGA KIRP -0.106; TCGA LGG -0.139; TCGA LUAD -0.086; TCGA PAAD -0.207; TCGA PRAD -0.23; TCGA SARC -0.325; TCGA THCA -0.163; TCGA STAD -0.37; TCGA UCEC -0.105
hsa-miR-590-3p
ITPRIPL2
11 cancers: BLCA; BRCA; CESC; ESCA; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.096; TCGA BRCA -0.121; TCGA CESC -0.166; TCGA ESCA -0.143; TCGA LUAD -0.066; TCGA LUSC -0.191; TCGA PAAD -0.237; TCGA PRAD -0.08; TCGA THCA -0.099; TCGA STAD -0.183; TCGA UCEC -0.086
hsa-miR-590-3p
ABI2
14 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.106; TCGA CESC -0.139; TCGA COAD -0.088; TCGA ESCA -0.132; TCGA KIRC -0.201; TCGA KIRP -0.26; TCGA LGG -0.12; TCGA LUAD -0.06; TCGA LUSC -0.071; TCGA PRAD -0.107; TCGA SARC -0.177; TCGA THCA -0.125; TCGA STAD -0.244; TCGA UCEC -0.161
hsa-miR-590-3p
SLC45A1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUSC; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.389; TCGA BRCA -0.276; TCGA CESC -0.282; TCGA COAD -0.472; TCGA ESCA -0.318; TCGA KIRC -0.237; TCGA KIRP -0.329; TCGA LIHC -0.194; TCGA LUSC -0.265; TCGA PRAD -0.174; TCGA THCA -0.168; TCGA STAD -0.456; TCGA UCEC -0.38
hsa-miR-590-3p
OSBPL6
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; STAD
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.201; TCGA BRCA -0.153; TCGA COAD -0.403; TCGA HNSC -0.122; TCGA KIRC -0.343; TCGA KIRP -0.545; TCGA LGG -0.074; TCGA LUAD -0.25; TCGA LUSC -0.203; TCGA STAD -0.548
hsa-miR-590-3p
TRIM68
10 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LUAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.071; TCGA BRCA -0.21; TCGA ESCA -0.129; TCGA KIRC -0.24; TCGA KIRP -0.169; TCGA LGG -0.079; TCGA LUAD -0.175; TCGA SARC -0.079; TCGA THCA -0.081; TCGA STAD -0.09
hsa-miR-590-3p
FBXL22
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.721; TCGA BRCA -0.183; TCGA CESC -0.362; TCGA COAD -0.34; TCGA ESCA -0.347; TCGA HNSC -0.136; TCGA KIRC -0.295; TCGA KIRP -0.145; TCGA LGG -0.126; TCGA PAAD -0.273; TCGA PRAD -0.328; TCGA SARC -1.072; TCGA THCA -0.144; TCGA STAD -0.869; TCGA UCEC -0.577
hsa-miR-590-3p
PPFIBP1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.154; TCGA BRCA -0.162; TCGA CESC -0.195; TCGA COAD -0.129; TCGA ESCA -0.149; TCGA HNSC -0.119; TCGA LUAD -0.092; TCGA LUSC -0.245; TCGA PAAD -0.231; TCGA PRAD -0.087; TCGA THCA -0.179; TCGA STAD -0.243; TCGA UCEC -0.147
hsa-miR-590-3p
TNFAIP8L3
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.505; TCGA BRCA -0.107; TCGA COAD -0.432; TCGA ESCA -0.378; TCGA HNSC -0.186; TCGA LUAD -0.157; TCGA LUSC -0.35; TCGA PRAD -0.277; TCGA SARC -0.549; TCGA STAD -0.652; TCGA UCEC -0.958
hsa-miR-590-3p
FAM131B
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.311; TCGA BRCA -0.292; TCGA CESC -0.203; TCGA ESCA -0.341; TCGA HNSC -0.206; TCGA KIRC -0.148; TCGA KIRP -0.266; TCGA LUAD -0.146; TCGA LUSC -0.253; TCGA PAAD -0.265; TCGA PRAD -0.261; TCGA STAD -0.33; TCGA UCEC -0.439
hsa-miR-590-3p
PEG3
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.838; TCGA BRCA -0.207; TCGA CESC -0.589; TCGA COAD -0.809; TCGA ESCA -0.638; TCGA HNSC -0.514; TCGA KIRC -0.914; TCGA KIRP -0.536; TCGA LUAD -0.287; TCGA LUSC -0.676; TCGA PAAD -0.236; TCGA PRAD -0.293; TCGA SARC -0.706; TCGA THCA -0.156; TCGA STAD -1.047; TCGA UCEC -0.817
hsa-miR-590-3p
AKTIP
12 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.093; TCGA CESC -0.093; TCGA ESCA -0.114; TCGA KIRC -0.138; TCGA KIRP -0.1; TCGA LUAD -0.06; TCGA LUSC -0.089; TCGA PAAD -0.066; TCGA PRAD -0.062; TCGA SARC -0.09; TCGA STAD -0.213; TCGA UCEC -0.144
hsa-miR-590-3p
HERC2
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.05; TCGA BRCA -0.117; TCGA CESC -0.079; TCGA HNSC -0.122; TCGA KIRC -0.188; TCGA KIRP -0.162; TCGA LGG -0.071; TCGA LUAD -0.108; TCGA PRAD -0.14; TCGA SARC -0.213; TCGA THCA -0.08; TCGA STAD -0.145
hsa-miR-590-3p
PLCL1
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.404; TCGA BRCA -0.282; TCGA COAD -0.446; TCGA ESCA -0.397; TCGA HNSC -0.186; TCGA KIRC -0.89; TCGA KIRP -0.289; TCGA LGG -0.088; TCGA LUAD -0.156; TCGA LUSC -0.419; TCGA PRAD -0.365; TCGA SARC -0.457; TCGA STAD -0.598; TCGA UCEC -0.479
hsa-miR-590-3p
KLC1
10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; STAD; UCEC
miRanda
TCGA BLCA -0.107; TCGA COAD -0.095; TCGA ESCA -0.11; TCGA HNSC -0.07; TCGA KIRC -0.051; TCGA KIRP -0.117; TCGA LGG -0.067; TCGA LUSC -0.061; TCGA STAD -0.145; TCGA UCEC -0.062
hsa-miR-590-3p
CCDC149
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.175; TCGA BRCA -0.08; TCGA ESCA -0.23; TCGA HNSC -0.218; TCGA KIRC -0.185; TCGA KIRP -0.147; TCGA LUAD -0.066; TCGA LUSC -0.12; TCGA SARC -0.128; TCGA STAD -0.243; TCGA UCEC -0.102
hsa-miR-590-3p
NOV
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUSC; PAAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.247; TCGA BRCA -0.363; TCGA CESC -0.533; TCGA COAD -0.341; TCGA ESCA -0.311; TCGA KIRC -0.263; TCGA KIRP -0.253; TCGA LIHC -0.334; TCGA LUSC -0.17; TCGA PAAD -0.193; TCGA STAD -0.522; TCGA UCEC -0.29
hsa-miR-590-3p
SNX25
10 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; LUSC; SARC; THCA; STAD
miRanda
TCGA BLCA -0.079; TCGA BRCA -0.051; TCGA CESC -0.104; TCGA KIRC -0.151; TCGA KIRP -0.337; TCGA LUAD -0.287; TCGA LUSC -0.276; TCGA SARC -0.143; TCGA THCA -0.209; TCGA STAD -0.102
hsa-miR-590-3p
LAMA4
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.424; TCGA BRCA -0.245; TCGA CESC -0.296; TCGA COAD -0.452; TCGA ESCA -0.291; TCGA HNSC -0.27; TCGA LIHC -0.143; TCGA LUAD -0.177; TCGA LUSC -0.579; TCGA PAAD -0.388; TCGA PRAD -0.251; TCGA SARC -0.266; TCGA THCA -0.175; TCGA STAD -0.466; TCGA UCEC -0.419
hsa-miR-590-3p
PDE4C
10 cancers: BLCA; CESC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.179; TCGA CESC -0.445; TCGA KIRC -0.262; TCGA KIRP -0.21; TCGA LIHC -0.239; TCGA LUAD -0.293; TCGA LUSC -0.339; TCGA PAAD -0.314; TCGA STAD -0.28; TCGA UCEC -0.174
hsa-miR-590-3p
LMO3
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.857; TCGA BRCA -0.208; TCGA CESC -0.685; TCGA COAD -1.329; TCGA ESCA -0.879; TCGA HNSC -0.412; TCGA KIRC -1.303; TCGA KIRP -0.668; TCGA LGG -0.339; TCGA LUAD -0.478; TCGA LUSC -0.524; TCGA PAAD -0.347; TCGA PRAD -0.382; TCGA SARC -0.866; TCGA THCA -0.133; TCGA STAD -1.201; TCGA UCEC -0.79
hsa-miR-590-3p
CD34
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.372; TCGA BRCA -0.346; TCGA CESC -0.23; TCGA COAD -0.316; TCGA ESCA -0.221; TCGA HNSC -0.179; TCGA KIRP -0.203; TCGA LIHC -0.415; TCGA LUAD -0.243; TCGA LUSC -0.481; TCGA PRAD -0.081; TCGA THCA -0.142; TCGA STAD -0.273; TCGA UCEC -0.303
hsa-miR-590-3p
IDS
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.153; TCGA BRCA -0.078; TCGA CESC -0.225; TCGA COAD -0.172; TCGA ESCA -0.196; TCGA HNSC -0.084; TCGA KIRP -0.24; TCGA LUSC -0.156; TCGA PRAD -0.117; TCGA STAD -0.255; TCGA UCEC -0.164
hsa-miR-590-3p
TLE4
9 cancers: BLCA; CESC; COAD; KIRC; LUAD; LUSC; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.224; TCGA CESC -0.187; TCGA COAD -0.275; TCGA KIRC -0.299; TCGA LUAD -0.244; TCGA LUSC -0.126; TCGA SARC -0.137; TCGA STAD -0.309; TCGA UCEC -0.233
hsa-miR-590-3p
SNX9
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUSC; PAAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.167; TCGA BRCA -0.091; TCGA CESC -0.117; TCGA HNSC -0.122; TCGA KIRC -0.076; TCGA KIRP -0.088; TCGA LUSC -0.063; TCGA PAAD -0.128; TCGA SARC -0.09; TCGA THCA -0.062; TCGA STAD -0.124; TCGA UCEC -0.08
hsa-miR-590-3p
NBR1
16 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.084; TCGA BRCA -0.135; TCGA CESC -0.096; TCGA ESCA -0.102; TCGA HNSC -0.092; TCGA KIRC -0.16; TCGA KIRP -0.06; TCGA LGG -0.077; TCGA LUAD -0.094; TCGA LUSC -0.053; TCGA PAAD -0.06; TCGA PRAD -0.094; TCGA SARC -0.105; TCGA THCA -0.088; TCGA STAD -0.088; TCGA UCEC -0.149
hsa-miR-590-3p
TBC1D5
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.075; TCGA BRCA -0.062; TCGA CESC -0.108; TCGA ESCA -0.086; TCGA KIRC -0.242; TCGA KIRP -0.078; TCGA LGG -0.118; TCGA LUAD -0.103; TCGA LUSC -0.1; TCGA PRAD -0.1; TCGA STAD -0.061; TCGA UCEC -0.099
hsa-miR-590-3p
ABCA8
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.887; TCGA BRCA -1.073; TCGA CESC -0.636; TCGA COAD -1.125; TCGA ESCA -0.94; TCGA HNSC -0.294; TCGA KIRC -0.88; TCGA LUAD -0.639; TCGA LUSC -1.183; TCGA PRAD -0.307; TCGA THCA -0.238; TCGA STAD -0.956; TCGA UCEC -0.635
hsa-miR-590-3p
MFAP5
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.975; TCGA BRCA -0.287; TCGA CESC -0.537; TCGA COAD -0.926; TCGA ESCA -0.962; TCGA HNSC -0.655; TCGA LUSC -0.666; TCGA PAAD -0.95; TCGA PRAD -0.43; TCGA STAD -0.699; TCGA UCEC -0.587
hsa-miR-590-3p
GPR135
9 cancers: BLCA; BRCA; CESC; ESCA; KIRP; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.307; TCGA BRCA -0.26; TCGA CESC -0.146; TCGA ESCA -0.35; TCGA KIRP -0.121; TCGA PRAD -0.249; TCGA SARC -0.365; TCGA STAD -0.569; TCGA UCEC -0.125
hsa-miR-590-3p
LPL
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LGG; LUAD; LUSC; THCA; STAD
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.385; TCGA BRCA -0.501; TCGA COAD -0.388; TCGA HNSC -0.365; TCGA KIRC -0.374; TCGA LGG -0.224; TCGA LUAD -0.521; TCGA LUSC -0.901; TCGA THCA -0.248; TCGA STAD -0.361
hsa-miR-590-3p
GEM
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.723; TCGA BRCA -0.347; TCGA CESC -0.304; TCGA COAD -0.397; TCGA ESCA -0.342; TCGA LUSC -0.362; TCGA PAAD -0.429; TCGA PRAD -0.28; TCGA SARC -0.325; TCGA STAD -0.632; TCGA UCEC -0.373
hsa-miR-590-3p
ZNF462
13 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.17; TCGA COAD -0.085; TCGA ESCA -0.177; TCGA HNSC -0.21; TCGA KIRP -0.207; TCGA LGG -0.166; TCGA LUAD -0.24; TCGA PAAD -0.187; TCGA PRAD -0.089; TCGA SARC -0.31; TCGA THCA -0.195; TCGA STAD -0.379; TCGA UCEC -0.167
hsa-miR-590-3p
HEY2
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.275; TCGA BRCA -0.172; TCGA CESC -0.328; TCGA COAD -0.362; TCGA HNSC -0.137; TCGA LUAD -0.186; TCGA LUSC -0.295; TCGA PAAD -0.214; TCGA SARC -0.528; TCGA THCA -0.244; TCGA STAD -0.225
hsa-miR-590-3p
DENND4A
9 cancers: BLCA; BRCA; KIRC; KIRP; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.103; TCGA BRCA -0.067; TCGA KIRC -0.108; TCGA KIRP -0.281; TCGA LUAD -0.113; TCGA PRAD -0.1; TCGA SARC -0.122; TCGA STAD -0.15; TCGA UCEC -0.122
hsa-miR-590-3p
PRSS35
13 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.684; TCGA BRCA -0.42; TCGA CESC -0.361; TCGA COAD -0.38; TCGA KIRC -0.794; TCGA KIRP -0.533; TCGA LGG -0.363; TCGA LUAD -0.408; TCGA LUSC -0.376; TCGA PAAD -0.241; TCGA THCA -0.249; TCGA STAD -0.341; TCGA UCEC -0.751
hsa-miR-590-3p
NAALAD2
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUAD; LUSC; SARC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.198; TCGA BRCA -0.432; TCGA CESC -0.193; TCGA HNSC -0.168; TCGA KIRC -0.556; TCGA LUAD -0.171; TCGA LUSC -0.286; TCGA SARC -0.342; TCGA STAD -0.46; TCGA UCEC -0.593
hsa-miR-590-3p
ZBTB38
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.195; TCGA BRCA -0.114; TCGA CESC -0.169; TCGA COAD -0.095; TCGA ESCA -0.108; TCGA HNSC -0.115; TCGA KIRP -0.301; TCGA PAAD -0.155; TCGA PRAD -0.246; TCGA SARC -0.16; TCGA STAD -0.156; TCGA UCEC -0.237
hsa-miR-590-3p
FGF13
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.501; TCGA BRCA -0.14; TCGA COAD -0.46; TCGA ESCA -0.497; TCGA HNSC -0.284; TCGA KIRC -0.127; TCGA LGG -0.476; TCGA SARC -0.639; TCGA STAD -0.568; TCGA UCEC -0.447
hsa-miR-590-3p
EFEMP1
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.528; TCGA BRCA -0.421; TCGA COAD -0.808; TCGA ESCA -0.25; TCGA HNSC -0.209; TCGA KIRC -0.324; TCGA KIRP -0.485; TCGA LUAD -0.334; TCGA LUSC -0.424; TCGA PAAD -0.484; TCGA PRAD -0.295; TCGA STAD -0.489; TCGA UCEC -0.754
hsa-miR-590-3p
KIAA1462
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.449; TCGA BRCA -0.257; TCGA CESC -0.384; TCGA COAD -0.527; TCGA ESCA -0.318; TCGA HNSC -0.321; TCGA KIRP -0.256; TCGA LGG -0.081; TCGA LIHC -0.294; TCGA LUAD -0.209; TCGA LUSC -0.65; TCGA PAAD -0.339; TCGA PRAD -0.156; TCGA SARC -0.208; TCGA THCA -0.263; TCGA STAD -0.276; TCGA UCEC -0.529
hsa-miR-590-3p
AGTR1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; THCA; STAD; UCEC
miRanda
TCGA BLCA -1.087; TCGA BRCA -0.776; TCGA CESC -0.519; TCGA COAD -1.236; TCGA ESCA -0.723; TCGA HNSC -0.735; TCGA KIRC -0.443; TCGA LUAD -0.372; TCGA LUSC -0.971; TCGA THCA -0.283; TCGA STAD -1.339; TCGA UCEC -0.695
hsa-miR-590-3p
MICAL2
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; STAD
miRanda
TCGA BLCA -0.152; TCGA CESC -0.286; TCGA COAD -0.091; TCGA ESCA -0.23; TCGA HNSC -0.131; TCGA LIHC -0.127; TCGA LUAD -0.212; TCGA LUSC -0.48; TCGA PAAD -0.392; TCGA STAD -0.32
hsa-miR-590-3p
ZNF561
11 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LIHC; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.086; TCGA BRCA -0.084; TCGA CESC -0.116; TCGA KIRC -0.08; TCGA KIRP -0.12; TCGA LIHC -0.09; TCGA LUAD -0.089; TCGA PRAD -0.101; TCGA SARC -0.231; TCGA STAD -0.092; TCGA UCEC -0.109
hsa-miR-590-3p
TMTC2
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.161; TCGA BRCA -0.16; TCGA CESC -0.276; TCGA ESCA -0.237; TCGA KIRC -0.257; TCGA KIRP -0.431; TCGA LUAD -0.186; TCGA LUSC -0.123; TCGA PAAD -0.271; TCGA PRAD -0.141; TCGA SARC -0.256; TCGA STAD -0.247
hsa-miR-590-3p
PIK3R1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.251; TCGA BRCA -0.24; TCGA CESC -0.189; TCGA COAD -0.146; TCGA ESCA -0.266; TCGA HNSC -0.158; TCGA KIRC -0.107; TCGA KIRP -0.129; TCGA LGG -0.282; TCGA LUAD -0.214; TCGA LUSC -0.217; TCGA PAAD -0.166; TCGA PRAD -0.228; TCGA SARC -0.338; TCGA STAD -0.307
hsa-miR-590-3p
BBX
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.112; TCGA BRCA -0.06; TCGA CESC -0.105; TCGA COAD -0.093; TCGA ESCA -0.137; TCGA KIRC -0.245; TCGA KIRP -0.253; TCGA PAAD -0.146; TCGA PRAD -0.187; TCGA SARC -0.205; TCGA THCA -0.108; TCGA STAD -0.223; TCGA UCEC -0.091
hsa-miR-590-3p
XPC
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; LUSC; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.064; TCGA BRCA -0.155; TCGA CESC -0.08; TCGA ESCA -0.106; TCGA KIRC -0.145; TCGA LUAD -0.142; TCGA LUSC -0.111; TCGA SARC -0.134; TCGA THCA -0.072; TCGA UCEC -0.132
hsa-miR-590-3p
CNN3
12 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.146; TCGA CESC -0.187; TCGA COAD -0.177; TCGA HNSC -0.114; TCGA KIRC -0.099; TCGA KIRP -0.111; TCGA LUAD -0.098; TCGA LUSC -0.162; TCGA PAAD -0.26; TCGA PRAD -0.207; TCGA STAD -0.263; TCGA UCEC -0.201
hsa-miR-590-3p
LEPR
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.398; TCGA BRCA -0.515; TCGA CESC -0.28; TCGA COAD -0.305; TCGA ESCA -0.394; TCGA HNSC -0.238; TCGA KIRC -0.255; TCGA KIRP -0.215; TCGA LUAD -0.299; TCGA LUSC -0.544; TCGA PAAD -0.263; TCGA PRAD -0.314; TCGA STAD -0.528; TCGA UCEC -0.549
hsa-miR-590-3p
GADD45B
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC
miRanda
TCGA BLCA -0.442; TCGA BRCA -0.144; TCGA COAD -0.228; TCGA ESCA -0.368; TCGA HNSC -0.163; TCGA LUAD -0.128; TCGA LUSC -0.427; TCGA STAD -0.406; TCGA UCEC -0.155
hsa-miR-590-3p
KIAA1328
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.139; TCGA BRCA -0.183; TCGA CESC -0.121; TCGA ESCA -0.191; TCGA KIRC -0.194; TCGA KIRP -0.193; TCGA LUAD -0.115; TCGA LUSC -0.147; TCGA PRAD -0.07; TCGA SARC -0.21; TCGA STAD -0.169; TCGA UCEC -0.2
hsa-miR-590-3p
MS4A2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.694; TCGA BRCA -0.711; TCGA CESC -0.267; TCGA COAD -0.562; TCGA ESCA -0.512; TCGA LUAD -0.639; TCGA LUSC -0.934; TCGA PAAD -0.546; TCGA SARC -0.759; TCGA STAD -0.534; TCGA UCEC -0.635
hsa-miR-590-3p
NLGN4X
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.346; TCGA BRCA -0.35; TCGA CESC -0.532; TCGA COAD -0.587; TCGA HNSC -0.326; TCGA KIRP -0.71; TCGA LGG -0.16; TCGA PRAD -0.268; TCGA STAD -0.506; TCGA UCEC -0.27
hsa-miR-590-3p
CDC42BPA
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.329; TCGA BRCA -0.07; TCGA CESC -0.227; TCGA COAD -0.124; TCGA ESCA -0.215; TCGA HNSC -0.176; TCGA KIRC -0.232; TCGA KIRP -0.217; TCGA LUAD -0.249; TCGA LUSC -0.138; TCGA PAAD -0.182; TCGA PRAD -0.142; TCGA SARC -0.28; TCGA THCA -0.179; TCGA STAD -0.241; TCGA UCEC -0.181
hsa-miR-590-3p
CRBN
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUSC; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.072; TCGA BRCA -0.092; TCGA CESC -0.173; TCGA ESCA -0.143; TCGA KIRC -0.161; TCGA KIRP -0.108; TCGA LGG -0.074; TCGA LUSC -0.128; TCGA SARC -0.141; TCGA STAD -0.179; TCGA UCEC -0.207
hsa-miR-590-3p
CCDC50
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUSC; PAAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.142; TCGA BRCA -0.117; TCGA CESC -0.124; TCGA COAD -0.136; TCGA ESCA -0.104; TCGA LGG -0.053; TCGA LUSC -0.163; TCGA PAAD -0.092; TCGA SARC -0.099; TCGA STAD -0.307; TCGA UCEC -0.204
hsa-miR-590-3p
SMARCA1
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.252; TCGA BRCA -0.204; TCGA CESC -0.328; TCGA COAD -0.546; TCGA HNSC -0.257; TCGA KIRC -0.271; TCGA PAAD -0.189; TCGA PRAD -0.098; TCGA SARC -0.178; TCGA THCA -0.141; TCGA STAD -0.399; TCGA UCEC -0.282
hsa-miR-590-3p
IPP
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; PRAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.082; TCGA CESC -0.119; TCGA ESCA -0.108; TCGA HNSC -0.086; TCGA KIRC -0.194; TCGA KIRP -0.283; TCGA PRAD -0.145; TCGA SARC -0.199; TCGA THCA -0.141; TCGA STAD -0.158
hsa-miR-590-3p
PTGFR
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.683; TCGA BRCA -0.279; TCGA CESC -0.308; TCGA COAD -0.69; TCGA ESCA -0.435; TCGA KIRC -0.68; TCGA KIRP -1.155; TCGA LGG -0.605; TCGA LUAD -0.378; TCGA LUSC -0.7; TCGA PAAD -0.338; TCGA STAD -0.671; TCGA UCEC -1.07
hsa-miR-590-3p
CRYAB
11 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.795; TCGA BRCA -0.162; TCGA COAD -0.729; TCGA HNSC -0.482; TCGA LIHC -0.517; TCGA LUAD -0.249; TCGA LUSC -0.272; TCGA PRAD -0.279; TCGA SARC -0.492; TCGA STAD -0.967; TCGA UCEC -0.278
hsa-miR-590-3p
LHFP
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.459; TCGA BRCA -0.441; TCGA CESC -0.3; TCGA COAD -0.491; TCGA ESCA -0.276; TCGA HNSC -0.144; TCGA LIHC -0.235; TCGA LUAD -0.228; TCGA LUSC -0.508; TCGA PAAD -0.283; TCGA PRAD -0.075; TCGA SARC -0.144; TCGA STAD -0.451; TCGA UCEC -0.398
hsa-miR-590-3p
KCNIP4
9 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LUAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.175; TCGA BRCA -0.173; TCGA CESC -0.124; TCGA ESCA -0.154; TCGA KIRP -0.219; TCGA LUAD -0.109; TCGA PRAD -0.063; TCGA STAD -0.456; TCGA UCEC -0.489
hsa-miR-590-3p
ADAMTSL3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.924; TCGA BRCA -0.229; TCGA CESC -0.415; TCGA COAD -1.035; TCGA ESCA -0.586; TCGA KIRC -0.331; TCGA KIRP -0.634; TCGA LUAD -0.419; TCGA LUSC -0.558; TCGA PAAD -0.341; TCGA PRAD -0.503; TCGA SARC -0.355; TCGA STAD -0.811; TCGA UCEC -0.571
hsa-miR-590-3p
LIFR
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.274; TCGA BRCA -0.437; TCGA CESC -0.304; TCGA COAD -0.65; TCGA ESCA -0.331; TCGA KIRC -0.39; TCGA KIRP -0.322; TCGA LGG -0.107; TCGA LUAD -0.187; TCGA LUSC -0.348; TCGA STAD -0.436; TCGA UCEC -0.644
hsa-miR-590-3p
COL4A5
11 cancers: BLCA; BRCA; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.336; TCGA BRCA -0.387; TCGA KIRC -0.832; TCGA KIRP -0.592; TCGA LUAD -0.279; TCGA PAAD -0.394; TCGA PRAD -0.134; TCGA SARC -1.194; TCGA THCA -0.273; TCGA STAD -0.767; TCGA UCEC -0.387
hsa-miR-590-3p
SPG11
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.083; TCGA BRCA -0.129; TCGA CESC -0.081; TCGA HNSC -0.083; TCGA KIRC -0.088; TCGA KIRP -0.085; TCGA LUAD -0.1; TCGA PRAD -0.085; TCGA SARC -0.132; TCGA STAD -0.061
hsa-miR-590-3p
SEL1L
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.107; TCGA BRCA -0.12; TCGA CESC -0.092; TCGA COAD -0.074; TCGA ESCA -0.132; TCGA HNSC -0.072; TCGA KIRC -0.095; TCGA KIRP -0.245; TCGA LUSC -0.146; TCGA PAAD -0.148; TCGA UCEC -0.112
hsa-miR-590-3p
FOS
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; UCEC
miRanda
TCGA BLCA -0.528; TCGA BRCA -0.566; TCGA CESC -0.234; TCGA ESCA -0.231; TCGA KIRC -0.282; TCGA LUAD -0.302; TCGA LUSC -0.413; TCGA PAAD -0.204; TCGA PRAD -0.433; TCGA UCEC -0.322
hsa-miR-590-3p
COL8A1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.468; TCGA BRCA -0.219; TCGA CESC -0.429; TCGA COAD -0.969; TCGA ESCA -0.624; TCGA HNSC -0.519; TCGA KIRP -0.343; TCGA LUAD -0.335; TCGA LUSC -0.676; TCGA PAAD -1.019; TCGA PRAD -0.229; TCGA SARC -0.507; TCGA THCA -0.21; TCGA STAD -0.555
hsa-miR-590-3p
GIGYF2
14 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.106; TCGA BRCA -0.083; TCGA CESC -0.091; TCGA HNSC -0.116; TCGA KIRC -0.129; TCGA KIRP -0.136; TCGA LGG -0.079; TCGA LUAD -0.079; TCGA PAAD -0.071; TCGA PRAD -0.075; TCGA SARC -0.146; TCGA THCA -0.076; TCGA STAD -0.065; TCGA UCEC -0.084
hsa-miR-590-3p
GPR85
9 cancers: BLCA; COAD; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; UCEC
miRanda
TCGA BLCA -0.183; TCGA COAD -0.425; TCGA HNSC -0.157; TCGA LGG -0.229; TCGA LUAD -0.291; TCGA LUSC -0.228; TCGA PAAD -0.167; TCGA PRAD -0.151; TCGA UCEC -0.17
hsa-miR-590-3p
EPDR1
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.481; TCGA BRCA -0.241; TCGA CESC -0.444; TCGA COAD -0.25; TCGA HNSC -0.425; TCGA LUAD -0.252; TCGA LUSC -0.291; TCGA PAAD -0.371; TCGA PRAD -0.129; TCGA THCA -0.138; TCGA STAD -0.278; TCGA UCEC -0.304
hsa-miR-590-3p
GCC2
12 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
miRanda; miRNATAP
TCGA BLCA -0.068; TCGA BRCA -0.095; TCGA CESC -0.125; TCGA KIRC -0.162; TCGA KIRP -0.26; TCGA LUAD -0.109; TCGA LUSC -0.098; TCGA PAAD -0.101; TCGA PRAD -0.143; TCGA SARC -0.091; TCGA THCA -0.068; TCGA UCEC -0.075
hsa-miR-590-3p
FAM13C
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.408; TCGA BRCA -0.436; TCGA CESC -0.585; TCGA COAD -0.676; TCGA ESCA -0.368; TCGA HNSC -0.452; TCGA KIRP -0.273; TCGA LGG -0.207; TCGA LUAD -0.362; TCGA LUSC -0.702; TCGA PAAD -0.268; TCGA SARC -0.578; TCGA STAD -0.634; TCGA UCEC -0.3
hsa-miR-590-3p
ACVR1
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.204; TCGA BRCA -0.108; TCGA CESC -0.214; TCGA COAD -0.133; TCGA HNSC -0.172; TCGA KIRP -0.138; TCGA LUAD -0.076; TCGA LUSC -0.139; TCGA PAAD -0.246; TCGA PRAD -0.158; TCGA SARC -0.155; TCGA THCA -0.136; TCGA STAD -0.11; TCGA UCEC -0.103
hsa-miR-590-3p
ROBO2
9 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUAD; LUSC; PRAD; STAD
miRanda; mirMAP
TCGA BLCA -0.194; TCGA BRCA -0.489; TCGA COAD -0.665; TCGA HNSC -0.497; TCGA KIRC -0.534; TCGA LUAD -0.655; TCGA LUSC -0.525; TCGA PRAD -0.208; TCGA STAD -0.293
hsa-miR-590-3p
ADAMTSL1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.491; TCGA BRCA -0.261; TCGA CESC -0.385; TCGA COAD -0.624; TCGA ESCA -0.736; TCGA HNSC -0.316; TCGA KIRC -0.57; TCGA LIHC -0.353; TCGA LUAD -0.225; TCGA LUSC -0.339; TCGA PAAD -0.393; TCGA STAD -0.48; TCGA UCEC -0.443
hsa-miR-590-3p
ZNF366
15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.326; TCGA BRCA -0.385; TCGA CESC -0.262; TCGA COAD -0.514; TCGA HNSC -0.189; TCGA KIRC -0.317; TCGA KIRP -0.51; TCGA LUAD -0.353; TCGA LUSC -0.611; TCGA PAAD -0.24; TCGA PRAD -0.258; TCGA SARC -0.358; TCGA THCA -0.183; TCGA STAD -0.161; TCGA UCEC -0.297
hsa-miR-590-3p
NEK1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.202; TCGA BRCA -0.116; TCGA CESC -0.118; TCGA COAD -0.159; TCGA ESCA -0.131; TCGA KIRC -0.153; TCGA KIRP -0.17; TCGA LUAD -0.102; TCGA LUSC -0.102; TCGA PAAD -0.146; TCGA SARC -0.226; TCGA STAD -0.222; TCGA UCEC -0.209
hsa-miR-590-3p
MAGEE1
12 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.127; TCGA BRCA -0.124; TCGA COAD -0.533; TCGA KIRC -0.288; TCGA KIRP -0.31; TCGA LGG -0.238; TCGA LUAD -0.277; TCGA PRAD -0.168; TCGA SARC -0.263; TCGA THCA -0.079; TCGA STAD -0.584; TCGA UCEC -0.398
hsa-miR-590-3p
TCF12
14 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.12; TCGA BRCA -0.07; TCGA CESC -0.226; TCGA HNSC -0.11; TCGA KIRP -0.184; TCGA LGG -0.304; TCGA LUAD -0.077; TCGA LUSC -0.084; TCGA PAAD -0.197; TCGA PRAD -0.134; TCGA SARC -0.103; TCGA THCA -0.087; TCGA STAD -0.099; TCGA UCEC -0.083
hsa-miR-590-3p
STON1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.61; TCGA BRCA -0.16; TCGA CESC -0.368; TCGA COAD -0.746; TCGA ESCA -0.591; TCGA HNSC -0.244; TCGA KIRC -0.328; TCGA LIHC -0.186; TCGA LUAD -0.218; TCGA LUSC -0.375; TCGA PAAD -0.448; TCGA PRAD -0.238; TCGA SARC -0.598; TCGA THCA -0.179; TCGA UCEC -0.762
hsa-miR-590-3p
OGN
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -1.401; TCGA BRCA -1.117; TCGA CESC -0.743; TCGA COAD -1.518; TCGA ESCA -1.119; TCGA HNSC -0.719; TCGA KIRC -0.782; TCGA LIHC -0.594; TCGA LUAD -0.606; TCGA LUSC -1.26; TCGA PAAD -0.649; TCGA PRAD -0.491; TCGA SARC -0.522; TCGA STAD -1.367; TCGA UCEC -0.988
hsa-miR-590-3p
BDH2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUSC; PAAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.102; TCGA BRCA -0.158; TCGA CESC -0.129; TCGA COAD -0.103; TCGA ESCA -0.158; TCGA KIRC -0.276; TCGA LUSC -0.168; TCGA PAAD -0.216; TCGA THCA -0.064; TCGA STAD -0.121; TCGA UCEC -0.128
hsa-miR-590-3p
NEK9
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.133; TCGA BRCA -0.17; TCGA CESC -0.067; TCGA ESCA -0.142; TCGA KIRC -0.11; TCGA LUAD -0.081; TCGA PRAD -0.07; TCGA SARC -0.146; TCGA STAD -0.233; TCGA UCEC -0.101
hsa-miR-590-3p
GATA2
14 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.151; TCGA BRCA -0.417; TCGA COAD -0.257; TCGA ESCA -0.238; TCGA KIRC -0.637; TCGA KIRP -0.469; TCGA LGG -0.139; TCGA LIHC -0.234; TCGA LUAD -0.177; TCGA LUSC -0.447; TCGA SARC -0.235; TCGA THCA -0.18; TCGA STAD -0.193; TCGA UCEC -0.324
hsa-miR-590-3p
FBN1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.538; TCGA BRCA -0.323; TCGA CESC -0.316; TCGA COAD -0.73; TCGA ESCA -0.54; TCGA HNSC -0.5; TCGA KIRP -0.263; TCGA LUAD -0.197; TCGA LUSC -0.589; TCGA PAAD -0.624; TCGA PRAD -0.288; TCGA STAD -0.39; TCGA UCEC -0.417
hsa-miR-590-3p
IRS2
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; LUSC; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.183; TCGA BRCA -0.309; TCGA CESC -0.259; TCGA HNSC -0.241; TCGA KIRP -0.245; TCGA LUAD -0.136; TCGA LUSC -0.261; TCGA SARC -0.168; TCGA STAD -0.338; TCGA UCEC -0.529
hsa-miR-590-3p
OSMR
10 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LUSC; PAAD; PRAD; SARC; STAD
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.307; TCGA BRCA -0.127; TCGA COAD -0.68; TCGA HNSC -0.127; TCGA KIRP -0.386; TCGA LUSC -0.196; TCGA PAAD -0.421; TCGA PRAD -0.265; TCGA SARC -0.25; TCGA STAD -0.197
hsa-miR-590-3p
SNX29
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.168; TCGA BRCA -0.137; TCGA CESC -0.176; TCGA COAD -0.163; TCGA ESCA -0.194; TCGA HNSC -0.116; TCGA KIRC -0.108; TCGA LUAD -0.185; TCGA LUSC -0.21; TCGA PRAD -0.109; TCGA STAD -0.244; TCGA UCEC -0.141
hsa-miR-590-3p
LRCH1
12 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.244; TCGA BRCA -0.145; TCGA CESC -0.207; TCGA KIRC -0.107; TCGA KIRP -0.118; TCGA LUAD -0.115; TCGA LUSC -0.284; TCGA PAAD -0.132; TCGA PRAD -0.206; TCGA SARC -0.184; TCGA STAD -0.197; TCGA UCEC -0.259
hsa-miR-590-3p
FAM149B1
9 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LGG; LUSC; PAAD; STAD
miRanda; mirMAP
TCGA BLCA -0.065; TCGA CESC -0.096; TCGA ESCA -0.069; TCGA KIRC -0.092; TCGA KIRP -0.088; TCGA LGG -0.078; TCGA LUSC -0.073; TCGA PAAD -0.087; TCGA STAD -0.11
hsa-miR-590-3p
RSPO3
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.69; TCGA BRCA -0.231; TCGA CESC -0.361; TCGA COAD -0.855; TCGA ESCA -1.07; TCGA HNSC -0.363; TCGA KIRC -0.535; TCGA KIRP -0.35; TCGA LGG -0.263; TCGA LUSC -0.622; TCGA PAAD -0.432; TCGA PRAD -0.466; TCGA SARC -0.917; TCGA STAD -0.74; TCGA UCEC -0.794
hsa-miR-590-3p
DYM
10 cancers: BLCA; CESC; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.095; TCGA CESC -0.067; TCGA HNSC -0.069; TCGA KIRC -0.09; TCGA KIRP -0.207; TCGA PAAD -0.12; TCGA PRAD -0.073; TCGA SARC -0.096; TCGA THCA -0.064; TCGA STAD -0.085
hsa-miR-590-3p
CRYL1
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LUSC; PRAD; THCA
miRanda
TCGA BLCA -0.191; TCGA BRCA -0.169; TCGA CESC -0.145; TCGA HNSC -0.16; TCGA KIRC -0.266; TCGA LGG -0.097; TCGA LUSC -0.203; TCGA PRAD -0.061; TCGA THCA -0.059
hsa-miR-590-3p
EMP1
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.309; TCGA BRCA -0.248; TCGA COAD -0.241; TCGA HNSC -0.206; TCGA KIRC -0.194; TCGA KIRP -0.235; TCGA LUAD -0.148; TCGA LUSC -0.336; TCGA PAAD -0.386; TCGA PRAD -0.147; TCGA THCA -0.121; TCGA STAD -0.385; TCGA UCEC -0.302
hsa-miR-590-3p
GPD1L
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.18; TCGA BRCA -0.313; TCGA CESC -0.178; TCGA ESCA -0.229; TCGA KIRC -0.577; TCGA LGG -0.127; TCGA LUAD -0.251; TCGA LUSC -0.223; TCGA PRAD -0.227; TCGA SARC -0.417; TCGA STAD -0.101; TCGA UCEC -0.116
hsa-miR-590-3p
DTWD2
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.09; TCGA BRCA -0.181; TCGA CESC -0.141; TCGA ESCA -0.104; TCGA HNSC -0.14; TCGA KIRC -0.198; TCGA KIRP -0.195; TCGA LGG -0.087; TCGA LUAD -0.117; TCGA PAAD -0.11; TCGA PRAD -0.153; TCGA SARC -0.226; TCGA STAD -0.099
hsa-miR-590-3p
MAGI2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.316; TCGA BRCA -0.281; TCGA CESC -0.153; TCGA COAD -0.222; TCGA ESCA -0.289; TCGA KIRC -0.344; TCGA LUAD -0.212; TCGA PRAD -0.117; TCGA SARC -0.303; TCGA STAD -0.708; TCGA UCEC -0.321
hsa-miR-590-3p
PCYT1B
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.335; TCGA BRCA -0.254; TCGA CESC -0.448; TCGA COAD -0.665; TCGA HNSC -0.303; TCGA KIRC -0.202; TCGA LGG -0.153; TCGA LUAD -0.354; TCGA PAAD -0.371; TCGA PRAD -0.592; TCGA SARC -0.848; TCGA STAD -0.902; TCGA UCEC -0.266
hsa-miR-590-3p
ABLIM1
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.168; TCGA BRCA -0.129; TCGA CESC -0.293; TCGA HNSC -0.179; TCGA KIRC -0.355; TCGA KIRP -0.217; TCGA LGG -0.112; TCGA LUAD -0.15; TCGA LUSC -0.12; TCGA PRAD -0.103; TCGA UCEC -0.109
hsa-miR-590-3p
SHROOM3
10 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; THCA
miRanda; mirMAP
TCGA BLCA -0.15; TCGA BRCA -0.126; TCGA CESC -0.216; TCGA KIRC -0.796; TCGA KIRP -0.353; TCGA LUAD -0.195; TCGA LUSC -0.286; TCGA PAAD -0.16; TCGA SARC -0.793; TCGA THCA -0.15
hsa-miR-590-3p
ERG
13 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.271; TCGA BRCA -0.359; TCGA COAD -0.474; TCGA HNSC -0.135; TCGA KIRP -0.268; TCGA LIHC -0.141; TCGA LUAD -0.292; TCGA LUSC -0.526; TCGA PRAD -0.401; TCGA SARC -0.156; TCGA THCA -0.133; TCGA STAD -0.299; TCGA UCEC -0.322
hsa-miR-590-3p
PDE1C
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.912; TCGA BRCA -0.431; TCGA COAD -0.363; TCGA ESCA -0.674; TCGA HNSC -0.273; TCGA KIRC -0.295; TCGA KIRP -1.019; TCGA LUAD -0.284; TCGA LUSC -0.677; TCGA PRAD -0.589; TCGA SARC -0.802; TCGA THCA -0.509; TCGA STAD -0.682; TCGA UCEC -0.437
hsa-miR-590-3p
PHACTR1
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC; STAD
miRanda
TCGA BLCA -0.242; TCGA BRCA -0.084; TCGA CESC -0.22; TCGA COAD -0.354; TCGA HNSC -0.15; TCGA KIRC -0.395; TCGA KIRP -0.221; TCGA LGG -0.363; TCGA LUAD -0.435; TCGA LUSC -0.486; TCGA SARC -0.161; TCGA STAD -0.394
hsa-miR-590-3p
HERC1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.137; TCGA BRCA -0.152; TCGA CESC -0.134; TCGA COAD -0.136; TCGA ESCA -0.103; TCGA HNSC -0.101; TCGA KIRC -0.159; TCGA KIRP -0.127; TCGA LGG -0.136; TCGA LUAD -0.143; TCGA LUSC -0.146; TCGA PRAD -0.161; TCGA SARC -0.19; TCGA STAD -0.216; TCGA UCEC -0.078
hsa-miR-590-3p
STXBP1
13 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.215; TCGA BRCA -0.227; TCGA CESC -0.221; TCGA KIRC -0.153; TCGA KIRP -0.251; TCGA LGG -0.245; TCGA LUAD -0.317; TCGA LUSC -0.232; TCGA PRAD -0.142; TCGA SARC -0.098; TCGA THCA -0.073; TCGA STAD -0.227; TCGA UCEC -0.37
hsa-miR-590-3p
KIAA1109
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.088; TCGA BRCA -0.195; TCGA CESC -0.173; TCGA COAD -0.069; TCGA ESCA -0.207; TCGA KIRC -0.261; TCGA KIRP -0.223; TCGA LGG -0.066; TCGA LUAD -0.151; TCGA LUSC -0.222; TCGA PRAD -0.159; TCGA SARC -0.243; TCGA THCA -0.108; TCGA STAD -0.206; TCGA UCEC -0.109
hsa-miR-590-3p
GDF6
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.553; TCGA BRCA -0.267; TCGA COAD -0.883; TCGA ESCA -0.588; TCGA HNSC -0.355; TCGA LUSC -0.616; TCGA PAAD -0.549; TCGA PRAD -0.294; TCGA STAD -0.716; TCGA UCEC -0.576
hsa-miR-590-3p
FAM26E
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.372; TCGA BRCA -0.255; TCGA COAD -0.602; TCGA ESCA -0.331; TCGA HNSC -0.249; TCGA KIRC -0.16; TCGA LUAD -0.098; TCGA LUSC -0.544; TCGA PAAD -0.396; TCGA THCA -0.154; TCGA STAD -0.292; TCGA UCEC -0.382
hsa-miR-590-3p
PTPN21
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.287; TCGA BRCA -0.302; TCGA CESC -0.228; TCGA COAD -0.151; TCGA ESCA -0.222; TCGA HNSC -0.162; TCGA KIRC -0.346; TCGA LUAD -0.269; TCGA LUSC -0.614; TCGA PAAD -0.199; TCGA PRAD -0.131; TCGA THCA -0.13; TCGA STAD -0.335; TCGA UCEC -0.235
hsa-miR-590-3p
C1RL
10 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.092; TCGA BRCA -0.083; TCGA COAD -0.088; TCGA ESCA -0.102; TCGA LUAD -0.065; TCGA LUSC -0.137; TCGA PAAD -0.179; TCGA PRAD -0.126; TCGA SARC -0.211; TCGA STAD -0.116
hsa-miR-590-3p
SAMD11
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; UCEC
miRanda
TCGA BLCA -0.387; TCGA BRCA -0.2; TCGA COAD -0.607; TCGA ESCA -0.5; TCGA HNSC -0.31; TCGA KIRC -0.375; TCGA KIRP -0.385; TCGA LGG -0.423; TCGA LUAD -0.161; TCGA LUSC -0.456; TCGA UCEC -0.31
hsa-miR-590-3p
SHANK3
12 cancers: BLCA; BRCA; COAD; HNSC; LGG; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.125; TCGA BRCA -0.232; TCGA COAD -0.223; TCGA HNSC -0.074; TCGA LGG -0.169; TCGA LIHC -0.135; TCGA LUAD -0.137; TCGA LUSC -0.246; TCGA SARC -0.14; TCGA THCA -0.155; TCGA STAD -0.215; TCGA UCEC -0.255
hsa-miR-590-3p
TMEM200A
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; SARC; UCEC
miRanda; mirMAP
TCGA BLCA -0.338; TCGA BRCA -0.107; TCGA CESC -0.232; TCGA COAD -0.188; TCGA HNSC -0.189; TCGA LUAD -0.135; TCGA LUSC -0.363; TCGA PAAD -0.409; TCGA SARC -0.576; TCGA UCEC -0.44
hsa-miR-590-3p
SYNE1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.523; TCGA BRCA -0.255; TCGA CESC -0.252; TCGA COAD -0.529; TCGA ESCA -0.542; TCGA HNSC -0.151; TCGA KIRC -0.333; TCGA KIRP -0.404; TCGA LGG -0.127; TCGA LUAD -0.33; TCGA LUSC -0.712; TCGA PRAD -0.258; TCGA SARC -0.434; TCGA STAD -0.575; TCGA UCEC -0.489
hsa-miR-590-3p
CLIP1
11 cancers: BLCA; COAD; HNSC; KIRP; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.148; TCGA COAD -0.114; TCGA HNSC -0.126; TCGA KIRP -0.188; TCGA LUSC -0.091; TCGA PAAD -0.11; TCGA PRAD -0.101; TCGA SARC -0.183; TCGA THCA -0.106; TCGA STAD -0.304; TCGA UCEC -0.091
hsa-miR-590-3p
UBE3A
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.056; TCGA BRCA -0.06; TCGA CESC -0.057; TCGA HNSC -0.056; TCGA KIRC -0.058; TCGA KIRP -0.084; TCGA PAAD -0.053; TCGA PRAD -0.054; TCGA SARC -0.125; TCGA STAD -0.101; TCGA UCEC -0.104
hsa-miR-590-3p
ADAM33
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.796; TCGA BRCA -0.859; TCGA CESC -0.441; TCGA COAD -0.884; TCGA ESCA -0.648; TCGA HNSC -0.214; TCGA KIRC -0.56; TCGA LIHC -0.488; TCGA LUAD -0.313; TCGA LUSC -0.665; TCGA PAAD -0.361; TCGA PRAD -0.267; TCGA SARC -0.388; TCGA STAD -1.1; TCGA UCEC -0.633
hsa-miR-590-3p
CRY2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.262; TCGA BRCA -0.323; TCGA CESC -0.177; TCGA COAD -0.094; TCGA ESCA -0.251; TCGA HNSC -0.13; TCGA KIRC -0.236; TCGA KIRP -0.128; TCGA LGG -0.314; TCGA LUAD -0.232; TCGA LUSC -0.251; TCGA PRAD -0.106; TCGA SARC -0.205; TCGA STAD -0.263; TCGA UCEC -0.204
hsa-miR-590-3p
PCDH18
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.464; TCGA BRCA -0.335; TCGA CESC -0.407; TCGA COAD -0.438; TCGA HNSC -0.33; TCGA KIRC -0.313; TCGA LUAD -0.171; TCGA LUSC -0.33; TCGA PAAD -0.493; TCGA PRAD -0.326; TCGA STAD -0.296; TCGA UCEC -0.34
hsa-miR-590-3p
NCOA2
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA
miRanda; mirMAP
TCGA BLCA -0.159; TCGA CESC -0.369; TCGA COAD -0.161; TCGA ESCA -0.144; TCGA HNSC -0.235; TCGA KIRC -0.374; TCGA KIRP -0.642; TCGA LGG -0.162; TCGA LUAD -0.179; TCGA LUSC -0.13; TCGA PRAD -0.301; TCGA SARC -0.493; TCGA THCA -0.202
hsa-miR-590-3p
CSDE1
11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.115; TCGA CESC -0.089; TCGA ESCA -0.119; TCGA HNSC -0.074; TCGA KIRC -0.126; TCGA KIRP -0.144; TCGA PAAD -0.093; TCGA PRAD -0.08; TCGA THCA -0.059; TCGA STAD -0.215; TCGA UCEC -0.129
hsa-miR-590-3p
KCNIP3
11 cancers: BLCA; CESC; COAD; ESCA; KIRC; LGG; LIHC; LUAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.37; TCGA CESC -0.232; TCGA COAD -0.339; TCGA ESCA -0.294; TCGA KIRC -0.277; TCGA LGG -0.508; TCGA LIHC -0.434; TCGA LUAD -0.141; TCGA PRAD -0.322; TCGA STAD -0.671; TCGA UCEC -0.312
hsa-miR-590-3p
PPFIA2
11 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LUAD; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.707; TCGA BRCA -0.381; TCGA ESCA -0.674; TCGA KIRC -0.436; TCGA KIRP -0.601; TCGA LGG -0.347; TCGA LUAD -0.294; TCGA PAAD -0.767; TCGA SARC -0.954; TCGA STAD -0.519; TCGA UCEC -0.3
hsa-miR-590-3p
RADIL
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC
miRanda
TCGA BLCA -0.242; TCGA BRCA -0.268; TCGA COAD -0.354; TCGA ESCA -0.419; TCGA HNSC -0.185; TCGA LUAD -0.216; TCGA LUSC -0.366; TCGA STAD -0.671; TCGA UCEC -0.47
hsa-miR-590-3p
APP
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
miRanda
TCGA BLCA -0.166; TCGA CESC -0.142; TCGA COAD -0.089; TCGA ESCA -0.138; TCGA HNSC -0.148; TCGA KIRC -0.308; TCGA KIRP -0.392; TCGA LUAD -0.092; TCGA LUSC -0.096; TCGA PAAD -0.109; TCGA PRAD -0.197; TCGA THCA -0.115; TCGA UCEC -0.148
hsa-miR-590-3p
ZDHHC17
9 cancers: BLCA; BRCA; CESC; COAD; KIRP; LGG; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.056; TCGA BRCA -0.153; TCGA CESC -0.12; TCGA COAD -0.051; TCGA KIRP -0.081; TCGA LGG -0.079; TCGA SARC -0.129; TCGA STAD -0.253; TCGA UCEC -0.128
hsa-miR-590-3p
FGFR2
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.311; TCGA BRCA -0.204; TCGA COAD -0.231; TCGA ESCA -0.245; TCGA KIRC -0.563; TCGA KIRP -0.399; TCGA LUAD -0.384; TCGA PAAD -0.58; TCGA PRAD -0.474; TCGA SARC -0.987; TCGA STAD -0.2; TCGA UCEC -0.201
hsa-miR-590-3p
WLS
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.361; TCGA BRCA -0.441; TCGA COAD -0.124; TCGA ESCA -0.245; TCGA HNSC -0.134; TCGA KIRC -0.584; TCGA KIRP -0.25; TCGA LUAD -0.214; TCGA LUSC -0.126; TCGA PAAD -0.207; TCGA PRAD -0.166; TCGA SARC -0.108; TCGA STAD -0.441; TCGA UCEC -0.241
hsa-miR-590-3p
MYOF
11 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRanda
TCGA BLCA -0.182; TCGA BRCA -0.234; TCGA COAD -0.181; TCGA ESCA -0.224; TCGA KIRP -0.175; TCGA LUAD -0.137; TCGA LUSC -0.199; TCGA PAAD -0.455; TCGA PRAD -0.443; TCGA THCA -0.174; TCGA STAD -0.243
hsa-miR-590-3p
THSD4
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.271; TCGA BRCA -0.658; TCGA CESC -0.267; TCGA COAD -0.262; TCGA ESCA -0.293; TCGA HNSC -0.213; TCGA KIRC -0.608; TCGA KIRP -0.496; TCGA LGG -0.393; TCGA LUAD -0.286; TCGA LUSC -0.231; TCGA PAAD -0.416; TCGA PRAD -0.335; TCGA SARC -0.592; TCGA THCA -0.146; TCGA STAD -0.375; TCGA UCEC -0.271
hsa-miR-590-3p
RASSF8
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.293; TCGA BRCA -0.196; TCGA CESC -0.359; TCGA COAD -0.68; TCGA ESCA -0.273; TCGA HNSC -0.182; TCGA KIRC -0.432; TCGA KIRP -0.34; TCGA LUAD -0.219; TCGA LUSC -0.276; TCGA PAAD -0.518; TCGA PRAD -0.245; TCGA SARC -0.343; TCGA THCA -0.14; TCGA STAD -0.686; TCGA UCEC -0.474
hsa-miR-590-3p
EDA2R
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.433; TCGA BRCA -0.42; TCGA CESC -0.279; TCGA COAD -0.563; TCGA ESCA -0.43; TCGA HNSC -0.247; TCGA LGG -0.18; TCGA LIHC -0.478; TCGA LUAD -0.532; TCGA LUSC -0.587; TCGA PAAD -0.25; TCGA PRAD -0.333; TCGA SARC -0.466; TCGA THCA -0.226; TCGA STAD -0.466; TCGA UCEC -0.413
hsa-miR-590-3p
MPHOSPH8
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.112; TCGA BRCA -0.139; TCGA CESC -0.185; TCGA COAD -0.104; TCGA ESCA -0.094; TCGA KIRC -0.13; TCGA KIRP -0.202; TCGA LUAD -0.115; TCGA LUSC -0.159; TCGA PRAD -0.174; TCGA SARC -0.212; TCGA THCA -0.069; TCGA STAD -0.171; TCGA UCEC -0.102
hsa-miR-590-3p
AGAP1
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; PAAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.062; TCGA BRCA -0.055; TCGA CESC -0.127; TCGA HNSC -0.131; TCGA KIRC -0.108; TCGA KIRP -0.239; TCGA PAAD -0.174; TCGA SARC -0.113; TCGA THCA -0.143; TCGA STAD -0.163
hsa-miR-590-3p
LDB2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.422; TCGA BRCA -0.405; TCGA CESC -0.405; TCGA COAD -0.45; TCGA ESCA -0.223; TCGA HNSC -0.213; TCGA LUAD -0.261; TCGA LUSC -0.666; TCGA PRAD -0.098; TCGA SARC -0.186; TCGA THCA -0.189; TCGA STAD -0.312; TCGA UCEC -0.458
hsa-miR-590-3p
PRG4
9 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.416; TCGA BRCA -0.488; TCGA COAD -0.577; TCGA ESCA -0.366; TCGA HNSC -0.353; TCGA LUAD -0.675; TCGA LUSC -0.711; TCGA PAAD -0.393; TCGA STAD -0.282
hsa-miR-590-3p
IGFBP7
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.357; TCGA BRCA -0.107; TCGA CESC -0.149; TCGA COAD -0.443; TCGA ESCA -0.157; TCGA KIRC -0.117; TCGA LIHC -0.287; TCGA LUAD -0.133; TCGA LUSC -0.405; TCGA PAAD -0.284; TCGA SARC -0.245; TCGA STAD -0.305; TCGA UCEC -0.216
hsa-miR-590-3p
PCDHGA11
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.325; TCGA BRCA -0.289; TCGA CESC -0.396; TCGA COAD -0.225; TCGA ESCA -0.306; TCGA HNSC -0.27; TCGA KIRC -0.202; TCGA LUAD -0.156; TCGA LUSC -0.357; TCGA PAAD -0.239; TCGA PRAD -0.439; TCGA SARC -0.385; TCGA THCA -0.189; TCGA UCEC -0.172
hsa-miR-590-3p
HGF
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.644; TCGA BRCA -0.405; TCGA COAD -0.738; TCGA ESCA -0.319; TCGA KIRC -0.171; TCGA LUAD -0.348; TCGA LUSC -0.709; TCGA PAAD -0.6; TCGA PRAD -0.312; TCGA STAD -0.306; TCGA UCEC -0.294
hsa-miR-590-3p
SYNPO2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -1.197; TCGA BRCA -0.465; TCGA CESC -0.356; TCGA COAD -1.076; TCGA ESCA -1.087; TCGA HNSC -0.349; TCGA KIRC -0.215; TCGA LUAD -0.346; TCGA LUSC -0.571; TCGA PAAD -0.416; TCGA PRAD -0.665; TCGA SARC -1.107; TCGA STAD -1.466; TCGA UCEC -0.686
hsa-miR-590-3p
DUSP19
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.267; TCGA BRCA -0.106; TCGA CESC -0.16; TCGA COAD -0.103; TCGA ESCA -0.224; TCGA HNSC -0.148; TCGA KIRC -0.138; TCGA KIRP -0.161; TCGA LGG -0.143; TCGA PRAD -0.233; TCGA SARC -0.451; TCGA STAD -0.316; TCGA UCEC -0.147
hsa-miR-590-3p
KBTBD3
9 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.134; TCGA BRCA -0.168; TCGA CESC -0.133; TCGA ESCA -0.147; TCGA KIRC -0.207; TCGA KIRP -0.089; TCGA SARC -0.121; TCGA STAD -0.149; TCGA UCEC -0.153
hsa-miR-590-3p
COL21A1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.732; TCGA BRCA -0.271; TCGA CESC -0.362; TCGA COAD -0.504; TCGA ESCA -0.528; TCGA HNSC -0.234; TCGA KIRP -0.329; TCGA LUAD -0.439; TCGA LUSC -0.542; TCGA PAAD -0.432; TCGA PRAD -0.351; TCGA SARC -0.387; TCGA THCA -0.304; TCGA STAD -0.952; TCGA UCEC -0.319
hsa-miR-590-3p
VWA5A
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.451; TCGA BRCA -0.281; TCGA CESC -0.264; TCGA HNSC -0.138; TCGA KIRC -0.331; TCGA LGG -0.063; TCGA LUAD -0.223; TCGA LUSC -0.404; TCGA PRAD -0.301; TCGA SARC -0.258; TCGA THCA -0.072; TCGA UCEC -0.247
hsa-miR-590-3p
SVIL
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.423; TCGA BRCA -0.104; TCGA CESC -0.192; TCGA COAD -0.343; TCGA ESCA -0.364; TCGA HNSC -0.217; TCGA KIRC -0.112; TCGA KIRP -0.198; TCGA LIHC -0.168; TCGA LUAD -0.125; TCGA PAAD -0.318; TCGA PRAD -0.415; TCGA SARC -0.728; TCGA STAD -0.848; TCGA UCEC -0.45
hsa-miR-590-3p
IKZF4
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.114; TCGA BRCA -0.089; TCGA CESC -0.138; TCGA COAD -0.095; TCGA ESCA -0.148; TCGA KIRC -0.06; TCGA KIRP -0.114; TCGA LUAD -0.063; TCGA LUSC -0.116; TCGA PRAD -0.098; TCGA SARC -0.126; TCGA THCA -0.071; TCGA STAD -0.209; TCGA UCEC -0.08
hsa-miR-590-3p
MATN2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.394; TCGA BRCA -0.467; TCGA CESC -0.193; TCGA COAD -0.261; TCGA ESCA -0.348; TCGA HNSC -0.183; TCGA KIRC -0.521; TCGA LUAD -0.383; TCGA PRAD -0.251; TCGA SARC -0.609; TCGA STAD -0.638; TCGA UCEC -0.304
hsa-miR-590-3p
ALAD
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.103; TCGA BRCA -0.198; TCGA CESC -0.095; TCGA ESCA -0.138; TCGA KIRC -0.306; TCGA KIRP -0.148; TCGA LUAD -0.085; TCGA LUSC -0.075; TCGA PRAD -0.115; TCGA SARC -0.107; TCGA THCA -0.097; TCGA STAD -0.108
hsa-miR-590-3p
RAPGEF2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.117; TCGA BRCA -0.123; TCGA CESC -0.185; TCGA COAD -0.082; TCGA ESCA -0.109; TCGA HNSC -0.072; TCGA KIRC -0.09; TCGA KIRP -0.115; TCGA LGG -0.1; TCGA LUAD -0.16; TCGA LUSC -0.321; TCGA PRAD -0.07; TCGA THCA -0.108; TCGA STAD -0.109; TCGA UCEC -0.064
hsa-miR-590-3p
MYOC
10 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -1.134; TCGA BRCA -0.963; TCGA COAD -1.213; TCGA ESCA -1.755; TCGA LUAD -0.651; TCGA LUSC -0.729; TCGA PRAD -0.31; TCGA SARC -1.614; TCGA STAD -1.789; TCGA UCEC -0.297
hsa-miR-590-3p
SCHIP1
9 cancers: BLCA; COAD; ESCA; LGG; PAAD; PRAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.251; TCGA COAD -0.426; TCGA ESCA -0.211; TCGA LGG -0.073; TCGA PAAD -0.163; TCGA PRAD -0.322; TCGA SARC -0.345; TCGA THCA -0.099; TCGA UCEC -0.357
hsa-miR-590-3p
ZFYVE1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.084; TCGA BRCA -0.14; TCGA CESC -0.087; TCGA COAD -0.107; TCGA ESCA -0.131; TCGA HNSC -0.107; TCGA KIRC -0.186; TCGA KIRP -0.117; TCGA LUAD -0.09; TCGA LUSC -0.141; TCGA PRAD -0.055; TCGA SARC -0.07; TCGA THCA -0.066; TCGA STAD -0.163; TCGA UCEC -0.056
hsa-miR-590-3p
FSTL1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.327; TCGA BRCA -0.254; TCGA CESC -0.21; TCGA COAD -0.509; TCGA ESCA -0.271; TCGA HNSC -0.299; TCGA LUSC -0.31; TCGA PAAD -0.437; TCGA PRAD -0.144; TCGA STAD -0.438; TCGA UCEC -0.31
hsa-miR-590-3p
ANO5
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.787; TCGA BRCA -0.271; TCGA CESC -0.409; TCGA COAD -0.677; TCGA ESCA -0.671; TCGA HNSC -0.439; TCGA KIRC -1.097; TCGA LGG -0.376; TCGA LUAD -0.351; TCGA LUSC -0.484; TCGA PRAD -0.568; TCGA SARC -0.641; TCGA STAD -0.867; TCGA UCEC -0.537
hsa-miR-590-3p
ATP9A
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.1; TCGA BRCA -0.092; TCGA CESC -0.257; TCGA COAD -0.179; TCGA ESCA -0.154; TCGA HNSC -0.225; TCGA KIRC -0.429; TCGA KIRP -0.213; TCGA LGG -0.248; TCGA LIHC -0.245; TCGA LUAD -0.164; TCGA LUSC -0.109; TCGA PRAD -0.154; TCGA SARC -0.462; TCGA THCA -0.135; TCGA STAD -0.13; TCGA UCEC -0.089
hsa-miR-590-3p
LYST
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.129; TCGA BRCA -0.11; TCGA CESC -0.123; TCGA COAD -0.082; TCGA ESCA -0.123; TCGA HNSC -0.137; TCGA LUAD -0.124; TCGA LUSC -0.241; TCGA PRAD -0.139; TCGA SARC -0.135; TCGA STAD -0.202
hsa-miR-590-3p
DIP2C
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.272; TCGA BRCA -0.158; TCGA CESC -0.128; TCGA COAD -0.39; TCGA ESCA -0.336; TCGA HNSC -0.254; TCGA KIRC -0.099; TCGA LGG -0.099; TCGA LUAD -0.086; TCGA LUSC -0.196; TCGA PAAD -0.244; TCGA PRAD -0.17; TCGA SARC -0.323; TCGA STAD -0.51; TCGA UCEC -0.21
hsa-miR-590-3p
MEIS3P1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.218; TCGA BRCA -0.309; TCGA CESC -0.346; TCGA COAD -0.463; TCGA ESCA -0.276; TCGA HNSC -0.229; TCGA KIRC -0.353; TCGA LUAD -0.119; TCGA LUSC -0.255; TCGA PAAD -0.198; TCGA PRAD -0.253; TCGA SARC -0.234; TCGA THCA -0.109; TCGA STAD -0.393; TCGA UCEC -0.156
hsa-miR-590-3p
CPA3
10 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.773; TCGA BRCA -0.751; TCGA COAD -0.643; TCGA ESCA -0.53; TCGA LUAD -0.611; TCGA LUSC -0.862; TCGA PAAD -0.729; TCGA SARC -0.745; TCGA STAD -0.411; TCGA UCEC -0.641
hsa-miR-590-3p
TGFB3
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.525; TCGA BRCA -0.276; TCGA COAD -0.695; TCGA ESCA -0.313; TCGA HNSC -0.212; TCGA LUSC -0.279; TCGA PAAD -0.418; TCGA PRAD -0.19; TCGA SARC -0.199; TCGA STAD -0.352; TCGA UCEC -0.277
hsa-miR-590-3p
ZMAT1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUSC; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.374; TCGA BRCA -0.26; TCGA CESC -0.239; TCGA COAD -0.197; TCGA ESCA -0.454; TCGA LGG -0.108; TCGA LUSC -0.331; TCGA SARC -0.259; TCGA STAD -0.542; TCGA UCEC -0.239
hsa-miR-590-3p
KLHL20
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.139; TCGA BRCA -0.087; TCGA CESC -0.14; TCGA COAD -0.116; TCGA ESCA -0.097; TCGA KIRP -0.103; TCGA LGG -0.086; TCGA LUAD -0.07; TCGA LUSC -0.075; TCGA PAAD -0.156; TCGA PRAD -0.19; TCGA SARC -0.258; TCGA STAD -0.16; TCGA UCEC -0.21
hsa-miR-590-3p
GIN1
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.072; TCGA BRCA -0.088; TCGA CESC -0.063; TCGA ESCA -0.069; TCGA KIRC -0.112; TCGA KIRP -0.092; TCGA LGG -0.066; TCGA LIHC -0.063; TCGA SARC -0.109; TCGA STAD -0.153; TCGA UCEC -0.105
hsa-miR-590-3p
NOX4
9 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUSC; PAAD; STAD
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.254; TCGA BRCA -0.134; TCGA CESC -0.216; TCGA COAD -0.715; TCGA HNSC -0.27; TCGA LIHC -0.325; TCGA LUSC -0.266; TCGA PAAD -0.692; TCGA STAD -0.194
hsa-miR-590-3p
SULF2
9 cancers: BLCA; BRCA; COAD; HNSC; LGG; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.286; TCGA BRCA -0.077; TCGA COAD -0.287; TCGA HNSC -0.222; TCGA LGG -0.325; TCGA PAAD -0.29; TCGA PRAD -0.265; TCGA STAD -0.113; TCGA UCEC -0.369
hsa-miR-590-3p
NMUR1
9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.308; TCGA BRCA -0.297; TCGA COAD -0.419; TCGA ESCA -0.398; TCGA LUAD -0.191; TCGA LUSC -0.514; TCGA PRAD -0.292; TCGA SARC -0.761; TCGA STAD -0.533
hsa-miR-590-3p
CHRDL1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.965; TCGA BRCA -0.593; TCGA CESC -0.829; TCGA COAD -1.427; TCGA ESCA -1.482; TCGA KIRC -1.083; TCGA KIRP -0.729; TCGA LGG -0.237; TCGA LUAD -0.516; TCGA LUSC -0.93; TCGA PAAD -0.409; TCGA PRAD -0.66; TCGA SARC -0.745; TCGA STAD -1.357; TCGA UCEC -1.122
hsa-miR-590-3p
GABARAPL1
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.209; TCGA BRCA -0.159; TCGA COAD -0.228; TCGA ESCA -0.185; TCGA HNSC -0.122; TCGA KIRC -0.467; TCGA KIRP -0.292; TCGA LGG -0.085; TCGA PRAD -0.083; TCGA THCA -0.062; TCGA STAD -0.339; TCGA UCEC -0.265
hsa-miR-590-3p
TRIM2
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.231; TCGA CESC -0.309; TCGA ESCA -0.184; TCGA HNSC -0.223; TCGA KIRC -0.748; TCGA KIRP -0.398; TCGA LGG -0.067; TCGA LUAD -0.152; TCGA PRAD -0.32; TCGA SARC -0.18
hsa-miR-590-3p
CDH6
11 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.267; TCGA BRCA -0.245; TCGA COAD -0.364; TCGA HNSC -0.211; TCGA LUAD -0.255; TCGA LUSC -0.594; TCGA PAAD -0.426; TCGA PRAD -0.19; TCGA SARC -0.245; TCGA THCA -0.195; TCGA STAD -0.252
hsa-miR-590-3p
YAP1
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.208; TCGA BRCA -0.142; TCGA COAD -0.098; TCGA ESCA -0.129; TCGA HNSC -0.171; TCGA KIRC -0.186; TCGA KIRP -0.329; TCGA LUAD -0.085; TCGA LUSC -0.145; TCGA PAAD -0.372; TCGA PRAD -0.199; TCGA SARC -0.441; TCGA THCA -0.179; TCGA STAD -0.236; TCGA UCEC -0.21
hsa-miR-590-3p
NRP2
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.465; TCGA CESC -0.255; TCGA COAD -0.573; TCGA ESCA -0.405; TCGA HNSC -0.141; TCGA LGG -0.084; TCGA LUAD -0.132; TCGA LUSC -0.388; TCGA PAAD -0.391; TCGA PRAD -0.392; TCGA SARC -0.14; TCGA THCA -0.227; TCGA STAD -0.637; TCGA UCEC -0.35
hsa-miR-590-3p
LIMCH1
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.309; TCGA BRCA -0.239; TCGA COAD -0.299; TCGA ESCA -0.485; TCGA HNSC -0.551; TCGA KIRC -0.356; TCGA KIRP -0.457; TCGA LUAD -0.329; TCGA LUSC -0.567; TCGA PRAD -0.138; TCGA SARC -0.435; TCGA THCA -0.092; TCGA STAD -0.355; TCGA UCEC -0.185
hsa-miR-590-3p
TNNI3K
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; LUSC; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.658; TCGA BRCA -0.5; TCGA CESC -0.369; TCGA ESCA -0.803; TCGA KIRC -0.35; TCGA LUAD -0.405; TCGA LUSC -0.457; TCGA PRAD -0.319; TCGA SARC -0.667; TCGA UCEC -0.332
hsa-miR-590-3p
FAM175A
9 cancers: BLCA; BRCA; CESC; KIRC; KIRP; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.152; TCGA BRCA -0.137; TCGA CESC -0.114; TCGA KIRC -0.109; TCGA KIRP -0.227; TCGA PRAD -0.072; TCGA SARC -0.081; TCGA STAD -0.079; TCGA UCEC -0.284
hsa-miR-590-3p
CRIM1
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.127; TCGA BRCA -0.349; TCGA COAD -0.115; TCGA ESCA -0.171; TCGA HNSC -0.134; TCGA KIRC -0.306; TCGA KIRP -0.379; TCGA LUAD -0.208; TCGA LUSC -0.277; TCGA PAAD -0.286; TCGA PRAD -0.245; TCGA SARC -0.242; TCGA THCA -0.111; TCGA STAD -0.294; TCGA UCEC -0.295
hsa-miR-590-3p
AP4S1
9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.092; TCGA BRCA -0.057; TCGA COAD -0.091; TCGA ESCA -0.123; TCGA KIRC -0.2; TCGA LGG -0.076; TCGA PRAD -0.062; TCGA STAD -0.261; TCGA UCEC -0.159
hsa-miR-590-3p
CDON
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.443; TCGA BRCA -0.313; TCGA CESC -0.305; TCGA COAD -0.274; TCGA ESCA -0.309; TCGA HNSC -0.156; TCGA LGG -0.277; TCGA LUAD -0.23; TCGA PAAD -0.211; TCGA PRAD -0.104; TCGA SARC -0.226; TCGA STAD -0.797; TCGA UCEC -0.513
hsa-miR-590-3p
PNMA2
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.466; TCGA BRCA -0.306; TCGA CESC -0.66; TCGA ESCA -0.504; TCGA HNSC -0.304; TCGA LGG -0.115; TCGA LUAD -0.484; TCGA LUSC -0.637; TCGA PAAD -0.222; TCGA PRAD -0.229; TCGA SARC -0.601; TCGA STAD -0.275; TCGA UCEC -0.549
hsa-miR-590-3p
B3GNT9
10 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRanda; miRNATAP
TCGA BLCA -0.088; TCGA CESC -0.11; TCGA COAD -0.175; TCGA HNSC -0.117; TCGA LUAD -0.084; TCGA LUSC -0.108; TCGA PAAD -0.095; TCGA PRAD -0.253; TCGA THCA -0.107; TCGA STAD -0.079
hsa-miR-590-3p
KLHDC1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; LUSC; SARC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.368; TCGA BRCA -0.401; TCGA CESC -0.271; TCGA COAD -0.256; TCGA ESCA -0.343; TCGA KIRC -0.172; TCGA LGG -0.122; TCGA LUAD -0.099; TCGA LUSC -0.34; TCGA SARC -0.28; TCGA STAD -0.45; TCGA UCEC -0.342
hsa-miR-590-3p
TAB2
9 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LUSC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.084; TCGA CESC -0.113; TCGA HNSC -0.119; TCGA KIRC -0.169; TCGA KIRP -0.178; TCGA LUSC -0.08; TCGA THCA -0.06; TCGA STAD -0.184; TCGA UCEC -0.107
hsa-miR-590-3p
APCDD1L
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.601; TCGA BRCA -0.175; TCGA CESC -0.559; TCGA COAD -0.8; TCGA ESCA -0.365; TCGA HNSC -0.47; TCGA KIRC -0.607; TCGA KIRP -0.889; TCGA PAAD -0.685; TCGA PRAD -0.53; TCGA STAD -0.447; TCGA UCEC -0.415
hsa-miR-590-3p
NID2
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.265; TCGA BRCA -0.108; TCGA CESC -0.311; TCGA COAD -0.346; TCGA HNSC -0.276; TCGA KIRP -0.403; TCGA LUSC -0.438; TCGA PAAD -0.409; TCGA PRAD -0.261; TCGA THCA -0.216; TCGA STAD -0.224; TCGA UCEC -0.123
hsa-miR-590-3p
KLHL13
10 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.355; TCGA BRCA -0.357; TCGA COAD -0.338; TCGA KIRC -0.552; TCGA KIRP -0.472; TCGA LGG -0.11; TCGA PRAD -0.302; TCGA SARC -0.746; TCGA STAD -0.702; TCGA UCEC -0.335
hsa-miR-590-3p
PDE5A
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.506; TCGA BRCA -0.34; TCGA CESC -0.442; TCGA COAD -0.309; TCGA ESCA -0.61; TCGA HNSC -0.216; TCGA KIRC -0.155; TCGA KIRP -0.203; TCGA LUAD -0.275; TCGA LUSC -0.47; TCGA PAAD -0.259; TCGA PRAD -0.479; TCGA SARC -0.751; TCGA THCA -0.271; TCGA STAD -0.659; TCGA UCEC -0.327
hsa-miR-590-3p
DRD1
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LUAD; LUSC; PRAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.286; TCGA BRCA -0.375; TCGA COAD -0.427; TCGA ESCA -0.429; TCGA KIRC -0.672; TCGA LUAD -0.394; TCGA LUSC -0.468; TCGA PRAD -0.568; TCGA SARC -0.702; TCGA STAD -0.45
hsa-miR-590-3p
FBXL3
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.116; TCGA BRCA -0.168; TCGA CESC -0.179; TCGA COAD -0.08; TCGA ESCA -0.074; TCGA HNSC -0.074; TCGA KIRC -0.194; TCGA KIRP -0.175; TCGA LUAD -0.072; TCGA LUSC -0.208; TCGA PAAD -0.072; TCGA PRAD -0.083; TCGA SARC -0.126; TCGA STAD -0.118; TCGA UCEC -0.269
hsa-miR-590-3p
CAT
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.09; TCGA BRCA -0.248; TCGA CESC -0.227; TCGA HNSC -0.135; TCGA KIRC -0.375; TCGA KIRP -0.264; TCGA LUAD -0.23; TCGA LUSC -0.292; TCGA PAAD -0.093; TCGA PRAD -0.134; TCGA SARC -0.106; TCGA STAD -0.099; TCGA UCEC -0.151
hsa-miR-590-3p
STON1-GTF2A1L
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; SARC; STAD
miRanda; miRNATAP
TCGA BLCA -0.9; TCGA BRCA -0.332; TCGA ESCA -0.955; TCGA HNSC -0.291; TCGA KIRC -0.497; TCGA LUSC -0.923; TCGA PAAD -0.773; TCGA PRAD -0.47; TCGA SARC -0.693; TCGA STAD -1.009
hsa-miR-590-3p
FEZ2
9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.097; TCGA BRCA -0.096; TCGA COAD -0.072; TCGA KIRC -0.134; TCGA KIRP -0.157; TCGA PAAD -0.155; TCGA PRAD -0.096; TCGA STAD -0.203; TCGA UCEC -0.208
hsa-miR-590-3p
CORIN
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD
miRanda; mirMAP
TCGA BLCA -0.354; TCGA BRCA -0.126; TCGA CESC -0.345; TCGA COAD -0.749; TCGA ESCA -0.303; TCGA HNSC -0.478; TCGA KIRC -0.569; TCGA LUAD -0.278; TCGA LUSC -0.757; TCGA PAAD -0.667; TCGA PRAD -0.256; TCGA STAD -0.27
hsa-miR-590-3p
WISP2
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -1.085; TCGA BRCA -0.59; TCGA COAD -0.674; TCGA ESCA -1.197; TCGA HNSC -0.517; TCGA LUAD -0.206; TCGA LUSC -0.783; TCGA PAAD -0.477; TCGA PRAD -0.554; TCGA STAD -0.983; TCGA UCEC -0.441
hsa-miR-590-3p
HOPX
9 cancers: BLCA; COAD; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.283; TCGA COAD -0.676; TCGA LUAD -0.364; TCGA LUSC -0.583; TCGA PAAD -0.287; TCGA PRAD -0.098; TCGA SARC -0.404; TCGA STAD -0.554; TCGA UCEC -0.239
hsa-miR-590-3p
CRYZL1
13 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.117; TCGA BRCA -0.067; TCGA CESC -0.094; TCGA ESCA -0.143; TCGA KIRC -0.085; TCGA KIRP -0.163; TCGA LGG -0.08; TCGA LIHC -0.074; TCGA LUSC -0.079; TCGA PAAD -0.059; TCGA SARC -0.153; TCGA STAD -0.206; TCGA UCEC -0.14
hsa-miR-590-3p
ZNF385B
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; STAD
miRanda
TCGA BLCA -0.435; TCGA BRCA -0.417; TCGA COAD -0.829; TCGA ESCA -0.545; TCGA HNSC -0.483; TCGA KIRC -0.544; TCGA LUAD -0.568; TCGA LUSC -0.81; TCGA PRAD -0.197; TCGA STAD -0.598
hsa-miR-590-3p
FTO
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.153; TCGA BRCA -0.138; TCGA CESC -0.189; TCGA COAD -0.133; TCGA ESCA -0.136; TCGA HNSC -0.115; TCGA KIRP -0.101; TCGA LGG -0.051; TCGA LUAD -0.175; TCGA LUSC -0.158; TCGA PAAD -0.133; TCGA PRAD -0.178; TCGA SARC -0.132; TCGA THCA -0.106; TCGA STAD -0.249; TCGA UCEC -0.096
hsa-miR-590-3p
SUCLA2
9 cancers: BLCA; BRCA; CESC; KIRC; KIRP; PRAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.103; TCGA BRCA -0.134; TCGA CESC -0.2; TCGA KIRC -0.334; TCGA KIRP -0.199; TCGA PRAD -0.151; TCGA SARC -0.08; TCGA THCA -0.069; TCGA UCEC -0.096
hsa-miR-590-3p
KDELC2
9 cancers: BLCA; ESCA; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.132; TCGA ESCA -0.123; TCGA KIRP -0.17; TCGA PAAD -0.17; TCGA PRAD -0.257; TCGA SARC -0.186; TCGA THCA -0.064; TCGA STAD -0.194; TCGA UCEC -0.157
hsa-miR-590-3p
TCF21
11 cancers: BLCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.814; TCGA CESC -0.546; TCGA COAD -0.509; TCGA ESCA -0.487; TCGA KIRC -1.024; TCGA LUAD -0.552; TCGA LUSC -1.013; TCGA PAAD -0.335; TCGA PRAD -0.2; TCGA STAD -0.378; TCGA UCEC -0.56
hsa-miR-590-3p
METTL7A
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.265; TCGA BRCA -0.221; TCGA CESC -0.263; TCGA ESCA -0.316; TCGA KIRC -0.367; TCGA LGG -0.089; TCGA LUAD -0.221; TCGA LUSC -0.36; TCGA PRAD -0.086; TCGA SARC -0.287; TCGA STAD -0.349; TCGA UCEC -0.203
hsa-miR-590-3p
BBS2
13 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.113; TCGA BRCA -0.12; TCGA ESCA -0.187; TCGA HNSC -0.084; TCGA KIRC -0.164; TCGA KIRP -0.112; TCGA LGG -0.064; TCGA LUAD -0.085; TCGA PRAD -0.095; TCGA SARC -0.074; TCGA THCA -0.077; TCGA STAD -0.164; TCGA UCEC -0.117
hsa-miR-590-3p
PDLIM3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.888; TCGA BRCA -0.26; TCGA CESC -0.398; TCGA COAD -0.72; TCGA ESCA -0.729; TCGA HNSC -0.339; TCGA LUAD -0.112; TCGA LUSC -0.516; TCGA PAAD -0.469; TCGA PRAD -0.301; TCGA SARC -0.692; TCGA STAD -0.93; TCGA UCEC -0.849
hsa-miR-590-3p
ACTG2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -1.272; TCGA BRCA -0.319; TCGA CESC -0.645; TCGA COAD -1.054; TCGA ESCA -1.059; TCGA HNSC -0.424; TCGA LIHC -0.358; TCGA LUAD -0.317; TCGA LUSC -0.58; TCGA PAAD -0.514; TCGA PRAD -0.622; TCGA SARC -1.226; TCGA STAD -1.513; TCGA UCEC -0.935
hsa-miR-590-3p
KDSR
11 cancers: BLCA; BRCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.079; TCGA BRCA -0.072; TCGA HNSC -0.054; TCGA KIRP -0.098; TCGA LUAD -0.061; TCGA LUSC -0.083; TCGA PAAD -0.153; TCGA PRAD -0.108; TCGA SARC -0.084; TCGA STAD -0.121; TCGA UCEC -0.221
hsa-miR-590-3p
RBMS3
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.533; TCGA BRCA -0.56; TCGA COAD -0.625; TCGA ESCA -0.318; TCGA HNSC -0.3; TCGA KIRC -0.169; TCGA LUAD -0.36; TCGA LUSC -0.498; TCGA PAAD -0.443; TCGA PRAD -0.511; TCGA SARC -0.198; TCGA STAD -0.711; TCGA UCEC -0.166
hsa-miR-590-3p
MBLAC2
11 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.084; TCGA BRCA -0.15; TCGA CESC -0.141; TCGA KIRC -0.099; TCGA KIRP -0.142; TCGA LGG -0.144; TCGA LUAD -0.113; TCGA PRAD -0.184; TCGA SARC -0.14; TCGA STAD -0.206; TCGA UCEC -0.183
hsa-miR-590-3p
FBXO8
11 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.107; TCGA BRCA -0.088; TCGA HNSC -0.056; TCGA KIRC -0.158; TCGA KIRP -0.178; TCGA LUSC -0.115; TCGA PAAD -0.075; TCGA PRAD -0.053; TCGA SARC -0.124; TCGA STAD -0.155; TCGA UCEC -0.096
hsa-miR-590-3p
KCNK2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.501; TCGA BRCA -0.226; TCGA CESC -0.354; TCGA COAD -0.787; TCGA ESCA -0.707; TCGA HNSC -0.384; TCGA KIRP -0.422; TCGA LGG -0.161; TCGA PAAD -0.762; TCGA PRAD -0.471; TCGA STAD -0.82; TCGA UCEC -0.355
hsa-miR-590-3p
IL1R1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD
miRanda; miRNATAP
TCGA BLCA -0.268; TCGA BRCA -0.2; TCGA CESC -0.147; TCGA COAD -0.491; TCGA ESCA -0.324; TCGA HNSC -0.211; TCGA KIRC -0.095; TCGA LUAD -0.167; TCGA LUSC -0.434; TCGA PAAD -0.44; TCGA STAD -0.336
hsa-miR-590-3p
ANTXR1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.392; TCGA BRCA -0.183; TCGA CESC -0.321; TCGA COAD -0.772; TCGA ESCA -0.361; TCGA HNSC -0.31; TCGA KIRP -0.173; TCGA LUAD -0.222; TCGA LUSC -0.423; TCGA PAAD -0.611; TCGA PRAD -0.348; TCGA THCA -0.123; TCGA STAD -0.398; TCGA UCEC -0.374
hsa-miR-590-3p
DCHS2
14 cancers: BLCA; CESC; COAD; ESCA; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.748; TCGA CESC -0.517; TCGA COAD -0.903; TCGA ESCA -0.603; TCGA KIRP -0.369; TCGA LGG -0.192; TCGA LUAD -0.301; TCGA LUSC -0.298; TCGA PAAD -0.334; TCGA PRAD -0.748; TCGA SARC -0.824; TCGA THCA -0.305; TCGA STAD -0.511; TCGA UCEC -0.361
hsa-miR-590-3p
TRPC6
11 cancers: BLCA; BRCA; COAD; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.142; TCGA BRCA -0.267; TCGA COAD -0.406; TCGA KIRP -0.464; TCGA LIHC -0.322; TCGA LUAD -0.424; TCGA LUSC -0.496; TCGA PAAD -0.228; TCGA PRAD -0.454; TCGA STAD -0.254; TCGA UCEC -0.269
hsa-miR-590-3p
RNF115
9 cancers: BLCA; CESC; ESCA; KIRP; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.092; TCGA CESC -0.072; TCGA ESCA -0.073; TCGA KIRP -0.189; TCGA PAAD -0.065; TCGA PRAD -0.083; TCGA SARC -0.207; TCGA STAD -0.095; TCGA UCEC -0.067
hsa-miR-590-3p
FAM63B
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.162; TCGA BRCA -0.273; TCGA CESC -0.228; TCGA COAD -0.245; TCGA ESCA -0.235; TCGA HNSC -0.239; TCGA KIRC -0.503; TCGA KIRP -0.447; TCGA LUAD -0.143; TCGA LUSC -0.296; TCGA PAAD -0.392; TCGA PRAD -0.237; TCGA SARC -0.437; TCGA THCA -0.166; TCGA STAD -0.317; TCGA UCEC -0.124
hsa-miR-590-3p
ZC4H2
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.202; TCGA COAD -0.165; TCGA ESCA -0.273; TCGA HNSC -0.192; TCGA KIRC -0.237; TCGA KIRP -0.077; TCGA LGG -0.255; TCGA LUSC -0.379; TCGA PRAD -0.203; TCGA SARC -0.339; TCGA STAD -0.184; TCGA UCEC -0.404
hsa-miR-590-3p
COBL
9 cancers: BLCA; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.239; TCGA ESCA -0.442; TCGA HNSC -0.327; TCGA KIRC -0.522; TCGA LUAD -0.394; TCGA LUSC -0.539; TCGA PAAD -0.192; TCGA SARC -0.398; TCGA STAD -0.227
hsa-miR-590-3p
EDNRA
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.506; TCGA BRCA -0.272; TCGA CESC -0.438; TCGA COAD -0.509; TCGA HNSC -0.243; TCGA KIRP -0.254; TCGA LUAD -0.207; TCGA LUSC -0.527; TCGA PAAD -0.573; TCGA PRAD -0.421; TCGA SARC -0.639; TCGA THCA -0.117; TCGA STAD -0.543; TCGA UCEC -0.426
hsa-miR-590-3p
ISCU
9 cancers: BLCA; BRCA; KIRC; LIHC; LUSC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.096; TCGA BRCA -0.098; TCGA KIRC -0.154; TCGA LIHC -0.13; TCGA LUSC -0.087; TCGA SARC -0.079; TCGA THCA -0.06; TCGA STAD -0.12; TCGA UCEC -0.106
hsa-miR-590-3p
RANBP3L
11 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -1.202; TCGA BRCA -0.744; TCGA ESCA -0.866; TCGA KIRC -2.063; TCGA KIRP -0.946; TCGA LUAD -0.503; TCGA LUSC -0.701; TCGA PAAD -0.552; TCGA PRAD -0.147; TCGA SARC -0.857; TCGA STAD -0.661
hsa-miR-590-3p
DPYD
9 cancers: BLCA; BRCA; COAD; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.312; TCGA BRCA -0.192; TCGA COAD -0.476; TCGA LUAD -0.186; TCGA LUSC -0.431; TCGA PAAD -0.405; TCGA PRAD -0.261; TCGA STAD -0.244; TCGA UCEC -0.284
hsa-miR-590-3p
RIN2
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
miRanda
TCGA BLCA -0.112; TCGA BRCA -0.139; TCGA CESC -0.158; TCGA COAD -0.1; TCGA HNSC -0.079; TCGA LGG -0.088; TCGA LUAD -0.088; TCGA LUSC -0.232; TCGA PAAD -0.106; TCGA PRAD -0.174; TCGA THCA -0.092; TCGA UCEC -0.198
hsa-miR-590-3p
BMX
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.51; TCGA BRCA -0.675; TCGA CESC -0.308; TCGA COAD -0.592; TCGA ESCA -0.482; TCGA HNSC -0.248; TCGA LIHC -0.307; TCGA LUAD -0.536; TCGA LUSC -0.593; TCGA SARC -0.514; TCGA STAD -0.433; TCGA UCEC -0.209
hsa-miR-590-3p
RAMP2
9 cancers: BLCA; BRCA; COAD; HNSC; LIHC; LUAD; LUSC; STAD; UCEC
miRanda
TCGA BLCA -0.204; TCGA BRCA -0.284; TCGA COAD -0.294; TCGA HNSC -0.101; TCGA LIHC -0.368; TCGA LUAD -0.177; TCGA LUSC -0.411; TCGA STAD -0.203; TCGA UCEC -0.266
hsa-miR-590-3p
HYDIN
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.204; TCGA BRCA -0.175; TCGA CESC -0.376; TCGA COAD -0.458; TCGA ESCA -0.364; TCGA KIRC -0.371; TCGA LUAD -0.28; TCGA LUSC -0.403; TCGA PAAD -0.297; TCGA PRAD -0.156; TCGA SARC -0.479; TCGA THCA -0.219; TCGA STAD -0.494
hsa-miR-590-3p
ZNF280D
9 cancers: BLCA; BRCA; CESC; ESCA; KIRP; PAAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.148; TCGA BRCA -0.147; TCGA CESC -0.131; TCGA ESCA -0.065; TCGA KIRP -0.108; TCGA PAAD -0.067; TCGA SARC -0.211; TCGA STAD -0.242; TCGA UCEC -0.152
hsa-miR-590-3p
SMOC2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; PAAD; SARC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.845; TCGA BRCA -0.443; TCGA CESC -0.58; TCGA COAD -0.347; TCGA ESCA -0.663; TCGA HNSC -0.385; TCGA KIRC -0.285; TCGA LIHC -0.37; TCGA LUAD -0.315; TCGA PAAD -0.532; TCGA SARC -0.679; TCGA STAD -0.937; TCGA UCEC -0.595
hsa-miR-590-3p
C6
11 cancers: BLCA; BRCA; CESC; ESCA; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.512; TCGA BRCA -0.78; TCGA CESC -0.489; TCGA ESCA -0.61; TCGA LUAD -0.575; TCGA LUSC -0.829; TCGA PAAD -0.598; TCGA PRAD -0.369; TCGA SARC -0.301; TCGA STAD -0.354; TCGA UCEC -0.532
hsa-miR-590-3p
ENOX1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LIHC; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.423; TCGA BRCA -0.176; TCGA CESC -0.353; TCGA COAD -0.645; TCGA ESCA -0.443; TCGA KIRC -0.421; TCGA LGG -0.141; TCGA LIHC -0.436; TCGA LUSC -0.294; TCGA PAAD -0.294; TCGA STAD -0.553; TCGA UCEC -0.387
hsa-miR-590-3p
RGS2
9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LUSC; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.602; TCGA BRCA -0.154; TCGA COAD -0.338; TCGA ESCA -0.448; TCGA KIRC -0.161; TCGA LUSC -0.192; TCGA SARC -0.479; TCGA STAD -0.521; TCGA UCEC -0.447
hsa-miR-590-3p
KIAA0141
9 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC
miRanda; mirMAP
TCGA BLCA -0.078; TCGA BRCA -0.162; TCGA KIRC -0.059; TCGA KIRP -0.062; TCGA LGG -0.068; TCGA LIHC -0.073; TCGA LUAD -0.094; TCGA LUSC -0.112; TCGA SARC -0.062
hsa-miR-590-3p
SOS2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.116; TCGA BRCA -0.081; TCGA CESC -0.189; TCGA COAD -0.074; TCGA ESCA -0.153; TCGA HNSC -0.117; TCGA KIRC -0.229; TCGA KIRP -0.114; TCGA LGG -0.077; TCGA LUAD -0.075; TCGA LUSC -0.165; TCGA PRAD -0.136; TCGA SARC -0.125; TCGA THCA -0.069; TCGA STAD -0.193; TCGA UCEC -0.142
hsa-miR-590-3p
ANKRD44
9 cancers: BLCA; COAD; ESCA; KIRP; LUAD; LUSC; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.298; TCGA COAD -0.344; TCGA ESCA -0.219; TCGA KIRP -0.299; TCGA LUAD -0.164; TCGA LUSC -0.45; TCGA PRAD -0.205; TCGA SARC -0.206; TCGA STAD -0.15
hsa-miR-590-3p
STXBP4
12 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.165; TCGA CESC -0.184; TCGA COAD -0.093; TCGA ESCA -0.125; TCGA KIRC -0.313; TCGA KIRP -0.33; TCGA LUAD -0.107; TCGA PAAD -0.182; TCGA PRAD -0.214; TCGA SARC -0.3; TCGA THCA -0.141; TCGA STAD -0.217
hsa-miR-590-3p
SECISBP2L
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.189; TCGA BRCA -0.114; TCGA CESC -0.225; TCGA COAD -0.121; TCGA ESCA -0.122; TCGA HNSC -0.155; TCGA KIRC -0.238; TCGA KIRP -0.217; TCGA LUAD -0.183; TCGA LUSC -0.315; TCGA PAAD -0.109; TCGA PRAD -0.104; TCGA SARC -0.188; TCGA THCA -0.096; TCGA STAD -0.231; TCGA UCEC -0.161
hsa-miR-590-3p
AP1S2
9 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.203; TCGA CESC -0.144; TCGA COAD -0.296; TCGA ESCA -0.204; TCGA LUAD -0.092; TCGA LUSC -0.243; TCGA PRAD -0.108; TCGA STAD -0.499; TCGA UCEC -0.24
hsa-miR-590-3p
TMCO3
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; UCEC
miRanda
TCGA BLCA -0.083; TCGA BRCA -0.112; TCGA CESC -0.23; TCGA HNSC -0.121; TCGA KIRC -0.181; TCGA KIRP -0.205; TCGA LUAD -0.1; TCGA LUSC -0.174; TCGA PAAD -0.124; TCGA SARC -0.092; TCGA UCEC -0.127
hsa-miR-590-3p
CCDC6
10 cancers: BLCA; CESC; HNSC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.11; TCGA CESC -0.146; TCGA HNSC -0.094; TCGA KIRP -0.055; TCGA LGG -0.082; TCGA LUAD -0.064; TCGA PAAD -0.123; TCGA PRAD -0.091; TCGA SARC -0.221; TCGA STAD -0.128
hsa-miR-590-3p
CC2D2A
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.338; TCGA BRCA -0.244; TCGA CESC -0.236; TCGA COAD -0.461; TCGA ESCA -0.346; TCGA HNSC -0.137; TCGA KIRC -0.274; TCGA LGG -0.088; TCGA LUAD -0.181; TCGA LUSC -0.16; TCGA PAAD -0.327; TCGA PRAD -0.22; TCGA SARC -0.38; TCGA THCA -0.143; TCGA STAD -0.582; TCGA UCEC -0.281
hsa-miR-590-3p
PPP1R2P3
9 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; PAAD; PRAD; SARC
miRanda
TCGA BLCA -0.074; TCGA CESC -0.122; TCGA COAD -0.059; TCGA HNSC -0.087; TCGA KIRC -0.176; TCGA KIRP -0.22; TCGA PAAD -0.144; TCGA PRAD -0.14; TCGA SARC -0.157
hsa-miR-590-3p
SLCO3A1
9 cancers: BLCA; BRCA; COAD; KIRC; LIHC; LUAD; PAAD; PRAD; STAD
miRanda; mirMAP
TCGA BLCA -0.159; TCGA BRCA -0.127; TCGA COAD -0.14; TCGA KIRC -0.116; TCGA LIHC -0.22; TCGA LUAD -0.234; TCGA PAAD -0.201; TCGA PRAD -0.287; TCGA STAD -0.117
hsa-miR-590-3p
TPST1
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.25; TCGA BRCA -0.098; TCGA COAD -0.45; TCGA HNSC -0.123; TCGA KIRC -0.094; TCGA KIRP -0.09; TCGA PAAD -0.152; TCGA PRAD -0.094; TCGA STAD -0.218; TCGA UCEC -0.153
hsa-miR-590-3p
SGCG
9 cancers: BLCA; BRCA; HNSC; LGG; LUAD; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.611; TCGA BRCA -0.667; TCGA HNSC -0.593; TCGA LGG -0.183; TCGA LUAD -0.415; TCGA LUSC -0.414; TCGA PRAD -0.277; TCGA STAD -0.89; TCGA UCEC -0.274
hsa-miR-590-3p
SCAPER
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.21; TCGA BRCA -0.137; TCGA CESC -0.151; TCGA COAD -0.084; TCGA ESCA -0.101; TCGA HNSC -0.153; TCGA KIRC -0.222; TCGA KIRP -0.29; TCGA LGG -0.117; TCGA LUAD -0.132; TCGA LUSC -0.1; TCGA PRAD -0.146; TCGA SARC -0.306; TCGA THCA -0.106; TCGA STAD -0.203; TCGA UCEC -0.131
hsa-miR-590-3p
LPCAT2
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.183; TCGA BRCA -0.151; TCGA CESC -0.183; TCGA HNSC -0.181; TCGA KIRC -0.294; TCGA KIRP -0.455; TCGA LUAD -0.195; TCGA LUSC -0.184; TCGA PAAD -0.359; TCGA PRAD -0.32; TCGA THCA -0.137; TCGA STAD -0.217; TCGA UCEC -0.215
hsa-miR-590-3p
ATP7A
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.079; TCGA BRCA -0.119; TCGA CESC -0.131; TCGA COAD -0.102; TCGA ESCA -0.102; TCGA HNSC -0.131; TCGA KIRC -0.123; TCGA KIRP -0.212; TCGA LUAD -0.1; TCGA LUSC -0.073; TCGA PAAD -0.102; TCGA PRAD -0.067; TCGA THCA -0.092; TCGA STAD -0.115; TCGA UCEC -0.117
hsa-miR-590-3p
GUCY1B3
12 cancers: BLCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.184; TCGA CESC -0.247; TCGA COAD -0.59; TCGA ESCA -0.337; TCGA LGG -0.112; TCGA LUAD -0.089; TCGA LUSC -0.195; TCGA PAAD -0.247; TCGA PRAD -0.229; TCGA THCA -0.227; TCGA STAD -0.575; TCGA UCEC -0.155
hsa-miR-590-3p
SPRED1
11 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
miRanda; mirMAP
TCGA BLCA -0.204; TCGA BRCA -0.091; TCGA CESC -0.112; TCGA HNSC -0.095; TCGA KIRP -0.111; TCGA LUAD -0.205; TCGA LUSC -0.226; TCGA PAAD -0.254; TCGA PRAD -0.173; TCGA THCA -0.132; TCGA UCEC -0.237
hsa-miR-590-3p
DSEL
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.328; TCGA BRCA -0.412; TCGA CESC -0.311; TCGA COAD -0.609; TCGA ESCA -0.33; TCGA HNSC -0.31; TCGA LUAD -0.271; TCGA LUSC -0.343; TCGA PAAD -0.344; TCGA STAD -0.553; TCGA UCEC -0.473
hsa-miR-590-3p
ALDH6A1
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC; THCA; STAD
miRanda
TCGA BLCA -0.184; TCGA BRCA -0.288; TCGA CESC -0.203; TCGA ESCA -0.267; TCGA HNSC -0.114; TCGA KIRC -0.88; TCGA KIRP -0.495; TCGA LGG -0.142; TCGA LUAD -0.159; TCGA LUSC -0.137; TCGA SARC -0.217; TCGA THCA -0.178; TCGA STAD -0.185
hsa-miR-590-3p
TOR1AIP1
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.193; TCGA BRCA -0.115; TCGA CESC -0.153; TCGA COAD -0.146; TCGA ESCA -0.212; TCGA HNSC -0.097; TCGA KIRC -0.083; TCGA KIRP -0.216; TCGA LGG -0.089; TCGA LUAD -0.081; TCGA LUSC -0.18; TCGA PAAD -0.133; TCGA PRAD -0.184; TCGA SARC -0.328; TCGA THCA -0.061; TCGA STAD -0.286; TCGA UCEC -0.239
hsa-miR-590-3p
RIC3
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.489; TCGA BRCA -0.284; TCGA COAD -0.875; TCGA ESCA -0.454; TCGA KIRC -1.066; TCGA LGG -0.294; TCGA LUAD -0.249; TCGA PRAD -0.164; TCGA SARC -0.685; TCGA THCA -0.087; TCGA STAD -0.879; TCGA UCEC -0.604
hsa-miR-590-3p
MIA3
9 cancers: BLCA; CESC; ESCA; KIRP; LGG; LUAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.071; TCGA CESC -0.09; TCGA ESCA -0.079; TCGA KIRP -0.099; TCGA LGG -0.051; TCGA LUAD -0.107; TCGA SARC -0.135; TCGA STAD -0.067; TCGA UCEC -0.069
hsa-miR-590-3p
C1S
9 cancers: BLCA; BRCA; COAD; ESCA; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.413; TCGA BRCA -0.095; TCGA COAD -0.669; TCGA ESCA -0.304; TCGA LUSC -0.306; TCGA PAAD -0.454; TCGA PRAD -0.188; TCGA STAD -0.292; TCGA UCEC -0.2
hsa-miR-590-3p
HNMT
10 cancers: BLCA; BRCA; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.21; TCGA BRCA -0.258; TCGA LGG -0.13; TCGA LUAD -0.161; TCGA LUSC -0.339; TCGA PAAD -0.273; TCGA PRAD -0.12; TCGA SARC -0.171; TCGA STAD -0.118; TCGA UCEC -0.232
hsa-miR-590-3p
ZBTB8A
12 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.056; TCGA CESC -0.135; TCGA ESCA -0.135; TCGA KIRC -0.239; TCGA KIRP -0.127; TCGA LUSC -0.148; TCGA PAAD -0.202; TCGA PRAD -0.06; TCGA SARC -0.139; TCGA THCA -0.069; TCGA STAD -0.216; TCGA UCEC -0.082
hsa-miR-590-3p
AK5
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; STAD
miRanda; mirMAP
TCGA BLCA -0.215; TCGA BRCA -0.745; TCGA CESC -0.275; TCGA COAD -0.54; TCGA ESCA -0.407; TCGA HNSC -0.439; TCGA KIRC -0.506; TCGA KIRP -0.637; TCGA LUSC -0.307; TCGA STAD -0.627
hsa-miR-590-3p
BAHCC1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; LUAD; LUSC; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.19; TCGA BRCA -0.134; TCGA CESC -0.231; TCGA COAD -0.224; TCGA ESCA -0.234; TCGA KIRP -0.373; TCGA LGG -0.058; TCGA LUAD -0.223; TCGA LUSC -0.152; TCGA SARC -0.31; TCGA STAD -0.246; TCGA UCEC -0.336
hsa-miR-590-3p
INPP5F
9 cancers: BLCA; COAD; ESCA; KIRC; KIRP; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.118; TCGA COAD -0.071; TCGA ESCA -0.114; TCGA KIRC -0.129; TCGA KIRP -0.213; TCGA PRAD -0.148; TCGA THCA -0.096; TCGA STAD -0.234; TCGA UCEC -0.169
hsa-miR-590-3p
BOC
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.725; TCGA BRCA -0.283; TCGA CESC -0.388; TCGA COAD -0.807; TCGA ESCA -0.723; TCGA HNSC -0.275; TCGA KIRC -0.188; TCGA KIRP -0.223; TCGA LGG -0.085; TCGA LIHC -0.37; TCGA LUAD -0.182; TCGA LUSC -0.305; TCGA PAAD -0.407; TCGA PRAD -0.226; TCGA SARC -0.615; TCGA STAD -0.899; TCGA UCEC -0.473
hsa-miR-590-3p
PCDHA3
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; UCEC
miRanda; mirMAP
TCGA BLCA -0.503; TCGA BRCA -0.41; TCGA CESC -0.317; TCGA COAD -0.623; TCGA ESCA -0.43; TCGA KIRC -0.4; TCGA KIRP -0.395; TCGA LUAD -0.198; TCGA LUSC -0.535; TCGA UCEC -0.573
hsa-miR-590-3p
CYP46A1
9 cancers: BLCA; BRCA; CESC; LGG; LUAD; LUSC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.324; TCGA BRCA -0.368; TCGA CESC -0.299; TCGA LGG -0.142; TCGA LUAD -0.178; TCGA LUSC -0.18; TCGA THCA -0.147; TCGA STAD -0.449; TCGA UCEC -0.239
hsa-miR-590-3p
EHBP1
9 cancers: BLCA; CESC; COAD; KIRP; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.069; TCGA CESC -0.12; TCGA COAD -0.11; TCGA KIRP -0.225; TCGA PAAD -0.183; TCGA PRAD -0.099; TCGA SARC -0.214; TCGA STAD -0.311; TCGA UCEC -0.23
hsa-miR-590-3p
CDO1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.802; TCGA BRCA -0.655; TCGA CESC -0.53; TCGA COAD -0.935; TCGA ESCA -0.552; TCGA HNSC -0.463; TCGA KIRC -0.918; TCGA LUAD -0.441; TCGA LUSC -0.772; TCGA PRAD -0.403; TCGA STAD -0.862; TCGA UCEC -0.737
hsa-miR-590-3p
DOK6
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.741; TCGA BRCA -0.333; TCGA CESC -0.557; TCGA COAD -0.626; TCGA ESCA -0.265; TCGA HNSC -0.389; TCGA LGG -0.466; TCGA LUAD -0.367; TCGA LUSC -0.509; TCGA PAAD -0.375; TCGA PRAD -0.318; TCGA SARC -0.311; TCGA STAD -0.553; TCGA UCEC -0.36
hsa-miR-590-3p
SORT1
13 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.156; TCGA CESC -0.329; TCGA HNSC -0.286; TCGA KIRC -0.538; TCGA KIRP -0.202; TCGA LIHC -0.218; TCGA LUAD -0.158; TCGA LUSC -0.208; TCGA PAAD -0.143; TCGA PRAD -0.155; TCGA SARC -0.298; TCGA THCA -0.091; TCGA STAD -0.186
hsa-miR-590-3p
HIF3A
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.778; TCGA BRCA -0.498; TCGA CESC -0.332; TCGA COAD -0.355; TCGA ESCA -0.774; TCGA KIRC -0.284; TCGA LGG -0.258; TCGA PRAD -0.483; TCGA SARC -0.658; TCGA STAD -0.988; TCGA UCEC -0.678
hsa-miR-590-3p
PPP3CB
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.161; TCGA BRCA -0.082; TCGA CESC -0.068; TCGA COAD -0.051; TCGA ESCA -0.098; TCGA KIRC -0.122; TCGA KIRP -0.088; TCGA LGG -0.139; TCGA LUSC -0.067; TCGA PRAD -0.115; TCGA SARC -0.06; TCGA STAD -0.262; TCGA UCEC -0.165
hsa-miR-590-3p
PRKG1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.761; TCGA BRCA -0.432; TCGA CESC -0.693; TCGA COAD -0.699; TCGA ESCA -0.453; TCGA HNSC -0.541; TCGA KIRC -0.353; TCGA KIRP -0.709; TCGA LUAD -0.41; TCGA LUSC -0.778; TCGA PAAD -0.684; TCGA PRAD -0.708; TCGA SARC -0.57; TCGA THCA -0.297; TCGA STAD -0.683; TCGA UCEC -0.682
hsa-miR-590-3p
DNAL1
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.061; TCGA BRCA -0.202; TCGA CESC -0.159; TCGA ESCA -0.184; TCGA KIRC -0.237; TCGA KIRP -0.121; TCGA LUAD -0.09; TCGA LUSC -0.185; TCGA THCA -0.092; TCGA STAD -0.195; TCGA UCEC -0.089
hsa-miR-590-3p
AMOTL2
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.268; TCGA BRCA -0.259; TCGA COAD -0.167; TCGA HNSC -0.092; TCGA KIRC -0.17; TCGA KIRP -0.13; TCGA LGG -0.162; TCGA LUSC -0.277; TCGA PAAD -0.301; TCGA PRAD -0.212; TCGA THCA -0.076; TCGA STAD -0.133; TCGA UCEC -0.22
hsa-miR-590-3p
FCHO2
11 cancers: BLCA; BRCA; CESC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.099; TCGA BRCA -0.161; TCGA CESC -0.181; TCGA LUAD -0.161; TCGA LUSC -0.275; TCGA PAAD -0.191; TCGA PRAD -0.124; TCGA SARC -0.116; TCGA THCA -0.101; TCGA STAD -0.15; TCGA UCEC -0.123
hsa-miR-590-3p
PPP2CB
11 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.094; TCGA BRCA -0.105; TCGA CESC -0.129; TCGA KIRC -0.148; TCGA KIRP -0.086; TCGA LUAD -0.115; TCGA LUSC -0.123; TCGA PAAD -0.097; TCGA PRAD -0.095; TCGA STAD -0.089; TCGA UCEC -0.155
hsa-miR-590-3p
COL16A1
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.464; TCGA BRCA -0.333; TCGA COAD -0.373; TCGA ESCA -0.194; TCGA KIRC -0.205; TCGA LUAD -0.12; TCGA LUSC -0.214; TCGA PAAD -0.194; TCGA STAD -0.37; TCGA UCEC -0.394
hsa-miR-590-3p
OSBPL1A
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.255; TCGA BRCA -0.125; TCGA CESC -0.149; TCGA ESCA -0.289; TCGA HNSC -0.145; TCGA KIRC -0.089; TCGA LUSC -0.113; TCGA PAAD -0.135; TCGA PRAD -0.146; TCGA SARC -0.145; TCGA STAD -0.411; TCGA UCEC -0.392
hsa-miR-590-3p
SV2B
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; LUAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.451; TCGA BRCA -0.265; TCGA COAD -0.826; TCGA ESCA -0.491; TCGA KIRC -0.422; TCGA LGG -0.24; TCGA LUAD -0.224; TCGA PRAD -0.296; TCGA STAD -0.581; TCGA UCEC -0.495
hsa-miR-590-3p
SEPT10
14 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.119; TCGA BRCA -0.14; TCGA ESCA -0.114; TCGA HNSC -0.077; TCGA KIRC -0.104; TCGA KIRP -0.28; TCGA LUAD -0.064; TCGA LUSC -0.121; TCGA PAAD -0.251; TCGA PRAD -0.189; TCGA SARC -0.232; TCGA THCA -0.072; TCGA STAD -0.218; TCGA UCEC -0.294
hsa-miR-590-3p
KDR
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
miRanda
TCGA BLCA -0.189; TCGA BRCA -0.165; TCGA CESC -0.291; TCGA COAD -0.317; TCGA HNSC -0.17; TCGA KIRP -0.356; TCGA LUAD -0.242; TCGA LUSC -0.516; TCGA PAAD -0.183; TCGA PRAD -0.179; TCGA THCA -0.235; TCGA UCEC -0.418
hsa-miR-590-3p
TBC1D19
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.153; TCGA BRCA -0.15; TCGA CESC -0.141; TCGA COAD -0.207; TCGA ESCA -0.134; TCGA KIRC -0.228; TCGA KIRP -0.132; TCGA LUAD -0.075; TCGA PAAD -0.125; TCGA PRAD -0.112; TCGA THCA -0.063; TCGA STAD -0.256; TCGA UCEC -0.163
hsa-miR-590-3p
CERK
9 cancers: BLCA; CESC; COAD; KIRC; KIRP; LIHC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.182; TCGA CESC -0.1; TCGA COAD -0.121; TCGA KIRC -0.135; TCGA KIRP -0.149; TCGA LIHC -0.139; TCGA PRAD -0.12; TCGA STAD -0.221; TCGA UCEC -0.201
hsa-miR-590-3p
ITPR2
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; STAD
miRanda
TCGA BLCA -0.08; TCGA BRCA -0.123; TCGA COAD -0.216; TCGA HNSC -0.17; TCGA KIRC -0.444; TCGA KIRP -0.263; TCGA LUAD -0.25; TCGA LUSC -0.288; TCGA PRAD -0.183; TCGA THCA -0.126; TCGA STAD -0.116
hsa-miR-590-3p
PLCB4
10 cancers: BLCA; COAD; ESCA; KIRP; LGG; LIHC; LUAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.613; TCGA COAD -0.217; TCGA ESCA -0.348; TCGA KIRP -0.547; TCGA LGG -0.094; TCGA LIHC -0.406; TCGA LUAD -0.349; TCGA SARC -0.72; TCGA THCA -0.173; TCGA STAD -0.266
hsa-miR-590-3p
SOSTDC1
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUAD; LUSC; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.275; TCGA BRCA -0.228; TCGA COAD -0.399; TCGA HNSC -0.66; TCGA KIRC -1.514; TCGA LUAD -0.596; TCGA LUSC -0.37; TCGA PRAD -0.479; TCGA STAD -0.408; TCGA UCEC -0.294
hsa-miR-590-3p
USP12
12 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.209; TCGA CESC -0.253; TCGA COAD -0.125; TCGA ESCA -0.174; TCGA KIRC -0.284; TCGA KIRP -0.529; TCGA LUAD -0.119; TCGA LUSC -0.193; TCGA PRAD -0.29; TCGA SARC -0.348; TCGA STAD -0.224; TCGA UCEC -0.14
hsa-miR-590-3p
SYDE2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.288; TCGA BRCA -0.157; TCGA CESC -0.302; TCGA COAD -0.126; TCGA ESCA -0.269; TCGA KIRC -0.393; TCGA KIRP -0.283; TCGA LGG -0.169; TCGA PRAD -0.217; TCGA SARC -0.444; TCGA STAD -0.568; TCGA UCEC -0.127
hsa-miR-590-3p
WDR17
13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.405; TCGA BRCA -0.368; TCGA COAD -0.586; TCGA ESCA -0.465; TCGA KIRC -0.282; TCGA KIRP -0.189; TCGA LGG -0.169; TCGA LUAD -0.29; TCGA LUSC -0.509; TCGA PRAD -0.264; TCGA SARC -0.289; TCGA STAD -0.933; TCGA UCEC -0.699
hsa-miR-590-3p
FBXO38
11 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LGG; LUAD; LUSC; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.065; TCGA BRCA -0.123; TCGA CESC -0.082; TCGA ESCA -0.067; TCGA KIRP -0.094; TCGA LGG -0.053; TCGA LUAD -0.135; TCGA LUSC -0.115; TCGA SARC -0.124; TCGA STAD -0.06; TCGA UCEC -0.072
hsa-miR-590-3p
RHOBTB3
11 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LUSC; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.255; TCGA BRCA -0.132; TCGA CESC -0.29; TCGA KIRC -0.516; TCGA KIRP -0.459; TCGA LGG -0.061; TCGA LUSC -0.23; TCGA PRAD -0.119; TCGA THCA -0.226; TCGA STAD -0.348; TCGA UCEC -0.274
hsa-miR-590-3p
PRDM8
9 cancers: BLCA; BRCA; CESC; ESCA; LGG; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.427; TCGA BRCA -0.224; TCGA CESC -0.287; TCGA ESCA -0.336; TCGA LGG -0.259; TCGA PAAD -0.287; TCGA PRAD -0.585; TCGA STAD -0.496; TCGA UCEC -0.533
hsa-miR-590-3p
FAM124B
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.401; TCGA BRCA -0.289; TCGA COAD -0.534; TCGA ESCA -0.276; TCGA HNSC -0.287; TCGA LIHC -0.357; TCGA LUAD -0.188; TCGA LUSC -0.519; TCGA PAAD -0.195; TCGA THCA -0.179; TCGA STAD -0.39; TCGA UCEC -0.413
hsa-miR-590-3p
ST6GALNAC3
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.345; TCGA BRCA -0.236; TCGA CESC -0.288; TCGA COAD -0.271; TCGA HNSC -0.177; TCGA KIRC -0.396; TCGA KIRP -0.467; TCGA LUSC -0.393; TCGA PRAD -0.127; TCGA SARC -0.212; TCGA STAD -0.308; TCGA UCEC -0.449
hsa-miR-590-3p
TNS1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.91; TCGA BRCA -0.498; TCGA CESC -0.252; TCGA COAD -0.805; TCGA ESCA -0.771; TCGA HNSC -0.307; TCGA KIRC -0.089; TCGA KIRP -0.191; TCGA LUAD -0.415; TCGA LUSC -0.608; TCGA PAAD -0.404; TCGA PRAD -0.536; TCGA SARC -0.676; TCGA THCA -0.109; TCGA STAD -0.956; TCGA UCEC -0.451
hsa-miR-590-3p
GRIN2A
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.557; TCGA BRCA -0.384; TCGA CESC -0.423; TCGA COAD -0.724; TCGA ESCA -0.963; TCGA LIHC -0.47; TCGA LUAD -0.735; TCGA LUSC -0.691; TCGA PAAD -0.374; TCGA PRAD -0.579; TCGA SARC -1.045; TCGA STAD -1.121; TCGA UCEC -0.459
hsa-miR-590-3p
AKAP12
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.406; TCGA BRCA -0.589; TCGA CESC -0.471; TCGA COAD -0.787; TCGA ESCA -0.464; TCGA HNSC -0.332; TCGA LUSC -0.618; TCGA PAAD -0.336; TCGA PRAD -0.121; TCGA SARC -0.266; TCGA THCA -0.163; TCGA STAD -0.822; TCGA UCEC -0.463
hsa-miR-590-3p
ISM1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.5; TCGA BRCA -0.508; TCGA CESC -0.317; TCGA COAD -0.993; TCGA ESCA -0.531; TCGA HNSC -0.36; TCGA LGG -0.287; TCGA LUAD -0.407; TCGA LUSC -0.53; TCGA PAAD -0.747; TCGA PRAD -0.274; TCGA STAD -0.914
hsa-miR-590-3p
GNAZ
10 cancers: BLCA; CESC; ESCA; KIRC; LGG; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.437; TCGA CESC -0.296; TCGA ESCA -0.393; TCGA KIRC -0.131; TCGA LGG -0.097; TCGA LUAD -0.265; TCGA PRAD -0.362; TCGA SARC -0.628; TCGA STAD -0.606; TCGA UCEC -0.36
hsa-miR-590-3p
SORCS1
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.88; TCGA BRCA -0.786; TCGA COAD -1.19; TCGA ESCA -0.985; TCGA HNSC -0.271; TCGA KIRC -0.421; TCGA LUAD -0.274; TCGA PRAD -0.479; TCGA STAD -1.166; TCGA UCEC -0.544
hsa-miR-590-3p
KLHL4
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.552; TCGA BRCA -0.416; TCGA COAD -0.787; TCGA ESCA -0.497; TCGA HNSC -0.367; TCGA LUAD -0.202; TCGA LUSC -0.651; TCGA PAAD -0.52; TCGA PRAD -0.597; TCGA SARC -0.322; TCGA STAD -0.781; TCGA UCEC -0.846
hsa-miR-590-3p
TMEM25
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.121; TCGA BRCA -0.218; TCGA CESC -0.125; TCGA COAD -0.323; TCGA ESCA -0.299; TCGA KIRC -0.614; TCGA KIRP -0.194; TCGA SARC -0.442; TCGA THCA -0.083; TCGA STAD -0.38
hsa-miR-590-3p
STOM
10 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.284; TCGA BRCA -0.146; TCGA COAD -0.273; TCGA ESCA -0.21; TCGA LUAD -0.115; TCGA LUSC -0.273; TCGA PRAD -0.224; TCGA SARC -0.125; TCGA STAD -0.431; TCGA UCEC -0.207
hsa-miR-590-3p
ZNF667
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.27; TCGA BRCA -0.13; TCGA CESC -0.607; TCGA COAD -0.657; TCGA ESCA -0.32; TCGA HNSC -0.197; TCGA KIRC -0.628; TCGA KIRP -0.778; TCGA SARC -0.507; TCGA THCA -0.168; TCGA STAD -0.744; TCGA UCEC -0.367
hsa-miR-590-3p
PNRC1
9 cancers: BLCA; COAD; ESCA; HNSC; KIRP; LUSC; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.169; TCGA COAD -0.07; TCGA ESCA -0.115; TCGA HNSC -0.094; TCGA KIRP -0.101; TCGA LUSC -0.138; TCGA SARC -0.15; TCGA STAD -0.192; TCGA UCEC -0.212
hsa-miR-590-3p
LDB1
10 cancers: BLCA; COAD; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.064; TCGA COAD -0.081; TCGA KIRC -0.064; TCGA KIRP -0.182; TCGA LGG -0.104; TCGA LUAD -0.071; TCGA PRAD -0.103; TCGA SARC -0.159; TCGA THCA -0.077; TCGA STAD -0.142
hsa-miR-590-3p
MBD5
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.244; TCGA BRCA -0.099; TCGA CESC -0.152; TCGA COAD -0.146; TCGA ESCA -0.215; TCGA HNSC -0.095; TCGA KIRC -0.092; TCGA KIRP -0.196; TCGA LGG -0.129; TCGA LUSC -0.164; TCGA PAAD -0.122; TCGA PRAD -0.211; TCGA SARC -0.276; TCGA THCA -0.059; TCGA STAD -0.275; TCGA UCEC -0.126
hsa-miR-590-3p
TMEM100
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.764; TCGA BRCA -0.534; TCGA COAD -0.775; TCGA ESCA -0.747; TCGA HNSC -0.386; TCGA LGG -0.63; TCGA LUAD -0.502; TCGA LUSC -0.778; TCGA PAAD -0.263; TCGA SARC -0.291; TCGA STAD -0.98; TCGA UCEC -0.442
hsa-miR-590-3p
FAM198B
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.322; TCGA BRCA -0.467; TCGA CESC -0.28; TCGA COAD -0.385; TCGA ESCA -0.31; TCGA HNSC -0.309; TCGA LUSC -0.531; TCGA PAAD -0.376; TCGA PRAD -0.129; TCGA THCA -0.136; TCGA STAD -0.303; TCGA UCEC -0.386
hsa-miR-590-3p
PPP1R3B
11 cancers: BLCA; BRCA; COAD; HNSC; KIRP; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.259; TCGA BRCA -0.175; TCGA COAD -0.102; TCGA HNSC -0.222; TCGA KIRP -0.188; TCGA LUSC -0.114; TCGA PRAD -0.111; TCGA SARC -0.554; TCGA THCA -0.121; TCGA STAD -0.146; TCGA UCEC -0.149
hsa-miR-590-3p
TMEM55A
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUSC; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.223; TCGA BRCA -0.092; TCGA COAD -0.193; TCGA ESCA -0.141; TCGA KIRC -0.158; TCGA KIRP -0.283; TCGA LGG -0.068; TCGA LUSC -0.204; TCGA PAAD -0.117; TCGA SARC -0.13; TCGA STAD -0.528; TCGA UCEC -0.36
hsa-miR-590-3p
S1PR1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.404; TCGA BRCA -0.34; TCGA CESC -0.212; TCGA COAD -0.424; TCGA ESCA -0.241; TCGA HNSC -0.159; TCGA KIRP -0.173; TCGA LUAD -0.234; TCGA LUSC -0.662; TCGA SARC -0.183; TCGA THCA -0.089; TCGA STAD -0.352; TCGA UCEC -0.384
hsa-miR-590-3p
SGCE
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.367; TCGA BRCA -0.113; TCGA CESC -0.52; TCGA COAD -0.55; TCGA ESCA -0.217; TCGA HNSC -0.217; TCGA LUSC -0.204; TCGA PAAD -0.157; TCGA PRAD -0.204; TCGA THCA -0.12; TCGA STAD -0.482; TCGA UCEC -0.347
hsa-miR-590-3p
RSPO1
11 cancers: BLCA; BRCA; CESC; COAD; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.57; TCGA BRCA -0.474; TCGA CESC -0.382; TCGA COAD -0.579; TCGA LUAD -0.557; TCGA LUSC -0.958; TCGA PAAD -0.516; TCGA PRAD -0.298; TCGA SARC -0.66; TCGA STAD -0.83; TCGA UCEC -0.92
hsa-miR-590-3p
THBS1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.504; TCGA BRCA -0.175; TCGA CESC -0.305; TCGA COAD -0.426; TCGA ESCA -0.453; TCGA HNSC -0.203; TCGA KIRC -0.199; TCGA KIRP -0.374; TCGA LUAD -0.19; TCGA LUSC -0.573; TCGA PAAD -0.609; TCGA PRAD -0.264; TCGA SARC -0.237; TCGA STAD -0.475; TCGA UCEC -0.412
hsa-miR-590-3p
PTGER2
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUSC; PAAD; PRAD; UCEC
miRanda
TCGA BLCA -0.25; TCGA BRCA -0.165; TCGA CESC -0.411; TCGA ESCA -0.396; TCGA KIRC -0.154; TCGA KIRP -0.425; TCGA LUSC -0.526; TCGA PAAD -0.228; TCGA PRAD -0.31; TCGA UCEC -0.309
hsa-miR-590-3p
PRKAB2
12 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.148; TCGA COAD -0.092; TCGA ESCA -0.217; TCGA HNSC -0.165; TCGA KIRC -0.149; TCGA KIRP -0.144; TCGA LGG -0.102; TCGA PAAD -0.126; TCGA PRAD -0.054; TCGA SARC -0.252; TCGA STAD -0.35; TCGA UCEC -0.245
hsa-miR-590-3p
DCLK1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; PRAD; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.551; TCGA BRCA -0.414; TCGA CESC -0.511; TCGA COAD -0.926; TCGA ESCA -0.477; TCGA HNSC -0.507; TCGA LIHC -0.365; TCGA PRAD -0.48; TCGA STAD -0.818; TCGA UCEC -0.607
hsa-miR-590-3p
NFE2L1
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.085; TCGA BRCA -0.084; TCGA ESCA -0.105; TCGA HNSC -0.122; TCGA KIRC -0.078; TCGA LUAD -0.057; TCGA PRAD -0.092; TCGA SARC -0.1; TCGA THCA -0.07; TCGA STAD -0.06; TCGA UCEC -0.109
hsa-miR-590-3p
GNAQ
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.154; TCGA BRCA -0.11; TCGA CESC -0.106; TCGA ESCA -0.141; TCGA HNSC -0.056; TCGA KIRC -0.088; TCGA KIRP -0.076; TCGA LUAD -0.169; TCGA LUSC -0.244; TCGA PAAD -0.13; TCGA PRAD -0.064; TCGA SARC -0.136; TCGA THCA -0.121; TCGA STAD -0.169; TCGA UCEC -0.099
hsa-miR-590-3p
CADM1
10 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.237; TCGA COAD -0.642; TCGA HNSC -0.204; TCGA KIRC -0.361; TCGA KIRP -0.334; TCGA LGG -0.062; TCGA LUAD -0.279; TCGA LUSC -0.565; TCGA THCA -0.19; TCGA STAD -0.303
hsa-miR-590-3p
PLA2G5
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUSC; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.84; TCGA BRCA -0.26; TCGA COAD -0.845; TCGA ESCA -0.733; TCGA HNSC -0.272; TCGA LIHC -0.266; TCGA LUSC -0.645; TCGA PRAD -0.13; TCGA STAD -0.736; TCGA UCEC -0.25
hsa-miR-590-3p
PLEKHH2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.191; TCGA BRCA -0.394; TCGA CESC -0.54; TCGA COAD -0.544; TCGA ESCA -0.213; TCGA KIRC -0.395; TCGA LGG -0.131; TCGA LUAD -0.321; TCGA LUSC -0.464; TCGA PAAD -0.19; TCGA PRAD -0.258; TCGA SARC -0.464; TCGA STAD -0.562; TCGA UCEC -0.446
hsa-miR-590-3p
CRYBG3
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.177; TCGA BRCA -0.21; TCGA CESC -0.265; TCGA COAD -0.117; TCGA ESCA -0.229; TCGA HNSC -0.148; TCGA KIRC -0.269; TCGA KIRP -0.354; TCGA LUAD -0.085; TCGA LUSC -0.145; TCGA PAAD -0.19; TCGA PRAD -0.229; TCGA SARC -0.186; TCGA THCA -0.168; TCGA STAD -0.319; TCGA UCEC -0.311
hsa-miR-590-3p
GNA14
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.37; TCGA BRCA -0.238; TCGA CESC -0.567; TCGA ESCA -0.303; TCGA KIRC -0.433; TCGA LUAD -0.13; TCGA LUSC -0.445; TCGA PRAD -0.168; TCGA SARC -0.627; TCGA STAD -0.358; TCGA UCEC -0.417
hsa-miR-590-3p
LIX1L
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.28; TCGA BRCA -0.075; TCGA CESC -0.151; TCGA COAD -0.274; TCGA ESCA -0.185; TCGA LGG -0.136; TCGA LUAD -0.115; TCGA LUSC -0.154; TCGA PRAD -0.069; TCGA SARC -0.065; TCGA STAD -0.474; TCGA UCEC -0.25
hsa-miR-590-3p
OCRL
10 cancers: BLCA; ESCA; HNSC; KIRC; KIRP; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.093; TCGA ESCA -0.155; TCGA HNSC -0.085; TCGA KIRC -0.056; TCGA KIRP -0.102; TCGA PRAD -0.053; TCGA SARC -0.238; TCGA THCA -0.132; TCGA STAD -0.208; TCGA UCEC -0.139
hsa-miR-590-3p
ZNF354C
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.296; TCGA BRCA -0.151; TCGA CESC -0.269; TCGA COAD -0.62; TCGA ESCA -0.315; TCGA KIRC -0.281; TCGA KIRP -0.487; TCGA LGG -0.161; TCGA LUAD -0.181; TCGA LUSC -0.217; TCGA PAAD -0.386; TCGA PRAD -0.329; TCGA SARC -0.359; TCGA STAD -0.616; TCGA UCEC -0.444
hsa-miR-590-3p
ALKBH8
9 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUSC; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.054; TCGA BRCA -0.065; TCGA CESC -0.109; TCGA KIRC -0.068; TCGA KIRP -0.112; TCGA LUSC -0.068; TCGA SARC -0.065; TCGA STAD -0.073; TCGA UCEC -0.158
hsa-miR-590-3p
ATL1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.275; TCGA BRCA -0.09; TCGA CESC -0.206; TCGA COAD -0.303; TCGA ESCA -0.364; TCGA HNSC -0.277; TCGA KIRC -0.206; TCGA LGG -0.096; TCGA LUAD -0.093; TCGA LUSC -0.202; TCGA PAAD -0.157; TCGA PRAD -0.063; TCGA SARC -0.403; TCGA STAD -0.394; TCGA UCEC -0.244
hsa-miR-590-3p
PCP4
10 cancers: BLCA; CESC; COAD; ESCA; KIRC; LIHC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -1.662; TCGA CESC -0.762; TCGA COAD -1.211; TCGA ESCA -0.994; TCGA KIRC -1.801; TCGA LIHC -0.381; TCGA PRAD -0.526; TCGA SARC -1.771; TCGA STAD -1.224; TCGA UCEC -0.761
hsa-miR-590-3p
ZC3H7A
10 cancers: BLCA; BRCA; CESC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.066; TCGA BRCA -0.057; TCGA CESC -0.075; TCGA KIRP -0.089; TCGA LUAD -0.079; TCGA LUSC -0.093; TCGA PRAD -0.071; TCGA SARC -0.11; TCGA STAD -0.126; TCGA UCEC -0.069
hsa-miR-590-3p
CNTN1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -1.09; TCGA BRCA -0.605; TCGA CESC -0.776; TCGA COAD -1.21; TCGA ESCA -0.819; TCGA HNSC -0.498; TCGA KIRC -1.774; TCGA KIRP -0.569; TCGA LGG -0.195; TCGA LUAD -0.413; TCGA PAAD -0.448; TCGA PRAD -0.618; TCGA STAD -1.412; TCGA UCEC -0.381
hsa-miR-590-3p
SLK
14 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.075; TCGA BRCA -0.093; TCGA CESC -0.107; TCGA HNSC -0.096; TCGA KIRC -0.188; TCGA KIRP -0.263; TCGA LUAD -0.069; TCGA LUSC -0.081; TCGA PAAD -0.225; TCGA PRAD -0.107; TCGA SARC -0.094; TCGA THCA -0.085; TCGA STAD -0.159; TCGA UCEC -0.143
hsa-miR-590-3p
PID1
12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.615; TCGA BRCA -0.359; TCGA COAD -0.216; TCGA HNSC -0.287; TCGA KIRC -0.334; TCGA LGG -0.452; TCGA LUAD -0.353; TCGA LUSC -0.41; TCGA PAAD -0.26; TCGA SARC -0.319; TCGA STAD -0.54; TCGA UCEC -0.69
hsa-miR-590-3p
EMCN
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.42; TCGA BRCA -0.409; TCGA CESC -0.396; TCGA COAD -0.454; TCGA ESCA -0.239; TCGA HNSC -0.179; TCGA KIRC -0.581; TCGA LIHC -0.395; TCGA LUAD -0.317; TCGA LUSC -0.684; TCGA PRAD -0.127; TCGA SARC -0.19; TCGA STAD -0.405; TCGA UCEC -0.639
hsa-miR-590-3p
ROR2
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.552; TCGA BRCA -0.145; TCGA COAD -0.627; TCGA ESCA -0.359; TCGA HNSC -0.234; TCGA KIRC -0.265; TCGA KIRP -0.561; TCGA LUSC -0.271; TCGA PAAD -0.402; TCGA PRAD -0.523; TCGA SARC -0.548; TCGA STAD -0.699; TCGA UCEC -0.28
hsa-miR-590-3p
HCFC2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.17; TCGA BRCA -0.115; TCGA CESC -0.147; TCGA COAD -0.224; TCGA ESCA -0.156; TCGA HNSC -0.08; TCGA KIRC -0.079; TCGA KIRP -0.125; TCGA LGG -0.11; TCGA LUAD -0.053; TCGA LUSC -0.204; TCGA PRAD -0.145; TCGA SARC -0.182; TCGA THCA -0.076; TCGA STAD -0.375; TCGA UCEC -0.184
hsa-miR-590-3p
NBEA
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.665; TCGA BRCA -0.463; TCGA CESC -0.753; TCGA COAD -0.749; TCGA ESCA -0.715; TCGA KIRC -0.285; TCGA KIRP -0.36; TCGA LGG -0.224; TCGA LUAD -0.286; TCGA PRAD -0.278; TCGA SARC -0.615; TCGA THCA -0.124; TCGA STAD -0.996; TCGA UCEC -0.581
hsa-miR-590-3p
JAM2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.652; TCGA BRCA -0.427; TCGA CESC -0.402; TCGA COAD -0.733; TCGA ESCA -0.564; TCGA HNSC -0.287; TCGA KIRC -0.345; TCGA LIHC -0.515; TCGA LUAD -0.266; TCGA LUSC -0.659; TCGA PAAD -0.281; TCGA PRAD -0.191; TCGA SARC -0.164; TCGA THCA -0.104; TCGA STAD -0.706; TCGA UCEC -0.512
hsa-miR-590-3p
STK32B
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.471; TCGA BRCA -0.638; TCGA CESC -0.432; TCGA COAD -0.456; TCGA ESCA -0.327; TCGA HNSC -0.275; TCGA KIRC -0.219; TCGA LUAD -0.317; TCGA PAAD -0.314; TCGA PRAD -0.196; TCGA STAD -0.207; TCGA UCEC -0.395
hsa-miR-590-3p
EGR1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.427; TCGA BRCA -0.577; TCGA CESC -0.262; TCGA COAD -0.163; TCGA ESCA -0.245; TCGA KIRC -0.429; TCGA KIRP -0.307; TCGA LUAD -0.334; TCGA LUSC -0.462; TCGA PAAD -0.297; TCGA PRAD -0.333; TCGA STAD -0.329; TCGA UCEC -0.324
hsa-miR-590-3p
ZEB1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.564; TCGA BRCA -0.345; TCGA CESC -0.317; TCGA COAD -0.624; TCGA ESCA -0.442; TCGA HNSC -0.214; TCGA KIRP -0.199; TCGA LGG -0.21; TCGA LUAD -0.179; TCGA LUSC -0.445; TCGA PAAD -0.377; TCGA PRAD -0.298; TCGA SARC -0.15; TCGA STAD -0.705; TCGA UCEC -0.437
hsa-miR-590-3p
OBSL1
10 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; SARC; STAD
miRanda
TCGA BLCA -0.165; TCGA COAD -0.472; TCGA HNSC -0.246; TCGA KIRC -0.248; TCGA KIRP -0.184; TCGA LGG -0.158; TCGA LIHC -0.442; TCGA LUAD -0.217; TCGA SARC -0.26; TCGA STAD -0.529
hsa-miR-590-3p
FBXO3
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.07; TCGA BRCA -0.105; TCGA CESC -0.205; TCGA COAD -0.071; TCGA ESCA -0.11; TCGA HNSC -0.102; TCGA KIRC -0.197; TCGA KIRP -0.165; TCGA LGG -0.135; TCGA LUAD -0.092; TCGA LUSC -0.1; TCGA PAAD -0.117; TCGA PRAD -0.1; TCGA SARC -0.206; TCGA THCA -0.079; TCGA STAD -0.161; TCGA UCEC -0.166
hsa-miR-590-3p
DAB2
9 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.193; TCGA BRCA -0.191; TCGA COAD -0.217; TCGA HNSC -0.22; TCGA LUAD -0.226; TCGA LUSC -0.525; TCGA PAAD -0.31; TCGA STAD -0.184; TCGA UCEC -0.226
hsa-miR-590-3p
TRIM58
9 cancers: BLCA; BRCA; CESC; COAD; KIRC; LUAD; LUSC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.242; TCGA BRCA -0.52; TCGA CESC -0.36; TCGA COAD -0.359; TCGA KIRC -0.218; TCGA LUAD -0.329; TCGA LUSC -0.662; TCGA STAD -0.462; TCGA UCEC -0.331
hsa-miR-590-3p
PMEPA1
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; THCA; UCEC
miRanda; mirMAP
TCGA BLCA -0.187; TCGA BRCA -0.078; TCGA CESC -0.295; TCGA COAD -0.395; TCGA HNSC -0.238; TCGA KIRP -0.175; TCGA LUAD -0.108; TCGA LUSC -0.512; TCGA PAAD -0.403; TCGA THCA -0.124; TCGA UCEC -0.221
hsa-miR-590-3p
BMP4
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD
miRanda
TCGA BLCA -0.366; TCGA BRCA -0.489; TCGA CESC -0.369; TCGA HNSC -0.155; TCGA KIRC -0.241; TCGA LGG -0.303; TCGA LIHC -0.269; TCGA LUAD -0.248; TCGA LUSC -0.199; TCGA PAAD -0.474; TCGA PRAD -0.175
hsa-miR-590-3p
WDFY3
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.056; TCGA BRCA -0.13; TCGA CESC -0.177; TCGA COAD -0.098; TCGA ESCA -0.123; TCGA HNSC -0.148; TCGA KIRC -0.204; TCGA KIRP -0.142; TCGA LGG -0.13; TCGA LUAD -0.158; TCGA LUSC -0.133; TCGA PAAD -0.144; TCGA PRAD -0.112; TCGA SARC -0.112; TCGA THCA -0.116; TCGA STAD -0.203
hsa-miR-590-3p
LRRC4C
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.573; TCGA BRCA -0.405; TCGA CESC -0.405; TCGA COAD -1.004; TCGA ESCA -0.603; TCGA HNSC -0.316; TCGA KIRP -0.678; TCGA LGG -0.279; TCGA LUAD -0.179; TCGA LUSC -0.426; TCGA PAAD -0.318; TCGA PRAD -0.341; TCGA STAD -0.66; TCGA UCEC -0.292
hsa-miR-590-3p
DAAM2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.543; TCGA BRCA -0.285; TCGA CESC -0.585; TCGA COAD -0.575; TCGA ESCA -0.688; TCGA HNSC -0.45; TCGA KIRC -0.182; TCGA LGG -0.192; TCGA LUAD -0.39; TCGA LUSC -0.699; TCGA PAAD -0.329; TCGA PRAD -0.449; TCGA SARC -0.372; TCGA THCA -0.174; TCGA STAD -0.792; TCGA UCEC -0.392
hsa-miR-590-3p
ARHGEF6
10 cancers: BLCA; BRCA; COAD; ESCA; LGG; LUAD; LUSC; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.217; TCGA BRCA -0.192; TCGA COAD -0.37; TCGA ESCA -0.237; TCGA LGG -0.059; TCGA LUAD -0.147; TCGA LUSC -0.486; TCGA PRAD -0.117; TCGA STAD -0.219; TCGA UCEC -0.216
hsa-miR-590-3p
KLF9
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.504; TCGA BRCA -0.301; TCGA CESC -0.231; TCGA COAD -0.224; TCGA ESCA -0.396; TCGA HNSC -0.242; TCGA KIRC -0.285; TCGA KIRP -0.193; TCGA LUAD -0.205; TCGA LUSC -0.485; TCGA PAAD -0.132; TCGA PRAD -0.092; TCGA SARC -0.218; TCGA STAD -0.619; TCGA UCEC -0.362
hsa-miR-590-3p
ABCA1
10 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRanda
TCGA BLCA -0.091; TCGA BRCA -0.157; TCGA COAD -0.338; TCGA HNSC -0.141; TCGA LUAD -0.104; TCGA LUSC -0.27; TCGA PAAD -0.196; TCGA PRAD -0.108; TCGA THCA -0.214; TCGA STAD -0.24
hsa-miR-590-3p
MEOX2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.865; TCGA BRCA -0.592; TCGA CESC -0.436; TCGA COAD -1.014; TCGA ESCA -0.554; TCGA HNSC -0.255; TCGA LUAD -0.39; TCGA LUSC -0.71; TCGA PAAD -0.574; TCGA PRAD -0.259; TCGA STAD -0.868; TCGA UCEC -0.783
hsa-miR-590-3p
LRRN3
9 cancers: BLCA; BRCA; COAD; LGG; LUAD; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.281; TCGA BRCA -0.593; TCGA COAD -0.448; TCGA LGG -0.199; TCGA LUAD -0.325; TCGA LUSC -0.613; TCGA PRAD -0.474; TCGA STAD -0.474; TCGA UCEC -0.258
hsa-miR-590-3p
NTF3
12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.34; TCGA BRCA -0.327; TCGA COAD -0.239; TCGA HNSC -0.322; TCGA KIRC -0.281; TCGA LUAD -0.251; TCGA PAAD -0.344; TCGA PRAD -0.284; TCGA SARC -0.931; TCGA THCA -0.334; TCGA STAD -0.331; TCGA UCEC -0.399
hsa-miR-590-3p
PPM1A
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.055; TCGA BRCA -0.091; TCGA CESC -0.117; TCGA ESCA -0.178; TCGA HNSC -0.071; TCGA KIRC -0.229; TCGA KIRP -0.127; TCGA LUAD -0.059; TCGA LUSC -0.064; TCGA SARC -0.113; TCGA STAD -0.219; TCGA UCEC -0.126
hsa-miR-590-3p
WDR48
14 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.063; TCGA BRCA -0.055; TCGA CESC -0.135; TCGA ESCA -0.08; TCGA KIRC -0.316; TCGA KIRP -0.106; TCGA LGG -0.083; TCGA LUAD -0.07; TCGA LUSC -0.077; TCGA PRAD -0.062; TCGA SARC -0.139; TCGA THCA -0.058; TCGA STAD -0.083; TCGA UCEC -0.091
hsa-miR-590-3p
ZNF483
11 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.165; TCGA BRCA -0.352; TCGA ESCA -0.52; TCGA KIRC -0.343; TCGA KIRP -0.175; TCGA LGG -0.122; TCGA PRAD -0.212; TCGA SARC -0.359; TCGA THCA -0.191; TCGA STAD -0.753; TCGA UCEC -0.266
hsa-miR-590-3p
UEVLD
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.062; TCGA BRCA -0.091; TCGA CESC -0.164; TCGA ESCA -0.096; TCGA HNSC -0.085; TCGA KIRC -0.18; TCGA KIRP -0.307; TCGA LUSC -0.101; TCGA PAAD -0.23; TCGA PRAD -0.156; TCGA SARC -0.113; TCGA THCA -0.103; TCGA STAD -0.075
hsa-miR-590-3p
CASKIN2
14 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.089; TCGA BRCA -0.099; TCGA CESC -0.077; TCGA HNSC -0.112; TCGA KIRC -0.309; TCGA KIRP -0.085; TCGA LGG -0.159; TCGA LUAD -0.174; TCGA LUSC -0.243; TCGA PRAD -0.052; TCGA SARC -0.283; TCGA THCA -0.169; TCGA STAD -0.089; TCGA UCEC -0.151
hsa-miR-590-3p
THSD7B
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.592; TCGA BRCA -0.703; TCGA COAD -1; TCGA ESCA -0.534; TCGA HNSC -0.361; TCGA KIRC -0.317; TCGA KIRP -0.653; TCGA LIHC -0.25; TCGA LUAD -0.467; TCGA PAAD -0.569; TCGA PRAD -0.5; TCGA SARC -0.375; TCGA THCA -0.366; TCGA STAD -0.971; TCGA UCEC -0.366
hsa-miR-590-3p
GAB1
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.138; TCGA BRCA -0.168; TCGA CESC -0.182; TCGA ESCA -0.227; TCGA HNSC -0.145; TCGA KIRC -0.286; TCGA KIRP -0.173; TCGA LUAD -0.132; TCGA LUSC -0.159; TCGA PAAD -0.096; TCGA PRAD -0.167; TCGA SARC -0.245; TCGA THCA -0.071; TCGA STAD -0.385; TCGA UCEC -0.261
hsa-miR-590-3p
PIK3CA
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.055; TCGA CESC -0.123; TCGA COAD -0.124; TCGA ESCA -0.097; TCGA HNSC -0.124; TCGA KIRC -0.168; TCGA KIRP -0.273; TCGA LGG -0.082; TCGA PAAD -0.208; TCGA PRAD -0.149; TCGA SARC -0.111; TCGA THCA -0.106; TCGA STAD -0.175; TCGA UCEC -0.104
hsa-miR-590-3p
STAC
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.282; TCGA CESC -0.551; TCGA COAD -0.617; TCGA ESCA -0.343; TCGA HNSC -0.263; TCGA KIRC -0.346; TCGA KIRP -0.39; TCGA LUAD -0.428; TCGA LUSC -0.778; TCGA PAAD -0.477; TCGA PRAD -0.719; TCGA SARC -0.403; TCGA STAD -0.723; TCGA UCEC -0.298
hsa-miR-590-3p
F13A1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.59; TCGA BRCA -0.454; TCGA CESC -0.236; TCGA COAD -0.917; TCGA ESCA -0.696; TCGA HNSC -0.431; TCGA LUAD -0.421; TCGA LUSC -0.612; TCGA PAAD -0.614; TCGA PRAD -0.153; TCGA STAD -0.482; TCGA UCEC -0.241
hsa-miR-590-3p
TLN1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.296; TCGA BRCA -0.079; TCGA CESC -0.107; TCGA COAD -0.193; TCGA ESCA -0.293; TCGA HNSC -0.088; TCGA LUAD -0.144; TCGA LUSC -0.302; TCGA PRAD -0.256; TCGA SARC -0.266; TCGA THCA -0.054; TCGA STAD -0.396; TCGA UCEC -0.108
hsa-miR-590-3p
BVES
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.378; TCGA BRCA -0.106; TCGA CESC -0.337; TCGA COAD -0.696; TCGA ESCA -0.521; TCGA HNSC -0.226; TCGA KIRC -0.365; TCGA KIRP -0.31; TCGA LUSC -0.225; TCGA PAAD -0.204; TCGA PRAD -0.428; TCGA SARC -0.221; TCGA STAD -0.986; TCGA UCEC -0.443
hsa-miR-590-3p
ZNF214
11 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; LUSC; PAAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.198; TCGA BRCA -0.443; TCGA CESC -0.588; TCGA KIRC -0.179; TCGA KIRP -0.131; TCGA LUAD -0.319; TCGA LUSC -0.546; TCGA PAAD -0.183; TCGA THCA -0.082; TCGA STAD -0.146; TCGA UCEC -0.422
hsa-miR-590-3p
ARID1B
11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.083; TCGA CESC -0.155; TCGA ESCA -0.058; TCGA HNSC -0.116; TCGA KIRC -0.18; TCGA KIRP -0.168; TCGA LGG -0.073; TCGA LUAD -0.084; TCGA PRAD -0.114; TCGA SARC -0.149; TCGA STAD -0.099
hsa-miR-590-3p
SEC22C
11 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LIHC; LUSC; PAAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.064; TCGA BRCA -0.075; TCGA ESCA -0.125; TCGA KIRC -0.179; TCGA KIRP -0.071; TCGA LIHC -0.066; TCGA LUSC -0.171; TCGA PAAD -0.071; TCGA SARC -0.083; TCGA STAD -0.088; TCGA UCEC -0.132
hsa-miR-590-3p
FREM1
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.533; TCGA BRCA -0.64; TCGA COAD -0.42; TCGA ESCA -0.562; TCGA HNSC -0.263; TCGA KIRC -1.613; TCGA KIRP -0.431; TCGA LUSC -0.411; TCGA PAAD -0.483; TCGA PRAD -0.187; TCGA SARC -0.531; TCGA STAD -0.869; TCGA UCEC -0.312
hsa-miR-590-3p
HSD11B1
9 cancers: BLCA; COAD; ESCA; KIRC; LUSC; PAAD; PRAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.37; TCGA COAD -0.586; TCGA ESCA -0.327; TCGA KIRC -0.412; TCGA LUSC -0.428; TCGA PAAD -0.504; TCGA PRAD -0.229; TCGA SARC -0.323; TCGA STAD -0.152
hsa-miR-590-3p
TCEAL4
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LIHC; LUAD; PAAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.198; TCGA BRCA -0.176; TCGA CESC -0.141; TCGA COAD -0.185; TCGA ESCA -0.203; TCGA LGG -0.063; TCGA LIHC -0.116; TCGA LUAD -0.075; TCGA PAAD -0.095; TCGA SARC -0.365; TCGA THCA -0.068; TCGA STAD -0.345; TCGA UCEC -0.303
hsa-miR-590-3p
LRCH2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.51; TCGA BRCA -0.35; TCGA CESC -0.466; TCGA COAD -0.758; TCGA ESCA -0.423; TCGA HNSC -0.247; TCGA KIRC -0.182; TCGA KIRP -0.567; TCGA LGG -0.186; TCGA LUSC -0.567; TCGA PAAD -0.271; TCGA PRAD -0.386; TCGA SARC -0.396; TCGA STAD -0.711; TCGA UCEC -0.598
hsa-miR-590-3p
FAM20B
10 cancers: BLCA; CESC; ESCA; KIRC; KIRP; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.052; TCGA CESC -0.07; TCGA ESCA -0.16; TCGA KIRC -0.211; TCGA KIRP -0.199; TCGA PRAD -0.067; TCGA SARC -0.129; TCGA THCA -0.06; TCGA STAD -0.242; TCGA UCEC -0.14
hsa-miR-590-3p
CCPG1
15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.266; TCGA BRCA -0.148; TCGA CESC -0.212; TCGA COAD -0.145; TCGA HNSC -0.111; TCGA KIRC -0.132; TCGA KIRP -0.289; TCGA LUAD -0.11; TCGA LUSC -0.221; TCGA PAAD -0.199; TCGA PRAD -0.119; TCGA SARC -0.087; TCGA THCA -0.122; TCGA STAD -0.095; TCGA UCEC -0.178
hsa-miR-590-3p
PMP22
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.289; TCGA BRCA -0.252; TCGA CESC -0.217; TCGA COAD -0.322; TCGA ESCA -0.338; TCGA HNSC -0.208; TCGA LUAD -0.196; TCGA LUSC -0.505; TCGA PAAD -0.374; TCGA PRAD -0.222; TCGA STAD -0.388; TCGA UCEC -0.526
hsa-miR-590-3p
PLXNA4
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.64; TCGA BRCA -0.448; TCGA CESC -0.383; TCGA COAD -0.96; TCGA ESCA -0.666; TCGA HNSC -0.334; TCGA KIRC -0.862; TCGA KIRP -0.683; TCGA LGG -0.24; TCGA LUAD -0.259; TCGA LUSC -0.607; TCGA PAAD -0.321; TCGA PRAD -0.258; TCGA SARC -0.845; TCGA THCA -0.48; TCGA STAD -0.787; TCGA UCEC -0.323
hsa-miR-590-3p
CPEB1
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.879; TCGA BRCA -0.484; TCGA COAD -0.989; TCGA ESCA -0.898; TCGA HNSC -0.288; TCGA KIRC -0.415; TCGA LUAD -0.303; TCGA LUSC -0.357; TCGA PAAD -0.338; TCGA PRAD -0.51; TCGA SARC -0.479; TCGA THCA -0.323; TCGA STAD -0.916; TCGA UCEC -0.531
hsa-miR-590-3p
RAB3A
9 cancers: BLCA; KIRC; KIRP; LGG; LIHC; LUAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.127; TCGA KIRC -0.33; TCGA KIRP -0.144; TCGA LGG -0.278; TCGA LIHC -0.162; TCGA LUAD -0.091; TCGA SARC -0.162; TCGA THCA -0.096; TCGA STAD -0.159
hsa-miR-590-3p
LYVE1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.667; TCGA BRCA -0.572; TCGA CESC -0.262; TCGA COAD -0.683; TCGA ESCA -0.436; TCGA HNSC -0.194; TCGA LGG -0.199; TCGA LUAD -0.186; TCGA LUSC -0.79; TCGA PRAD -0.535; TCGA STAD -0.602; TCGA UCEC -0.438
hsa-miR-590-3p
PRSS23
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.316; TCGA BRCA -0.232; TCGA CESC -0.273; TCGA COAD -0.205; TCGA HNSC -0.213; TCGA KIRP -0.352; TCGA LUSC -0.303; TCGA PAAD -0.421; TCGA PRAD -0.175; TCGA SARC -0.27; TCGA STAD -0.346; TCGA UCEC -0.347
hsa-miR-590-3p
DLC1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.351; TCGA BRCA -0.407; TCGA CESC -0.33; TCGA COAD -0.371; TCGA ESCA -0.347; TCGA HNSC -0.281; TCGA KIRC -0.155; TCGA KIRP -0.297; TCGA LUAD -0.442; TCGA LUSC -0.803; TCGA PAAD -0.189; TCGA PRAD -0.154; TCGA THCA -0.225; TCGA STAD -0.477; TCGA UCEC -0.322
hsa-miR-590-3p
GRIK3
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; STAD
miRanda
TCGA BLCA -0.657; TCGA BRCA -0.736; TCGA CESC -0.361; TCGA COAD -0.448; TCGA ESCA -0.83; TCGA HNSC -0.394; TCGA LUAD -0.457; TCGA LUSC -0.325; TCGA PRAD -0.327; TCGA STAD -1.062
hsa-miR-590-3p
CTNNA1
11 cancers: BLCA; BRCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA
miRanda
TCGA BLCA -0.087; TCGA BRCA -0.052; TCGA KIRC -0.076; TCGA KIRP -0.121; TCGA LIHC -0.13; TCGA LUAD -0.113; TCGA LUSC -0.097; TCGA PAAD -0.167; TCGA PRAD -0.061; TCGA SARC -0.058; TCGA THCA -0.088
hsa-miR-590-3p
FGFR1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.576; TCGA BRCA -0.233; TCGA CESC -0.348; TCGA COAD -0.519; TCGA ESCA -0.26; TCGA HNSC -0.267; TCGA KIRC -0.099; TCGA KIRP -0.355; TCGA LUAD -0.108; TCGA PAAD -0.19; TCGA PRAD -0.212; TCGA THCA -0.104; TCGA STAD -0.572
hsa-miR-590-3p
BBS9
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.129; TCGA BRCA -0.075; TCGA CESC -0.182; TCGA COAD -0.129; TCGA ESCA -0.161; TCGA LUSC -0.12; TCGA PAAD -0.148; TCGA PRAD -0.056; TCGA THCA -0.076; TCGA STAD -0.182; TCGA UCEC -0.16
hsa-miR-590-3p
PTPRD
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.735; TCGA BRCA -0.181; TCGA CESC -0.547; TCGA COAD -0.333; TCGA ESCA -0.527; TCGA HNSC -0.532; TCGA KIRC -0.368; TCGA LGG -0.155; TCGA LUAD -0.355; TCGA LUSC -0.39; TCGA PRAD -0.166; TCGA SARC -0.396; TCGA STAD -0.429; TCGA UCEC -0.645
hsa-miR-590-3p
SYTL4
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.138; TCGA BRCA -0.37; TCGA CESC -0.355; TCGA ESCA -0.288; TCGA HNSC -0.18; TCGA KIRC -0.346; TCGA KIRP -0.231; TCGA LGG -0.137; TCGA LUSC -0.23; TCGA PAAD -0.258; TCGA PRAD -0.076; TCGA STAD -0.158; TCGA UCEC -0.386
hsa-miR-590-3p
PDK4
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.625; TCGA BRCA -0.706; TCGA CESC -0.649; TCGA COAD -0.32; TCGA ESCA -0.611; TCGA HNSC -0.353; TCGA KIRC -0.305; TCGA KIRP -0.315; TCGA LUAD -0.275; TCGA LUSC -0.73; TCGA PRAD -0.456; TCGA SARC -0.58; TCGA THCA -0.372; TCGA STAD -0.974; TCGA UCEC -0.553
hsa-miR-590-3p
MAP4
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.139; TCGA BRCA -0.06; TCGA COAD -0.089; TCGA ESCA -0.181; TCGA HNSC -0.178; TCGA KIRC -0.104; TCGA LUAD -0.12; TCGA LUSC -0.226; TCGA PAAD -0.171; TCGA SARC -0.115; TCGA STAD -0.219; TCGA UCEC -0.081
hsa-miR-590-3p
HAND2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -1.053; TCGA BRCA -0.344; TCGA CESC -0.58; TCGA COAD -1.226; TCGA ESCA -1.04; TCGA HNSC -0.491; TCGA PAAD -0.605; TCGA PRAD -0.432; TCGA SARC -0.861; TCGA STAD -1.495; TCGA UCEC -0.735
hsa-miR-590-3p
FLT1
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.133; TCGA BRCA -0.15; TCGA CESC -0.172; TCGA COAD -0.268; TCGA HNSC -0.175; TCGA KIRP -0.262; TCGA LUAD -0.143; TCGA LUSC -0.324; TCGA PAAD -0.139; TCGA THCA -0.286; TCGA STAD -0.084; TCGA UCEC -0.213
hsa-miR-590-3p
GOLIM4
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA
miRanda
TCGA BLCA -0.144; TCGA BRCA -0.108; TCGA CESC -0.32; TCGA HNSC -0.205; TCGA KIRC -0.161; TCGA KIRP -0.471; TCGA LUAD -0.152; TCGA PAAD -0.329; TCGA PRAD -0.286; TCGA SARC -0.203; TCGA THCA -0.138
hsa-miR-590-3p
FAM120B
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.089; TCGA BRCA -0.081; TCGA CESC -0.128; TCGA HNSC -0.065; TCGA KIRC -0.173; TCGA KIRP -0.196; TCGA LGG -0.103; TCGA LUAD -0.052; TCGA PRAD -0.084; TCGA SARC -0.082; TCGA THCA -0.061; TCGA STAD -0.082
hsa-miR-590-3p
SAMD4A
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.467; TCGA BRCA -0.226; TCGA CESC -0.167; TCGA COAD -0.32; TCGA ESCA -0.239; TCGA LUAD -0.181; TCGA LUSC -0.478; TCGA PAAD -0.195; TCGA PRAD -0.235; TCGA SARC -0.168; TCGA STAD -0.581; TCGA UCEC -0.386
hsa-miR-590-3p
TRAM1L1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.181; TCGA BRCA -0.163; TCGA CESC -0.316; TCGA COAD -0.504; TCGA ESCA -0.264; TCGA HNSC -0.318; TCGA KIRC -0.399; TCGA KIRP -0.32; TCGA LGG -0.129; TCGA LUSC -0.192; TCGA PAAD -0.198; TCGA STAD -0.527; TCGA UCEC -0.384
hsa-miR-590-3p
NRXN1
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.869; TCGA BRCA -0.398; TCGA COAD -1.082; TCGA ESCA -0.915; TCGA KIRC -0.749; TCGA LGG -0.499; TCGA LUAD -0.305; TCGA PRAD -0.517; TCGA SARC -0.843; TCGA STAD -1.375; TCGA UCEC -0.65
hsa-miR-590-3p
CYP2U1
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.251; TCGA BRCA -0.211; TCGA COAD -0.226; TCGA ESCA -0.41; TCGA KIRC -0.207; TCGA KIRP -0.19; TCGA LGG -0.094; TCGA LUAD -0.21; TCGA LUSC -0.273; TCGA SARC -0.18; TCGA STAD -0.41; TCGA UCEC -0.245
hsa-miR-590-3p
KIAA0355
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.084; TCGA BRCA -0.137; TCGA CESC -0.206; TCGA COAD -0.151; TCGA ESCA -0.129; TCGA HNSC -0.134; TCGA KIRC -0.14; TCGA KIRP -0.154; TCGA LUAD -0.132; TCGA LUSC -0.196; TCGA SARC -0.078; TCGA THCA -0.116; TCGA STAD -0.179; TCGA UCEC -0.122
hsa-miR-590-3p
PARM1
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.369; TCGA BRCA -0.171; TCGA CESC -0.296; TCGA ESCA -0.309; TCGA KIRC -0.538; TCGA LUAD -0.266; TCGA LUSC -0.387; TCGA PRAD -0.308; TCGA SARC -0.729; TCGA STAD -0.223; TCGA UCEC -0.397
hsa-miR-590-3p
ELK3
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.149; TCGA BRCA -0.208; TCGA CESC -0.265; TCGA COAD -0.315; TCGA HNSC -0.184; TCGA KIRP -0.434; TCGA LUSC -0.274; TCGA PAAD -0.326; TCGA PRAD -0.264; TCGA THCA -0.173; TCGA STAD -0.179; TCGA UCEC -0.332
hsa-miR-590-3p
BHLHE40
9 cancers: BLCA; BRCA; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD
miRanda; mirMAP
TCGA BLCA -0.185; TCGA BRCA -0.252; TCGA ESCA -0.178; TCGA HNSC -0.129; TCGA KIRP -0.246; TCGA LUAD -0.123; TCGA LUSC -0.12; TCGA PAAD -0.28; TCGA PRAD -0.276
hsa-miR-590-3p
FER
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.15; TCGA BRCA -0.211; TCGA COAD -0.181; TCGA ESCA -0.208; TCGA HNSC -0.121; TCGA KIRC -0.314; TCGA KIRP -0.385; TCGA LUAD -0.105; TCGA LUSC -0.223; TCGA PAAD -0.305; TCGA PRAD -0.237; TCGA SARC -0.15; TCGA THCA -0.093; TCGA STAD -0.297
hsa-miR-590-3p
FAM129A
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.617; TCGA BRCA -0.261; TCGA CESC -0.182; TCGA COAD -0.565; TCGA ESCA -0.393; TCGA HNSC -0.152; TCGA LUAD -0.207; TCGA LUSC -0.213; TCGA PAAD -0.33; TCGA PRAD -0.191; TCGA SARC -0.651; TCGA STAD -0.854; TCGA UCEC -0.25
hsa-miR-590-3p
SNRPN
9 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; LUSC; SARC; STAD
miRanda
TCGA BLCA -0.273; TCGA BRCA -0.2; TCGA COAD -0.357; TCGA ESCA -0.222; TCGA KIRC -0.351; TCGA LGG -0.091; TCGA LUSC -0.146; TCGA SARC -0.146; TCGA STAD -0.39
hsa-miR-590-3p
CCDC89
10 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.277; TCGA BRCA -0.275; TCGA COAD -0.358; TCGA HNSC -0.184; TCGA LUAD -0.303; TCGA LUSC -0.397; TCGA PRAD -0.308; TCGA SARC -0.216; TCGA STAD -0.405; TCGA UCEC -0.425
hsa-miR-590-3p
ZCCHC24
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.576; TCGA BRCA -0.483; TCGA CESC -0.316; TCGA COAD -0.582; TCGA ESCA -0.507; TCGA HNSC -0.292; TCGA LGG -0.196; TCGA LUAD -0.227; TCGA LUSC -0.55; TCGA PAAD -0.408; TCGA PRAD -0.145; TCGA STAD -0.684; TCGA UCEC -0.492
hsa-miR-590-3p
RASA3
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.382; TCGA BRCA -0.131; TCGA COAD -0.229; TCGA ESCA -0.183; TCGA HNSC -0.117; TCGA LGG -0.078; TCGA LUSC -0.413; TCGA PAAD -0.185; TCGA PRAD -0.092; TCGA STAD -0.173; TCGA UCEC -0.339
hsa-miR-590-3p
ARSK
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUSC; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.068; TCGA BRCA -0.086; TCGA CESC -0.146; TCGA COAD -0.062; TCGA ESCA -0.123; TCGA KIRC -0.112; TCGA KIRP -0.253; TCGA LUSC -0.093; TCGA PRAD -0.16; TCGA SARC -0.08; TCGA THCA -0.067; TCGA STAD -0.165
hsa-miR-590-3p
TRIM8
10 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; STAD
miRanda
TCGA BLCA -0.104; TCGA BRCA -0.161; TCGA KIRC -0.131; TCGA KIRP -0.14; TCGA LGG -0.131; TCGA LIHC -0.087; TCGA LUAD -0.091; TCGA LUSC -0.13; TCGA PAAD -0.089; TCGA STAD -0.06
hsa-miR-590-3p
PTPRG
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.253; TCGA BRCA -0.304; TCGA CESC -0.484; TCGA COAD -0.104; TCGA ESCA -0.193; TCGA HNSC -0.24; TCGA KIRC -0.245; TCGA KIRP -0.397; TCGA LGG -0.085; TCGA LUAD -0.326; TCGA LUSC -0.383; TCGA PAAD -0.353; TCGA PRAD -0.273; TCGA THCA -0.257; TCGA STAD -0.185; TCGA UCEC -0.157
hsa-miR-590-3p
TMEM200B
10 cancers: BLCA; BRCA; COAD; ESCA; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.258; TCGA BRCA -0.36; TCGA COAD -0.755; TCGA ESCA -0.255; TCGA LUSC -0.273; TCGA PAAD -0.369; TCGA PRAD -0.374; TCGA SARC -0.355; TCGA STAD -0.114; TCGA UCEC -0.7
hsa-miR-590-3p
EXTL2
9 cancers: BLCA; CESC; COAD; KIRC; KIRP; PAAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.079; TCGA CESC -0.205; TCGA COAD -0.169; TCGA KIRC -0.211; TCGA KIRP -0.073; TCGA PAAD -0.196; TCGA THCA -0.093; TCGA STAD -0.197; TCGA UCEC -0.187
hsa-miR-590-3p
BAG2
9 cancers: BLCA; CESC; KIRC; LGG; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.393; TCGA CESC -0.218; TCGA KIRC -0.158; TCGA LGG -0.083; TCGA PAAD -0.22; TCGA PRAD -0.126; TCGA SARC -0.399; TCGA STAD -0.554; TCGA UCEC -0.319
hsa-miR-590-3p
RAPGEF4
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LUAD; LUSC; SARC; THCA; UCEC
miRanda; mirMAP
TCGA BLCA -0.101; TCGA BRCA -0.266; TCGA CESC -0.278; TCGA COAD -0.268; TCGA HNSC -0.176; TCGA KIRP -0.337; TCGA LGG -0.233; TCGA LUAD -0.241; TCGA LUSC -0.352; TCGA SARC -0.255; TCGA THCA -0.18; TCGA UCEC -0.327
hsa-miR-590-3p
PIK3C2A
14 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.083; TCGA BRCA -0.098; TCGA CESC -0.212; TCGA ESCA -0.096; TCGA KIRC -0.223; TCGA KIRP -0.287; TCGA LUAD -0.072; TCGA LUSC -0.096; TCGA PAAD -0.13; TCGA PRAD -0.156; TCGA SARC -0.204; TCGA THCA -0.082; TCGA STAD -0.129; TCGA UCEC -0.108
hsa-miR-590-3p
FGF9
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.634; TCGA BRCA -0.208; TCGA CESC -0.664; TCGA COAD -0.396; TCGA HNSC -0.25; TCGA KIRC -2.018; TCGA KIRP -0.695; TCGA LGG -0.361; TCGA LUAD -0.548; TCGA LUSC -0.535; TCGA STAD -0.284; TCGA UCEC -0.306
hsa-miR-590-3p
SOCS5
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.111; TCGA BRCA -0.089; TCGA CESC -0.116; TCGA COAD -0.116; TCGA ESCA -0.097; TCGA HNSC -0.13; TCGA KIRC -0.095; TCGA KIRP -0.191; TCGA LUAD -0.082; TCGA LUSC -0.085; TCGA PAAD -0.174; TCGA PRAD -0.136; TCGA SARC -0.168; TCGA THCA -0.079; TCGA STAD -0.271; TCGA UCEC -0.218
hsa-miR-590-3p
RNASE4
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; SARC; UCEC
miRanda; mirMAP
TCGA BLCA -0.494; TCGA BRCA -0.446; TCGA CESC -0.408; TCGA ESCA -0.309; TCGA HNSC -0.171; TCGA LUAD -0.179; TCGA LUSC -0.472; TCGA PAAD -0.205; TCGA SARC -0.439; TCGA UCEC -0.432
hsa-miR-590-3p
CYBRD1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.517; TCGA BRCA -0.493; TCGA CESC -0.291; TCGA COAD -0.586; TCGA ESCA -0.516; TCGA HNSC -0.313; TCGA KIRC -0.314; TCGA KIRP -0.407; TCGA LUAD -0.322; TCGA LUSC -0.573; TCGA PAAD -0.497; TCGA PRAD -0.252; TCGA SARC -0.201; TCGA STAD -0.585; TCGA UCEC -0.5
hsa-miR-590-3p
CHSY1
10 cancers: BLCA; CESC; COAD; HNSC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.072; TCGA CESC -0.094; TCGA COAD -0.119; TCGA HNSC -0.089; TCGA KIRP -0.135; TCGA LUSC -0.092; TCGA PAAD -0.19; TCGA PRAD -0.053; TCGA STAD -0.063; TCGA UCEC -0.138
hsa-miR-590-3p
EDIL3
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.499; TCGA BRCA -0.435; TCGA CESC -0.658; TCGA COAD -0.667; TCGA ESCA -0.347; TCGA HNSC -0.69; TCGA KIRP -0.837; TCGA LUAD -0.354; TCGA LUSC -0.6; TCGA PAAD -0.631; TCGA PRAD -0.605; TCGA SARC -0.484; TCGA THCA -0.506; TCGA STAD -0.32; TCGA UCEC -0.492
hsa-miR-590-3p
SNX18
16 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.103; TCGA BRCA -0.103; TCGA CESC -0.192; TCGA COAD -0.273; TCGA HNSC -0.096; TCGA KIRC -0.26; TCGA KIRP -0.251; TCGA LGG -0.084; TCGA LUAD -0.116; TCGA LUSC -0.132; TCGA PAAD -0.202; TCGA PRAD -0.114; TCGA SARC -0.144; TCGA THCA -0.074; TCGA STAD -0.168; TCGA UCEC -0.17
hsa-miR-590-3p
NMT2
9 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.158; TCGA BRCA -0.1; TCGA KIRC -0.089; TCGA KIRP -0.146; TCGA LGG -0.065; TCGA LUSC -0.106; TCGA PRAD -0.055; TCGA STAD -0.137; TCGA UCEC -0.257
hsa-miR-590-3p
SFRP2
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LUSC; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.971; TCGA BRCA -0.308; TCGA COAD -1.158; TCGA ESCA -0.975; TCGA HNSC -0.576; TCGA KIRP -0.618; TCGA LGG -0.761; TCGA LUSC -0.446; TCGA PAAD -0.943; TCGA PRAD -0.179; TCGA STAD -0.847
hsa-miR-590-3p
PGM5
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -1.129; TCGA BRCA -0.731; TCGA CESC -0.722; TCGA COAD -0.794; TCGA ESCA -1.132; TCGA HNSC -0.356; TCGA KIRC -0.669; TCGA LUAD -0.417; TCGA LUSC -0.762; TCGA PRAD -0.633; TCGA SARC -1.26; TCGA STAD -1.309; TCGA UCEC -1.066
hsa-miR-590-3p
TTBK2
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.212; TCGA BRCA -0.265; TCGA CESC -0.25; TCGA COAD -0.285; TCGA ESCA -0.23; TCGA HNSC -0.171; TCGA KIRC -0.217; TCGA KIRP -0.363; TCGA LGG -0.143; TCGA LUAD -0.193; TCGA LUSC -0.112; TCGA PAAD -0.291; TCGA PRAD -0.294; TCGA SARC -0.38; TCGA STAD -0.365; TCGA UCEC -0.152
hsa-miR-590-3p
GXYLT2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; THCA; STAD
miRanda
TCGA BLCA -0.52; TCGA BRCA -0.284; TCGA CESC -0.369; TCGA COAD -0.34; TCGA ESCA -0.307; TCGA HNSC -0.384; TCGA LUSC -0.437; TCGA PAAD -0.493; TCGA PRAD -0.294; TCGA THCA -0.142; TCGA STAD -0.544
hsa-miR-590-3p
SUSD5
16 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.355; TCGA CESC -0.494; TCGA COAD -0.848; TCGA HNSC -0.388; TCGA KIRC -0.445; TCGA KIRP -0.287; TCGA LGG -0.564; TCGA LIHC -0.393; TCGA LUAD -0.179; TCGA LUSC -0.441; TCGA PAAD -0.366; TCGA PRAD -0.243; TCGA SARC -0.857; TCGA THCA -0.274; TCGA STAD -0.765; TCGA UCEC -0.362
hsa-miR-590-3p
FAM13B
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.222; TCGA BRCA -0.168; TCGA CESC -0.152; TCGA COAD -0.151; TCGA ESCA -0.269; TCGA KIRC -0.131; TCGA KIRP -0.137; TCGA LUAD -0.164; TCGA LUSC -0.153; TCGA PRAD -0.179; TCGA SARC -0.346; TCGA STAD -0.347; TCGA UCEC -0.138
hsa-miR-590-3p
COL4A1
14 cancers: BLCA; CESC; COAD; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.197; TCGA CESC -0.223; TCGA COAD -0.334; TCGA HNSC -0.19; TCGA KIRP -0.179; TCGA LIHC -0.233; TCGA LUAD -0.12; TCGA LUSC -0.218; TCGA PAAD -0.342; TCGA PRAD -0.199; TCGA SARC -0.221; TCGA THCA -0.25; TCGA STAD -0.176; TCGA UCEC -0.089
hsa-miR-590-3p
SCARA5
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.858; TCGA BRCA -0.787; TCGA COAD -0.495; TCGA ESCA -1.003; TCGA HNSC -0.569; TCGA KIRC -0.673; TCGA LGG -0.522; TCGA LUAD -0.458; TCGA LUSC -1.159; TCGA PRAD -0.614; TCGA STAD -0.876; TCGA UCEC -0.507
hsa-miR-590-3p
ATP9B
10 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; THCA
miRanda
TCGA BLCA -0.124; TCGA BRCA -0.154; TCGA CESC -0.121; TCGA HNSC -0.099; TCGA KIRP -0.151; TCGA LUAD -0.141; TCGA LUSC -0.195; TCGA PRAD -0.121; TCGA SARC -0.161; TCGA THCA -0.051
hsa-miR-590-3p
TNRC6C
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; LUAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.234; TCGA BRCA -0.148; TCGA COAD -0.079; TCGA ESCA -0.19; TCGA KIRC -0.102; TCGA LGG -0.151; TCGA LUAD -0.188; TCGA SARC -0.137; TCGA STAD -0.294; TCGA UCEC -0.137
hsa-miR-590-3p
ST6GALNAC5
10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.457; TCGA COAD -0.739; TCGA ESCA -0.355; TCGA HNSC -0.199; TCGA KIRC -0.602; TCGA LUAD -0.198; TCGA LUSC -0.557; TCGA PAAD -0.288; TCGA SARC -0.734; TCGA STAD -0.547
hsa-miR-590-3p
NEGR1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.944; TCGA BRCA -0.531; TCGA CESC -0.303; TCGA COAD -0.777; TCGA ESCA -0.783; TCGA HNSC -0.525; TCGA LGG -0.23; TCGA LUAD -0.472; TCGA LUSC -0.877; TCGA PAAD -0.356; TCGA PRAD -0.357; TCGA STAD -1.039; TCGA UCEC -0.71
hsa-miR-590-3p
RORA
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.238; TCGA BRCA -0.155; TCGA CESC -0.232; TCGA COAD -0.421; TCGA HNSC -0.296; TCGA LGG -0.111; TCGA LUAD -0.176; TCGA LUSC -0.213; TCGA PAAD -0.196; TCGA PRAD -0.117; TCGA SARC -0.135; TCGA STAD -0.431; TCGA UCEC -0.226
hsa-miR-590-3p
USP44
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.206; TCGA BRCA -0.291; TCGA CESC -0.521; TCGA ESCA -0.512; TCGA KIRC -1.121; TCGA KIRP -0.619; TCGA LUAD -0.308; TCGA LUSC -0.355; TCGA PRAD -0.365; TCGA SARC -0.394; TCGA STAD -0.643; TCGA UCEC -0.356
hsa-miR-590-3p
SLC16A4
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.469; TCGA BRCA -0.234; TCGA CESC -0.428; TCGA COAD -0.235; TCGA ESCA -0.369; TCGA HNSC -0.282; TCGA KIRP -0.16; TCGA LUAD -0.209; TCGA LUSC -0.552; TCGA PAAD -0.408; TCGA PRAD -0.291; TCGA THCA -0.196; TCGA STAD -0.32; TCGA UCEC -0.263
hsa-miR-590-3p
ASPA
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.713; TCGA BRCA -0.669; TCGA CESC -0.523; TCGA COAD -0.462; TCGA ESCA -0.706; TCGA LUAD -0.357; TCGA LUSC -0.776; TCGA PRAD -0.527; TCGA SARC -0.611; TCGA STAD -0.648; TCGA UCEC -0.658
hsa-miR-590-3p
C1QTNF3
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.436; TCGA BRCA -0.326; TCGA CESC -0.344; TCGA COAD -0.456; TCGA ESCA -0.503; TCGA HNSC -0.353; TCGA LUSC -0.35; TCGA PAAD -0.555; TCGA STAD -0.691; TCGA UCEC -0.32
hsa-miR-590-3p
ESD
9 cancers: BLCA; BRCA; CESC; LIHC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.151; TCGA BRCA -0.07; TCGA CESC -0.114; TCGA LIHC -0.1; TCGA LUSC -0.059; TCGA PAAD -0.058; TCGA PRAD -0.114; TCGA STAD -0.171; TCGA UCEC -0.22
hsa-miR-590-3p
CNST
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.128; TCGA CESC -0.08; TCGA ESCA -0.175; TCGA HNSC -0.067; TCGA KIRC -0.114; TCGA KIRP -0.12; TCGA LGG -0.074; TCGA SARC -0.327; TCGA STAD -0.169; TCGA UCEC -0.098
hsa-miR-590-3p
CDC42EP3
13 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.231; TCGA CESC -0.179; TCGA COAD -0.266; TCGA ESCA -0.247; TCGA KIRC -0.274; TCGA KIRP -0.396; TCGA LUAD -0.133; TCGA LUSC -0.157; TCGA PAAD -0.211; TCGA PRAD -0.317; TCGA SARC -0.558; TCGA STAD -0.446; TCGA UCEC -0.401
hsa-miR-590-3p
CUX1
9 cancers: BLCA; HNSC; LGG; LIHC; LUAD; PAAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.084; TCGA HNSC -0.133; TCGA LGG -0.091; TCGA LIHC -0.145; TCGA LUAD -0.06; TCGA PAAD -0.085; TCGA THCA -0.083; TCGA STAD -0.123; TCGA UCEC -0.078
hsa-miR-590-3p
ABHD2
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; THCA; UCEC
miRanda; mirMAP
TCGA BLCA -0.154; TCGA BRCA -0.151; TCGA CESC -0.259; TCGA HNSC -0.131; TCGA KIRC -0.238; TCGA KIRP -0.226; TCGA LGG -0.083; TCGA LUAD -0.164; TCGA LUSC -0.21; TCGA PAAD -0.25; TCGA THCA -0.106; TCGA UCEC -0.09
hsa-miR-590-3p
EPHB1
11 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LGG; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.364; TCGA BRCA -0.176; TCGA CESC -0.265; TCGA COAD -0.385; TCGA KIRC -0.331; TCGA KIRP -0.579; TCGA LGG -0.415; TCGA PRAD -0.462; TCGA SARC -0.625; TCGA STAD -0.307; TCGA UCEC -0.516
hsa-miR-590-3p
BCL2L2
13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.154; TCGA BRCA -0.164; TCGA COAD -0.082; TCGA ESCA -0.209; TCGA KIRC -0.264; TCGA KIRP -0.212; TCGA LIHC -0.086; TCGA LUAD -0.098; TCGA LUSC -0.121; TCGA PRAD -0.084; TCGA SARC -0.253; TCGA THCA -0.091; TCGA UCEC -0.209
hsa-miR-590-3p
NPR1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.421; TCGA BRCA -0.514; TCGA CESC -0.317; TCGA COAD -0.475; TCGA ESCA -0.361; TCGA KIRC -0.347; TCGA LIHC -0.203; TCGA LUAD -0.456; TCGA LUSC -0.788; TCGA SARC -0.295; TCGA THCA -0.145; TCGA STAD -0.521; TCGA UCEC -0.388
hsa-miR-590-3p
CIRBP
9 cancers: BLCA; BRCA; ESCA; KIRC; LGG; LIHC; LUAD; STAD; UCEC
miRanda
TCGA BLCA -0.142; TCGA BRCA -0.293; TCGA ESCA -0.12; TCGA KIRC -0.121; TCGA LGG -0.137; TCGA LIHC -0.195; TCGA LUAD -0.186; TCGA STAD -0.187; TCGA UCEC -0.239
hsa-miR-590-3p
ASPN
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.608; TCGA BRCA -0.397; TCGA CESC -0.438; TCGA COAD -0.917; TCGA ESCA -0.371; TCGA HNSC -0.434; TCGA KIRC -0.233; TCGA LUAD -0.199; TCGA LUSC -0.674; TCGA PAAD -0.727; TCGA SARC -0.529; TCGA STAD -0.622; TCGA UCEC -0.673
hsa-miR-590-3p
ENDOD1
13 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.15; TCGA CESC -0.216; TCGA ESCA -0.27; TCGA HNSC -0.283; TCGA KIRC -0.117; TCGA KIRP -0.253; TCGA LUAD -0.139; TCGA LUSC -0.137; TCGA PAAD -0.206; TCGA SARC -0.362; TCGA THCA -0.153; TCGA STAD -0.254; TCGA UCEC -0.145
hsa-miR-590-3p
LSAMP
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.406; TCGA BRCA -0.174; TCGA CESC -0.353; TCGA COAD -0.766; TCGA ESCA -0.399; TCGA KIRC -1.09; TCGA LGG -0.216; TCGA LUAD -0.334; TCGA LUSC -0.522; TCGA PAAD -0.274; TCGA PRAD -0.249; TCGA SARC -0.411; TCGA STAD -0.566; TCGA UCEC -0.518
hsa-miR-590-3p
MAML3
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.131; TCGA BRCA -0.294; TCGA CESC -0.332; TCGA ESCA -0.141; TCGA HNSC -0.251; TCGA KIRC -0.11; TCGA KIRP -0.155; TCGA LUAD -0.234; TCGA LUSC -0.134; TCGA PAAD -0.125; TCGA SARC -0.376; TCGA THCA -0.188; TCGA STAD -0.142; TCGA UCEC -0.258
hsa-miR-590-3p
ADAMTS9
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.358; TCGA BRCA -0.146; TCGA CESC -0.275; TCGA COAD -0.227; TCGA HNSC -0.285; TCGA LUAD -0.136; TCGA LUSC -0.339; TCGA PAAD -0.261; TCGA PRAD -0.254; TCGA SARC -0.203; TCGA THCA -0.348; TCGA STAD -0.215
hsa-miR-590-3p
MYO1D
11 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; THCA
miRanda
TCGA BLCA -0.148; TCGA CESC -0.148; TCGA ESCA -0.146; TCGA HNSC -0.186; TCGA KIRC -0.257; TCGA KIRP -0.154; TCGA LUAD -0.17; TCGA LUSC -0.2; TCGA PAAD -0.169; TCGA SARC -0.271; TCGA THCA -0.114
hsa-miR-590-3p
DENND5A
13 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.207; TCGA BRCA -0.097; TCGA COAD -0.298; TCGA ESCA -0.169; TCGA KIRP -0.1; TCGA LGG -0.143; TCGA LUAD -0.094; TCGA LUSC -0.137; TCGA PAAD -0.138; TCGA PRAD -0.147; TCGA SARC -0.173; TCGA STAD -0.443; TCGA UCEC -0.073
hsa-miR-590-3p
SLC22A3
12 cancers: BLCA; BRCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.629; TCGA BRCA -0.345; TCGA HNSC -0.254; TCGA KIRC -0.379; TCGA LGG -0.15; TCGA LUAD -0.53; TCGA LUSC -0.75; TCGA PAAD -0.401; TCGA PRAD -0.411; TCGA SARC -0.902; TCGA STAD -0.645; TCGA UCEC -0.772
hsa-miR-590-3p
CDH11
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.547; TCGA BRCA -0.125; TCGA CESC -0.487; TCGA COAD -0.618; TCGA ESCA -0.258; TCGA HNSC -0.374; TCGA LUAD -0.249; TCGA LUSC -0.556; TCGA PAAD -0.628; TCGA PRAD -0.205; TCGA STAD -0.237; TCGA UCEC -0.25
hsa-miR-590-3p
HHAT
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LUAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.083; TCGA BRCA -0.216; TCGA CESC -0.268; TCGA HNSC -0.134; TCGA KIRC -0.227; TCGA LUAD -0.171; TCGA PRAD -0.252; TCGA THCA -0.104; TCGA STAD -0.131; TCGA UCEC -0.247
hsa-miR-590-3p
TMTC1
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.376; TCGA BRCA -0.465; TCGA COAD -0.545; TCGA ESCA -0.342; TCGA HNSC -0.218; TCGA KIRC -0.341; TCGA KIRP -0.234; TCGA LUAD -0.323; TCGA PRAD -0.315; TCGA THCA -0.14; TCGA STAD -0.71; TCGA UCEC -0.264
hsa-miR-590-3p
CALCRL
15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.239; TCGA BRCA -0.211; TCGA CESC -0.375; TCGA COAD -0.477; TCGA HNSC -0.188; TCGA KIRP -0.241; TCGA LGG -0.324; TCGA LIHC -0.211; TCGA LUAD -0.201; TCGA LUSC -0.483; TCGA PAAD -0.296; TCGA PRAD -0.201; TCGA THCA -0.19; TCGA STAD -0.245; TCGA UCEC -0.412
hsa-miR-590-3p
CAB39L
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.271; TCGA BRCA -0.293; TCGA CESC -0.307; TCGA COAD -0.333; TCGA ESCA -0.345; TCGA KIRC -0.572; TCGA KIRP -0.171; TCGA LIHC -0.103; TCGA LUAD -0.087; TCGA LUSC -0.335; TCGA SARC -0.277; TCGA THCA -0.122; TCGA STAD -0.641; TCGA UCEC -0.332
hsa-miR-590-3p
SOX5
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.559; TCGA BRCA -0.413; TCGA CESC -0.367; TCGA COAD -0.563; TCGA HNSC -0.235; TCGA KIRC -0.459; TCGA KIRP -0.448; TCGA LUAD -0.307; TCGA LUSC -0.314; TCGA PAAD -0.239; TCGA PRAD -0.372; TCGA SARC -0.438; TCGA STAD -0.513
hsa-miR-590-3p
KIF16B
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA
miRanda; mirMAP
TCGA BLCA -0.093; TCGA BRCA -0.209; TCGA CESC -0.181; TCGA HNSC -0.105; TCGA KIRC -0.195; TCGA KIRP -0.14; TCGA LUAD -0.133; TCGA LUSC -0.122; TCGA PRAD -0.174; TCGA SARC -0.131; TCGA THCA -0.092
hsa-miR-590-3p
KLHL21
10 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.144; TCGA BRCA -0.097; TCGA ESCA -0.133; TCGA KIRC -0.258; TCGA KIRP -0.143; TCGA PRAD -0.126; TCGA SARC -0.113; TCGA THCA -0.07; TCGA STAD -0.252; TCGA UCEC -0.113
hsa-miR-590-3p
PTX3
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.387; TCGA CESC -0.312; TCGA COAD -0.429; TCGA ESCA -0.32; TCGA HNSC -0.355; TCGA LUSC -0.529; TCGA PRAD -0.177; TCGA STAD -0.533; TCGA UCEC -0.5
hsa-miR-590-3p
RBL2
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.083; TCGA BRCA -0.097; TCGA CESC -0.195; TCGA ESCA -0.125; TCGA KIRC -0.165; TCGA KIRP -0.178; TCGA LUAD -0.142; TCGA LUSC -0.146; TCGA PRAD -0.112; TCGA SARC -0.158; TCGA STAD -0.142; TCGA UCEC -0.145
hsa-miR-590-3p
LUM
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.527; TCGA BRCA -0.223; TCGA CESC -0.35; TCGA COAD -0.679; TCGA ESCA -0.281; TCGA HNSC -0.349; TCGA KIRC -0.647; TCGA LUAD -0.155; TCGA LUSC -0.509; TCGA PAAD -0.726; TCGA STAD -0.323; TCGA UCEC -0.329
hsa-miR-590-3p
PDGFD
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.411; TCGA BRCA -0.5; TCGA CESC -0.486; TCGA COAD -0.386; TCGA HNSC -0.337; TCGA LUAD -0.184; TCGA LUSC -0.442; TCGA PAAD -0.326; TCGA PRAD -0.226; TCGA THCA -0.207; TCGA STAD -0.253; TCGA UCEC -0.337
hsa-miR-590-3p
ZNF25
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.28; TCGA BRCA -0.166; TCGA CESC -0.112; TCGA COAD -0.215; TCGA ESCA -0.315; TCGA KIRP -0.176; TCGA LGG -0.179; TCGA LUAD -0.098; TCGA LUSC -0.162; TCGA PRAD -0.078; TCGA SARC -0.203; TCGA THCA -0.059; TCGA STAD -0.464; TCGA UCEC -0.329
hsa-miR-590-3p
DPT
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -1.158; TCGA BRCA -0.62; TCGA CESC -0.361; TCGA COAD -0.988; TCGA ESCA -0.82; TCGA HNSC -0.305; TCGA KIRC -1.079; TCGA LUAD -0.191; TCGA LUSC -0.732; TCGA PAAD -0.404; TCGA PRAD -0.392; TCGA STAD -0.846; TCGA UCEC -0.965
hsa-miR-590-3p
CBX7
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.445; TCGA BRCA -0.39; TCGA CESC -0.195; TCGA COAD -0.158; TCGA ESCA -0.403; TCGA KIRC -0.218; TCGA KIRP -0.149; TCGA LUAD -0.212; TCGA LUSC -0.273; TCGA PRAD -0.183; TCGA SARC -0.43; TCGA STAD -0.53; TCGA UCEC -0.448
hsa-miR-590-3p
TTLL11
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.148; TCGA BRCA -0.147; TCGA COAD -0.082; TCGA ESCA -0.227; TCGA KIRC -0.145; TCGA KIRP -0.092; TCGA LUAD -0.107; TCGA LUSC -0.198; TCGA SARC -0.075; TCGA STAD -0.348; TCGA UCEC -0.072
hsa-miR-590-3p
CPE
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LUSC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.238; TCGA BRCA -0.408; TCGA COAD -0.508; TCGA ESCA -0.369; TCGA HNSC -0.198; TCGA KIRP -0.543; TCGA LGG -0.288; TCGA LUSC -0.323; TCGA SARC -0.472; TCGA THCA -0.323; TCGA STAD -0.665; TCGA UCEC -0.521
hsa-miR-590-3p
TCEAL3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.298; TCGA BRCA -0.187; TCGA CESC -0.171; TCGA COAD -0.36; TCGA ESCA -0.311; TCGA KIRC -0.302; TCGA KIRP -0.106; TCGA LGG -0.061; TCGA LUAD -0.092; TCGA SARC -0.351; TCGA THCA -0.067; TCGA STAD -0.432; TCGA UCEC -0.272
hsa-miR-590-3p
WDR35
14 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.062; TCGA BRCA -0.079; TCGA CESC -0.203; TCGA COAD -0.156; TCGA KIRC -0.079; TCGA KIRP -0.165; TCGA LUAD -0.126; TCGA LUSC -0.077; TCGA PAAD -0.111; TCGA PRAD -0.06; TCGA SARC -0.087; TCGA THCA -0.086; TCGA STAD -0.35; TCGA UCEC -0.195
hsa-miR-590-3p
TRIL
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.353; TCGA BRCA -0.189; TCGA COAD -0.363; TCGA ESCA -0.269; TCGA HNSC -0.189; TCGA KIRC -0.314; TCGA KIRP -0.176; TCGA LUAD -0.254; TCGA LUSC -0.32; TCGA PAAD -0.204; TCGA PRAD -0.131; TCGA SARC -0.34; TCGA THCA -0.162; TCGA STAD -0.249; TCGA UCEC -0.341
hsa-miR-590-3p
VPS36
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.145; TCGA BRCA -0.098; TCGA CESC -0.151; TCGA HNSC -0.065; TCGA KIRC -0.147; TCGA KIRP -0.126; TCGA LGG -0.102; TCGA LUAD -0.068; TCGA LUSC -0.133; TCGA PRAD -0.152; TCGA SARC -0.102; TCGA STAD -0.053; TCGA UCEC -0.095
hsa-miR-590-3p
ZNF208
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.358; TCGA BRCA -0.258; TCGA CESC -0.298; TCGA COAD -0.65; TCGA ESCA -0.494; TCGA HNSC -0.203; TCGA KIRC -0.459; TCGA LUSC -0.497; TCGA PRAD -0.171; TCGA STAD -0.6; TCGA UCEC -0.361
hsa-miR-590-3p
AMIGO1
11 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.172; TCGA BRCA -0.198; TCGA CESC -0.172; TCGA KIRC -0.208; TCGA KIRP -0.166; TCGA LUAD -0.236; TCGA PRAD -0.164; TCGA SARC -0.288; TCGA THCA -0.147; TCGA STAD -0.477; TCGA UCEC -0.209
hsa-miR-590-3p
PNMA1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.223; TCGA BRCA -0.103; TCGA CESC -0.188; TCGA COAD -0.175; TCGA ESCA -0.217; TCGA KIRC -0.181; TCGA KIRP -0.234; TCGA LGG -0.174; TCGA PRAD -0.219; TCGA SARC -0.178; TCGA THCA -0.166; TCGA STAD -0.329; TCGA UCEC -0.169
hsa-miR-590-3p
HSD17B6
12 cancers: BLCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.646; TCGA CESC -0.327; TCGA COAD -0.657; TCGA ESCA -0.293; TCGA KIRC -0.444; TCGA LGG -0.223; TCGA LUAD -0.534; TCGA LUSC -0.728; TCGA PAAD -0.356; TCGA SARC -0.826; TCGA STAD -0.421; TCGA UCEC -0.702
hsa-miR-590-3p
SLIT3
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.819; TCGA BRCA -0.529; TCGA CESC -0.407; TCGA COAD -0.737; TCGA ESCA -0.488; TCGA HNSC -0.422; TCGA KIRC -0.239; TCGA LIHC -0.437; TCGA LUAD -0.519; TCGA LUSC -0.879; TCGA PAAD -0.269; TCGA PRAD -0.265; TCGA SARC -0.394; TCGA THCA -0.275; TCGA STAD -0.661; TCGA UCEC -0.337
hsa-miR-590-3p
ABCA9
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.71; TCGA BRCA -0.761; TCGA CESC -0.453; TCGA COAD -0.653; TCGA ESCA -0.947; TCGA HNSC -0.2; TCGA KIRC -0.366; TCGA LUAD -0.323; TCGA LUSC -0.751; TCGA PAAD -0.345; TCGA STAD -0.913; TCGA UCEC -0.436
hsa-miR-590-3p
CKMT2
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRanda; miRNATAP
TCGA BLCA -0.925; TCGA BRCA -0.524; TCGA CESC -0.571; TCGA ESCA -0.817; TCGA HNSC -0.581; TCGA KIRC -1.043; TCGA KIRP -0.756; TCGA LUAD -0.295; TCGA LUSC -0.594; TCGA PAAD -0.388; TCGA PRAD -0.368; TCGA SARC -1.001; TCGA STAD -0.691
hsa-miR-590-3p
FGD5
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.391; TCGA BRCA -0.29; TCGA CESC -0.273; TCGA COAD -0.462; TCGA ESCA -0.227; TCGA HNSC -0.21; TCGA KIRC -0.137; TCGA LIHC -0.249; TCGA LUAD -0.249; TCGA LUSC -0.641; TCGA PAAD -0.262; TCGA PRAD -0.142; TCGA THCA -0.158; TCGA STAD -0.227; TCGA UCEC -0.356
hsa-miR-590-3p
SNED1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.539; TCGA BRCA -0.374; TCGA CESC -0.35; TCGA COAD -0.4; TCGA ESCA -0.293; TCGA HNSC -0.338; TCGA KIRP -0.244; TCGA LUAD -0.268; TCGA LUSC -0.557; TCGA PAAD -0.138; TCGA PRAD -0.074; TCGA STAD -0.327; TCGA UCEC -0.531
hsa-miR-590-3p
CYP7B1
10 cancers: BLCA; COAD; HNSC; KIRC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.331; TCGA COAD -0.645; TCGA HNSC -0.302; TCGA KIRC -0.197; TCGA LUSC -0.293; TCGA PAAD -0.24; TCGA PRAD -0.131; TCGA SARC -0.302; TCGA STAD -0.43; TCGA UCEC -0.202
hsa-miR-590-3p
SGMS2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.221; TCGA BRCA -0.092; TCGA CESC -0.268; TCGA COAD -0.124; TCGA ESCA -0.259; TCGA HNSC -0.128; TCGA KIRC -0.121; TCGA KIRP -0.39; TCGA LUAD -0.183; TCGA LUSC -0.631; TCGA PAAD -0.422; TCGA PRAD -0.119; TCGA SARC -0.241; TCGA STAD -0.197; TCGA UCEC -0.193
hsa-miR-590-3p
NOTCH2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.099; TCGA BRCA -0.071; TCGA CESC -0.179; TCGA COAD -0.207; TCGA ESCA -0.202; TCGA HNSC -0.17; TCGA LUAD -0.117; TCGA LUSC -0.208; TCGA PAAD -0.289; TCGA PRAD -0.151; TCGA STAD -0.252; TCGA UCEC -0.07
hsa-miR-590-3p
HECTD1
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.067; TCGA BRCA -0.07; TCGA CESC -0.16; TCGA HNSC -0.129; TCGA KIRC -0.234; TCGA KIRP -0.268; TCGA LGG -0.077; TCGA LUAD -0.069; TCGA PAAD -0.084; TCGA PRAD -0.153; TCGA SARC -0.111; TCGA THCA -0.084; TCGA STAD -0.103
hsa-miR-590-3p
ZNF609
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC
miRanda; mirMAP
TCGA BLCA -0.054; TCGA BRCA -0.053; TCGA CESC -0.091; TCGA COAD -0.061; TCGA HNSC -0.081; TCGA KIRC -0.057; TCGA KIRP -0.128; TCGA LGG -0.114; TCGA LUAD -0.121; TCGA PAAD -0.087; TCGA PRAD -0.079; TCGA SARC -0.141
hsa-miR-590-3p
PRPH2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.25; TCGA BRCA -0.339; TCGA CESC -0.366; TCGA COAD -0.494; TCGA ESCA -0.273; TCGA HNSC -0.265; TCGA KIRC -0.613; TCGA LUAD -0.172; TCGA LUSC -0.537; TCGA PAAD -0.364; TCGA PRAD -0.351; TCGA STAD -0.495; TCGA UCEC -0.177
hsa-miR-590-3p
SH3RF3
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.378; TCGA BRCA -0.171; TCGA COAD -0.353; TCGA ESCA -0.171; TCGA HNSC -0.264; TCGA LIHC -0.492; TCGA LUAD -0.201; TCGA LUSC -0.239; TCGA PAAD -0.142; TCGA PRAD -0.199; TCGA STAD -0.406; TCGA UCEC -0.227
hsa-miR-590-3p
NAV3
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.574; TCGA BRCA -0.522; TCGA CESC -0.529; TCGA COAD -0.742; TCGA HNSC -0.358; TCGA LUAD -0.224; TCGA LUSC -0.559; TCGA PAAD -0.348; TCGA PRAD -0.134; TCGA STAD -0.662; TCGA UCEC -0.592
hsa-miR-590-3p
PCCA
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA
miRanda; miRNATAP
TCGA BLCA -0.211; TCGA BRCA -0.233; TCGA CESC -0.289; TCGA ESCA -0.227; TCGA KIRC -0.468; TCGA KIRP -0.209; TCGA LGG -0.112; TCGA LUAD -0.107; TCGA LUSC -0.162; TCGA PRAD -0.068; TCGA SARC -0.088; TCGA THCA -0.088
hsa-miR-590-3p
DSTN
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.294; TCGA BRCA -0.07; TCGA CESC -0.15; TCGA COAD -0.095; TCGA ESCA -0.263; TCGA KIRC -0.203; TCGA KIRP -0.216; TCGA LUSC -0.142; TCGA PAAD -0.141; TCGA PRAD -0.145; TCGA SARC -0.472; TCGA THCA -0.075; TCGA STAD -0.47; TCGA UCEC -0.298
hsa-miR-590-3p
ZZEF1
9 cancers: BLCA; BRCA; CESC; HNSC; KIRC; LGG; LUAD; LUSC; PRAD
miRanda
TCGA BLCA -0.059; TCGA BRCA -0.106; TCGA CESC -0.128; TCGA HNSC -0.076; TCGA KIRC -0.076; TCGA LGG -0.076; TCGA LUAD -0.122; TCGA LUSC -0.155; TCGA PRAD -0.089
hsa-miR-590-3p
EGLN1
10 cancers: BLCA; ESCA; HNSC; KIRP; LGG; LIHC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.064; TCGA ESCA -0.083; TCGA HNSC -0.129; TCGA KIRP -0.088; TCGA LGG -0.084; TCGA LIHC -0.117; TCGA PRAD -0.068; TCGA SARC -0.109; TCGA STAD -0.162; TCGA UCEC -0.106
hsa-miR-590-3p
KLHL15
10 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LGG; PRAD; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.061; TCGA CESC -0.076; TCGA ESCA -0.111; TCGA KIRC -0.28; TCGA KIRP -0.235; TCGA LGG -0.069; TCGA PRAD -0.077; TCGA THCA -0.121; TCGA STAD -0.285; TCGA UCEC -0.132
hsa-miR-590-3p
RBPMS
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.437; TCGA BRCA -0.276; TCGA CESC -0.3; TCGA COAD -0.233; TCGA ESCA -0.316; TCGA HNSC -0.141; TCGA LIHC -0.209; TCGA LUAD -0.221; TCGA LUSC -0.317; TCGA PAAD -0.168; TCGA PRAD -0.287; TCGA SARC -0.647; TCGA STAD -0.535; TCGA UCEC -0.156
hsa-miR-590-3p
DOCK9
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.068; TCGA BRCA -0.124; TCGA CESC -0.252; TCGA COAD -0.13; TCGA ESCA -0.156; TCGA HNSC -0.199; TCGA KIRC -0.173; TCGA KIRP -0.386; TCGA LUAD -0.301; TCGA LUSC -0.365; TCGA PAAD -0.196; TCGA PRAD -0.202; TCGA SARC -0.129; TCGA THCA -0.206; TCGA STAD -0.207; TCGA UCEC -0.109
hsa-miR-590-3p
FNDC5
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.175; TCGA BRCA -0.293; TCGA CESC -0.229; TCGA COAD -0.308; TCGA ESCA -0.43; TCGA HNSC -0.349; TCGA KIRC -0.491; TCGA LGG -0.269; TCGA LUAD -0.186; TCGA PRAD -0.103; TCGA STAD -0.772; TCGA UCEC -0.404
hsa-miR-590-3p
MAOA
12 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.226; TCGA BRCA -0.659; TCGA ESCA -0.238; TCGA HNSC -0.236; TCGA KIRC -0.281; TCGA LUAD -0.276; TCGA LUSC -0.2; TCGA PAAD -0.162; TCGA SARC -0.802; TCGA THCA -0.181; TCGA STAD -0.274; TCGA UCEC -0.25
hsa-miR-590-3p
TYRP1
11 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.445; TCGA COAD -0.72; TCGA ESCA -0.801; TCGA HNSC -0.714; TCGA KIRC -1.64; TCGA KIRP -0.987; TCGA LUAD -0.374; TCGA LUSC -0.401; TCGA PAAD -0.596; TCGA SARC -0.716; TCGA STAD -0.633
hsa-miR-590-3p
ANXA5
9 cancers: BLCA; CESC; COAD; KIRP; LUSC; PAAD; PRAD; THCA; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.128; TCGA CESC -0.08; TCGA COAD -0.144; TCGA KIRP -0.13; TCGA LUSC -0.259; TCGA PAAD -0.218; TCGA PRAD -0.079; TCGA THCA -0.068; TCGA UCEC -0.097
hsa-miR-590-3p
SSH1
10 cancers: BLCA; COAD; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.052; TCGA COAD -0.118; TCGA KIRP -0.074; TCGA LUAD -0.083; TCGA LUSC -0.128; TCGA PAAD -0.137; TCGA PRAD -0.141; TCGA THCA -0.071; TCGA STAD -0.158; TCGA UCEC -0.067
hsa-miR-590-3p
NAALADL2
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; SARC
miRanda; mirMAP
TCGA BLCA -0.336; TCGA BRCA -0.179; TCGA CESC -0.298; TCGA COAD -0.249; TCGA ESCA -0.28; TCGA HNSC -0.271; TCGA KIRC -0.704; TCGA KIRP -0.305; TCGA PAAD -0.371; TCGA SARC -0.22
hsa-miR-590-3p
KDM3B
13 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.079; TCGA BRCA -0.073; TCGA CESC -0.113; TCGA ESCA -0.066; TCGA KIRC -0.086; TCGA KIRP -0.155; TCGA LGG -0.13; TCGA LUAD -0.123; TCGA PRAD -0.103; TCGA SARC -0.174; TCGA THCA -0.075; TCGA STAD -0.077; TCGA UCEC -0.063
hsa-miR-590-3p
FCHSD2
10 cancers: BLCA; CESC; COAD; ESCA; KIRP; LGG; LUAD; LUSC; PRAD; STAD
miRanda; mirMAP
TCGA BLCA -0.102; TCGA CESC -0.081; TCGA COAD -0.124; TCGA ESCA -0.132; TCGA KIRP -0.073; TCGA LGG -0.25; TCGA LUAD -0.064; TCGA LUSC -0.126; TCGA PRAD -0.121; TCGA STAD -0.099
hsa-miR-590-3p
SEC23A
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.195; TCGA BRCA -0.093; TCGA CESC -0.158; TCGA COAD -0.095; TCGA ESCA -0.176; TCGA HNSC -0.136; TCGA LUSC -0.098; TCGA PAAD -0.266; TCGA PRAD -0.281; TCGA SARC -0.112; TCGA STAD -0.312; TCGA UCEC -0.164
hsa-miR-590-3p
ICA1L
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; LUAD; PRAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.119; TCGA BRCA -0.157; TCGA COAD -0.149; TCGA ESCA -0.269; TCGA KIRC -0.14; TCGA LGG -0.122; TCGA LUAD -0.113; TCGA PRAD -0.119; TCGA SARC -0.328; TCGA THCA -0.145; TCGA STAD -0.549
hsa-miR-590-3p
PDGFRA
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.493; TCGA BRCA -0.264; TCGA CESC -0.486; TCGA COAD -0.506; TCGA ESCA -0.246; TCGA HNSC -0.363; TCGA KIRC -0.97; TCGA LGG -0.361; TCGA LUAD -0.216; TCGA LUSC -0.578; TCGA PAAD -0.456; TCGA PRAD -0.259; TCGA STAD -0.238; TCGA UCEC -0.435
hsa-miR-590-3p
SPON1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.846; TCGA BRCA -0.42; TCGA CESC -0.645; TCGA COAD -0.413; TCGA ESCA -0.591; TCGA HNSC -0.506; TCGA KIRC -0.365; TCGA LGG -0.274; TCGA LUAD -0.366; TCGA LUSC -0.797; TCGA PAAD -0.592; TCGA PRAD -0.489; TCGA STAD -0.87; TCGA UCEC -0.404
hsa-miR-590-3p
TIPARP
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.112; TCGA BRCA -0.214; TCGA CESC -0.162; TCGA ESCA -0.13; TCGA HNSC -0.107; TCGA LUAD -0.115; TCGA LUSC -0.211; TCGA PAAD -0.183; TCGA PRAD -0.277; TCGA SARC -0.16; TCGA THCA -0.141; TCGA STAD -0.102; TCGA UCEC -0.267
hsa-miR-590-3p
SLIT2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.827; TCGA BRCA -0.49; TCGA CESC -0.658; TCGA COAD -1.162; TCGA ESCA -1.062; TCGA HNSC -0.452; TCGA KIRC -0.64; TCGA LUAD -0.497; TCGA LUSC -0.742; TCGA PAAD -0.57; TCGA PRAD -0.407; TCGA STAD -0.878; TCGA UCEC -0.447
hsa-miR-590-3p
COL4A6
11 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.565; TCGA BRCA -0.708; TCGA ESCA -0.407; TCGA KIRC -1.826; TCGA KIRP -0.985; TCGA LUAD -0.477; TCGA PAAD -0.279; TCGA PRAD -0.578; TCGA SARC -1.476; TCGA STAD -1.038; TCGA UCEC -0.87
hsa-miR-590-3p
MID2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.233; TCGA BRCA -0.136; TCGA CESC -0.2; TCGA COAD -0.293; TCGA ESCA -0.258; TCGA HNSC -0.16; TCGA KIRC -0.19; TCGA KIRP -0.267; TCGA LUAD -0.173; TCGA PRAD -0.169; TCGA SARC -0.408; TCGA THCA -0.139; TCGA STAD -0.644; TCGA UCEC -0.305
hsa-miR-590-3p
MPV17L
9 cancers: BLCA; BRCA; HNSC; KIRC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.287; TCGA BRCA -0.352; TCGA HNSC -0.284; TCGA KIRC -0.404; TCGA PAAD -0.281; TCGA PRAD -0.297; TCGA SARC -0.559; TCGA STAD -0.514; TCGA UCEC -0.239
hsa-miR-590-3p
TMEM98
9 cancers: BLCA; BRCA; HNSC; LUAD; LUSC; PAAD; SARC; THCA; UCEC
miRanda; mirMAP
TCGA BLCA -0.121; TCGA BRCA -0.204; TCGA HNSC -0.257; TCGA LUAD -0.173; TCGA LUSC -0.173; TCGA PAAD -0.184; TCGA SARC -0.434; TCGA THCA -0.158; TCGA UCEC -0.321
hsa-miR-590-3p
NUDT11
10 cancers: BLCA; BRCA; COAD; KIRP; LGG; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.366; TCGA BRCA -0.109; TCGA COAD -0.576; TCGA KIRP -0.539; TCGA LGG -0.281; TCGA PAAD -0.27; TCGA PRAD -0.22; TCGA THCA -0.267; TCGA STAD -0.755; TCGA UCEC -0.62
hsa-miR-590-3p
EFR3A
11 cancers: BLCA; CESC; ESCA; KIRP; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.091; TCGA CESC -0.132; TCGA ESCA -0.116; TCGA KIRP -0.102; TCGA LUSC -0.065; TCGA PAAD -0.136; TCGA PRAD -0.154; TCGA SARC -0.126; TCGA THCA -0.109; TCGA STAD -0.11; TCGA UCEC -0.104
hsa-miR-590-3p
ENPP5
9 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; LUSC; PRAD; THCA
miRanda; mirMAP
TCGA BLCA -0.325; TCGA BRCA -0.213; TCGA CESC -0.565; TCGA KIRC -0.565; TCGA KIRP -0.277; TCGA LUAD -0.189; TCGA LUSC -0.342; TCGA PRAD -0.122; TCGA THCA -0.169
hsa-miR-590-3p
TRIM23
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.117; TCGA BRCA -0.19; TCGA CESC -0.185; TCGA COAD -0.136; TCGA ESCA -0.121; TCGA KIRP -0.115; TCGA LGG -0.17; TCGA LUAD -0.107; TCGA LUSC -0.133; TCGA PRAD -0.124; TCGA SARC -0.17; TCGA THCA -0.088; TCGA STAD -0.265; TCGA UCEC -0.217
hsa-miR-590-3p
AXL
10 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.4; TCGA BRCA -0.2; TCGA COAD -0.491; TCGA ESCA -0.315; TCGA LUAD -0.142; TCGA LUSC -0.49; TCGA PAAD -0.362; TCGA PRAD -0.232; TCGA STAD -0.383; TCGA UCEC -0.28
hsa-miR-590-3p
PURA
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.051; TCGA BRCA -0.085; TCGA CESC -0.067; TCGA COAD -0.059; TCGA ESCA -0.099; TCGA KIRC -0.155; TCGA KIRP -0.196; TCGA LGG -0.132; TCGA LUAD -0.125; TCGA LUSC -0.128; TCGA PRAD -0.128; TCGA SARC -0.11; TCGA THCA -0.061; TCGA STAD -0.173
hsa-miR-590-3p
SLC16A12
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; LUSC; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.291; TCGA BRCA -0.77; TCGA CESC -0.379; TCGA ESCA -0.29; TCGA KIRC -0.721; TCGA LUAD -0.365; TCGA LUSC -0.68; TCGA PRAD -0.235; TCGA STAD -0.543; TCGA UCEC -0.37
hsa-miR-590-3p
DDIT4L
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; SARC; STAD
miRanda
TCGA BLCA -0.515; TCGA BRCA -0.152; TCGA CESC -0.586; TCGA COAD -0.795; TCGA ESCA -0.452; TCGA HNSC -0.324; TCGA KIRC -0.37; TCGA KIRP -0.547; TCGA PAAD -0.43; TCGA SARC -0.428; TCGA STAD -0.656
hsa-miR-590-3p
FRY
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.475; TCGA BRCA -0.383; TCGA CESC -0.516; TCGA COAD -0.421; TCGA ESCA -0.468; TCGA HNSC -0.263; TCGA KIRC -0.564; TCGA KIRP -0.461; TCGA LGG -0.268; TCGA LUAD -0.388; TCGA LUSC -0.479; TCGA PAAD -0.268; TCGA PRAD -0.218; TCGA SARC -0.709; TCGA THCA -0.165; TCGA STAD -0.39; TCGA UCEC -0.385
hsa-miR-590-3p
BNC2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.709; TCGA BRCA -0.352; TCGA CESC -0.489; TCGA COAD -0.801; TCGA ESCA -0.703; TCGA HNSC -0.428; TCGA LUAD -0.193; TCGA LUSC -0.658; TCGA PAAD -0.612; TCGA PRAD -0.43; TCGA SARC -0.274; TCGA STAD -0.819; TCGA UCEC -0.702
hsa-miR-590-3p
TMX4
12 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.185; TCGA CESC -0.11; TCGA COAD -0.107; TCGA ESCA -0.174; TCGA KIRC -0.172; TCGA KIRP -0.39; TCGA LUSC -0.146; TCGA PRAD -0.082; TCGA SARC -0.211; TCGA THCA -0.11; TCGA STAD -0.211; TCGA UCEC -0.145
hsa-miR-590-3p
GPC6
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.646; TCGA BRCA -0.179; TCGA CESC -0.327; TCGA COAD -0.654; TCGA ESCA -0.457; TCGA HNSC -0.534; TCGA LUSC -0.528; TCGA PAAD -0.225; TCGA PRAD -0.143; TCGA STAD -0.388; TCGA UCEC -0.37
hsa-miR-590-3p
PARVA
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.303; TCGA BRCA -0.169; TCGA CESC -0.215; TCGA COAD -0.171; TCGA ESCA -0.285; TCGA HNSC -0.16; TCGA KIRC -0.108; TCGA KIRP -0.2; TCGA LGG -0.096; TCGA LUAD -0.187; TCGA LUSC -0.232; TCGA PAAD -0.369; TCGA PRAD -0.238; TCGA SARC -0.234; TCGA THCA -0.062; TCGA STAD -0.505; TCGA UCEC -0.14
hsa-miR-590-3p
FZD1
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.162; TCGA BRCA -0.073; TCGA CESC -0.178; TCGA COAD -0.292; TCGA HNSC -0.242; TCGA LUAD -0.282; TCGA LUSC -0.169; TCGA PAAD -0.358; TCGA PRAD -0.154; TCGA STAD -0.25; TCGA UCEC -0.108
hsa-miR-590-3p
TFPI
10 cancers: BLCA; BRCA; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.222; TCGA BRCA -0.276; TCGA COAD -0.149; TCGA HNSC -0.146; TCGA LUAD -0.138; TCGA LUSC -0.3; TCGA PAAD -0.377; TCGA PRAD -0.222; TCGA STAD -0.211; TCGA UCEC -0.396
hsa-miR-590-3p
ZFP28
9 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.257; TCGA BRCA -0.078; TCGA CESC -0.379; TCGA COAD -0.449; TCGA KIRC -0.423; TCGA KIRP -0.334; TCGA SARC -0.375; TCGA STAD -0.623; TCGA UCEC -0.15
hsa-miR-590-3p
MOAP1
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.163; TCGA BRCA -0.125; TCGA CESC -0.119; TCGA ESCA -0.179; TCGA KIRC -0.194; TCGA KIRP -0.169; TCGA LGG -0.17; TCGA LUAD -0.1; TCGA SARC -0.261; TCGA THCA -0.082; TCGA STAD -0.275
hsa-miR-590-3p
SH3BGRL2
11 cancers: BLCA; BRCA; CESC; KIRC; LGG; LUAD; LUSC; PRAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.171; TCGA BRCA -0.361; TCGA CESC -0.572; TCGA KIRC -0.4; TCGA LGG -0.08; TCGA LUAD -0.148; TCGA LUSC -0.173; TCGA PRAD -0.122; TCGA SARC -0.239; TCGA THCA -0.14; TCGA UCEC -0.29
hsa-miR-590-3p
PHLDB2
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.355; TCGA BRCA -0.328; TCGA COAD -0.67; TCGA ESCA -0.286; TCGA KIRC -0.204; TCGA KIRP -0.276; TCGA PAAD -0.253; TCGA PRAD -0.379; TCGA SARC -0.286; TCGA THCA -0.162; TCGA STAD -0.637; TCGA UCEC -0.547
hsa-miR-590-3p
ZNF441
13 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.098; TCGA BRCA -0.198; TCGA CESC -0.208; TCGA ESCA -0.196; TCGA KIRC -0.281; TCGA KIRP -0.169; TCGA LGG -0.062; TCGA LUAD -0.112; TCGA LUSC -0.132; TCGA SARC -0.207; TCGA THCA -0.081; TCGA STAD -0.247; TCGA UCEC -0.215
hsa-miR-590-3p
LONP2
12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.069; TCGA CESC -0.1; TCGA ESCA -0.153; TCGA HNSC -0.13; TCGA KIRC -0.132; TCGA KIRP -0.186; TCGA LUAD -0.067; TCGA PAAD -0.138; TCGA PRAD -0.077; TCGA SARC -0.137; TCGA THCA -0.166; TCGA STAD -0.116
hsa-miR-590-3p
PDE7B
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.447; TCGA BRCA -0.303; TCGA CESC -0.359; TCGA COAD -0.466; TCGA ESCA -0.297; TCGA HNSC -0.218; TCGA KIRC -0.496; TCGA KIRP -0.259; TCGA LUAD -0.247; TCGA LUSC -0.344; TCGA PRAD -0.257; TCGA SARC -0.251; TCGA THCA -0.3; TCGA STAD -0.71; TCGA UCEC -0.478
hsa-miR-590-3p
MYOM1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.892; TCGA BRCA -0.566; TCGA CESC -0.451; TCGA COAD -0.634; TCGA ESCA -0.742; TCGA HNSC -0.337; TCGA KIRC -0.432; TCGA LUSC -0.434; TCGA PAAD -0.22; TCGA PRAD -0.378; TCGA SARC -0.745; TCGA THCA -0.175; TCGA STAD -0.957; TCGA UCEC -0.484
hsa-miR-590-3p
KL
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.412; TCGA BRCA -0.536; TCGA CESC -0.393; TCGA COAD -0.586; TCGA ESCA -0.336; TCGA KIRC -0.645; TCGA LUAD -0.33; TCGA LUSC -0.669; TCGA PRAD -0.409; TCGA SARC -0.279; TCGA THCA -0.326; TCGA STAD -0.519; TCGA UCEC -0.466
hsa-miR-590-3p
RPS6KA5
10 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.18; TCGA BRCA -0.207; TCGA ESCA -0.309; TCGA KIRC -0.231; TCGA KIRP -0.311; TCGA LGG -0.139; TCGA PRAD -0.257; TCGA SARC -0.431; TCGA STAD -0.275; TCGA UCEC -0.146
hsa-miR-590-3p
DNAJC3
10 cancers: BLCA; CESC; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA; UCEC
miRanda; miRNATAP
TCGA BLCA -0.07; TCGA CESC -0.092; TCGA HNSC -0.11; TCGA KIRP -0.156; TCGA LUAD -0.102; TCGA LUSC -0.184; TCGA PAAD -0.108; TCGA PRAD -0.135; TCGA THCA -0.116; TCGA UCEC -0.055
hsa-miR-590-3p
DENND2A
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.295; TCGA BRCA -0.312; TCGA CESC -0.556; TCGA ESCA -0.261; TCGA HNSC -0.136; TCGA KIRC -0.343; TCGA LUAD -0.33; TCGA LUSC -0.619; TCGA PRAD -0.104; TCGA STAD -0.362; TCGA UCEC -0.437
hsa-miR-590-3p
ADH1B
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -1.259; TCGA BRCA -1.256; TCGA CESC -0.739; TCGA COAD -0.93; TCGA ESCA -1.101; TCGA KIRC -1.299; TCGA LUAD -0.738; TCGA LUSC -1.106; TCGA PRAD -0.332; TCGA SARC -0.458; TCGA STAD -1.091; TCGA UCEC -0.963
hsa-miR-590-3p
GNG12
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.204; TCGA BRCA -0.231; TCGA CESC -0.196; TCGA ESCA -0.122; TCGA HNSC -0.109; TCGA KIRC -0.166; TCGA KIRP -0.079; TCGA LUAD -0.106; TCGA LUSC -0.149; TCGA PAAD -0.279; TCGA PRAD -0.17; TCGA SARC -0.173; TCGA THCA -0.1; TCGA STAD -0.276; TCGA UCEC -0.275
hsa-miR-590-3p
AHNAK
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.32; TCGA BRCA -0.413; TCGA CESC -0.169; TCGA COAD -0.215; TCGA ESCA -0.298; TCGA HNSC -0.312; TCGA KIRC -0.176; TCGA KIRP -0.177; TCGA LUAD -0.324; TCGA LUSC -0.42; TCGA PAAD -0.341; TCGA PRAD -0.222; TCGA SARC -0.165; TCGA STAD -0.494; TCGA UCEC -0.3
hsa-miR-590-3p
ADAMTS8
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.94; TCGA BRCA -0.402; TCGA COAD -0.66; TCGA ESCA -1.001; TCGA HNSC -0.283; TCGA KIRC -0.671; TCGA LUAD -0.637; TCGA LUSC -0.957; TCGA PRAD -0.356; TCGA SARC -1.136; TCGA STAD -0.977
hsa-miR-590-3p
CHRM3
10 cancers: BLCA; COAD; ESCA; HNSC; KIRC; KIRP; PRAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.534; TCGA COAD -0.243; TCGA ESCA -0.274; TCGA HNSC -0.539; TCGA KIRC -0.438; TCGA KIRP -0.618; TCGA PRAD -0.468; TCGA SARC -0.605; TCGA THCA -0.291; TCGA STAD -0.533
hsa-miR-590-3p
NME5
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; SARC; STAD
miRanda
TCGA BLCA -0.523; TCGA BRCA -0.517; TCGA CESC -0.523; TCGA COAD -0.481; TCGA ESCA -0.472; TCGA KIRC -0.321; TCGA LIHC -0.373; TCGA LUAD -0.367; TCGA LUSC -0.521; TCGA SARC -0.382; TCGA STAD -0.575
hsa-miR-590-3p
PRR16
9 cancers: BLCA; BRCA; CESC; COAD; LIHC; LUSC; PAAD; SARC; UCEC
miRanda
TCGA BLCA -0.21; TCGA BRCA -0.089; TCGA CESC -0.352; TCGA COAD -0.419; TCGA LIHC -0.192; TCGA LUSC -0.167; TCGA PAAD -0.356; TCGA SARC -0.238; TCGA UCEC -0.337
hsa-miR-590-3p
ARL15
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.192; TCGA BRCA -0.242; TCGA CESC -0.311; TCGA COAD -0.205; TCGA ESCA -0.154; TCGA HNSC -0.222; TCGA KIRC -0.28; TCGA KIRP -0.378; TCGA LUAD -0.144; TCGA LUSC -0.152; TCGA PRAD -0.166; TCGA SARC -0.162; TCGA THCA -0.153; TCGA STAD -0.128; TCGA UCEC -0.238
hsa-miR-590-3p
ABCB1
9 cancers: BLCA; BRCA; ESCA; KIRC; LUAD; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.288; TCGA BRCA -0.41; TCGA ESCA -0.458; TCGA KIRC -0.549; TCGA LUAD -0.169; TCGA LUSC -0.554; TCGA PRAD -0.19; TCGA STAD -0.255; TCGA UCEC -0.402
hsa-miR-590-3p
CGRRF1
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUSC; STAD; UCEC
miRanda
TCGA BLCA -0.088; TCGA BRCA -0.141; TCGA CESC -0.155; TCGA ESCA -0.107; TCGA KIRC -0.212; TCGA KIRP -0.131; TCGA LGG -0.063; TCGA LUSC -0.105; TCGA STAD -0.155; TCGA UCEC -0.196
hsa-miR-590-3p
ADAMTS16
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUSC; PAAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.773; TCGA BRCA -0.568; TCGA CESC -0.778; TCGA COAD -0.93; TCGA ESCA -0.656; TCGA HNSC -0.579; TCGA KIRC -0.995; TCGA KIRP -0.369; TCGA LIHC -0.508; TCGA LUSC -0.626; TCGA PAAD -0.639; TCGA STAD -0.398; TCGA UCEC -0.405
hsa-miR-590-3p
PLEKHM3
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.113; TCGA BRCA -0.153; TCGA CESC -0.219; TCGA COAD -0.147; TCGA ESCA -0.167; TCGA HNSC -0.2; TCGA KIRC -0.168; TCGA KIRP -0.229; TCGA LGG -0.134; TCGA LUAD -0.172; TCGA LUSC -0.216; TCGA PAAD -0.11; TCGA PRAD -0.205; TCGA SARC -0.227; TCGA THCA -0.079; TCGA STAD -0.347; TCGA UCEC -0.205
hsa-miR-590-3p
SLC35F1
12 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.274; TCGA BRCA -0.175; TCGA COAD -0.537; TCGA ESCA -0.475; TCGA KIRP -0.34; TCGA LGG -0.249; TCGA LUAD -0.172; TCGA PRAD -0.222; TCGA SARC -0.392; TCGA THCA -0.343; TCGA STAD -0.756; TCGA UCEC -0.517
hsa-miR-590-3p
ZNF582
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUSC; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.228; TCGA BRCA -0.224; TCGA COAD -0.423; TCGA ESCA -0.316; TCGA KIRC -0.434; TCGA KIRP -0.272; TCGA LUSC -0.279; TCGA SARC -0.134; TCGA STAD -0.495; TCGA UCEC -0.277
hsa-miR-590-3p
MAOB
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.784; TCGA BRCA -0.397; TCGA CESC -0.297; TCGA COAD -0.492; TCGA ESCA -0.426; TCGA LUAD -0.358; TCGA LUSC -0.562; TCGA PAAD -0.242; TCGA PRAD -0.434; TCGA SARC -1.186; TCGA STAD -0.709; TCGA UCEC -0.464
hsa-miR-590-3p
DOPEY1
11 cancers: BLCA; CESC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.059; TCGA CESC -0.159; TCGA KIRC -0.066; TCGA KIRP -0.096; TCGA LGG -0.158; TCGA LUAD -0.064; TCGA LUSC -0.086; TCGA PRAD -0.124; TCGA SARC -0.171; TCGA THCA -0.061; TCGA STAD -0.071
hsa-miR-590-3p
TCEAL5
9 cancers: BLCA; BRCA; CESC; KIRP; LGG; LUAD; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.305; TCGA BRCA -0.525; TCGA CESC -0.352; TCGA KIRP -0.171; TCGA LGG -0.235; TCGA LUAD -0.162; TCGA PRAD -0.13; TCGA SARC -0.318; TCGA UCEC -0.668
hsa-miR-590-3p
DOCK1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.196; TCGA BRCA -0.23; TCGA CESC -0.19; TCGA COAD -0.094; TCGA ESCA -0.162; TCGA HNSC -0.088; TCGA KIRC -0.251; TCGA KIRP -0.369; TCGA LUAD -0.181; TCGA LUSC -0.164; TCGA PAAD -0.234; TCGA PRAD -0.199; TCGA SARC -0.129; TCGA THCA -0.085; TCGA STAD -0.216; TCGA UCEC -0.137
hsa-miR-590-3p
SULT1C4
12 cancers: BLCA; BRCA; CESC; COAD; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.438; TCGA BRCA -0.297; TCGA CESC -0.504; TCGA COAD -0.62; TCGA LGG -0.117; TCGA LUAD -0.382; TCGA LUSC -0.656; TCGA PAAD -0.411; TCGA PRAD -0.405; TCGA SARC -0.631; TCGA STAD -0.619; TCGA UCEC -0.417
hsa-miR-590-3p
PRUNE2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -1.093; TCGA BRCA -0.262; TCGA CESC -0.423; TCGA COAD -0.442; TCGA ESCA -1.177; TCGA HNSC -0.389; TCGA LUAD -0.284; TCGA LUSC -0.612; TCGA PRAD -0.469; TCGA SARC -0.781; TCGA STAD -1.328; TCGA UCEC -0.653
hsa-miR-590-3p
CD302
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; UCEC
miRanda
TCGA BLCA -0.261; TCGA BRCA -0.275; TCGA CESC -0.161; TCGA COAD -0.139; TCGA HNSC -0.118; TCGA LUAD -0.289; TCGA LUSC -0.501; TCGA PAAD -0.195; TCGA PRAD -0.081; TCGA UCEC -0.239
hsa-miR-590-3p
PCDHAC2
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.294; TCGA CESC -0.787; TCGA COAD -0.373; TCGA ESCA -0.569; TCGA HNSC -0.278; TCGA KIRP -0.661; TCGA LGG -0.149; TCGA LUAD -0.28; TCGA LUSC -0.536; TCGA PRAD -0.403; TCGA SARC -0.348; TCGA STAD -0.462; TCGA UCEC -0.246
hsa-miR-590-3p
ZNF781
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.255; TCGA BRCA -0.23; TCGA CESC -0.273; TCGA COAD -0.464; TCGA ESCA -0.275; TCGA KIRC -0.134; TCGA LUSC -0.369; TCGA PRAD -0.12; TCGA SARC -0.331; TCGA STAD -0.638; TCGA UCEC -0.525
hsa-miR-590-3p
FBXL17
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.155; TCGA BRCA -0.206; TCGA CESC -0.111; TCGA COAD -0.123; TCGA ESCA -0.195; TCGA KIRC -0.182; TCGA KIRP -0.103; TCGA LGG -0.14; TCGA LUAD -0.108; TCGA LUSC -0.196; TCGA PRAD -0.111; TCGA SARC -0.072; TCGA THCA -0.09; TCGA STAD -0.178; TCGA UCEC -0.21
hsa-miR-590-3p
RAB33B
10 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.067; TCGA BRCA -0.117; TCGA CESC -0.135; TCGA ESCA -0.094; TCGA KIRP -0.081; TCGA LUSC -0.17; TCGA PRAD -0.082; TCGA SARC -0.234; TCGA STAD -0.166; TCGA UCEC -0.185
hsa-miR-590-3p
SAV1
12 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.053; TCGA BRCA -0.071; TCGA CESC -0.129; TCGA KIRC -0.203; TCGA KIRP -0.119; TCGA LUAD -0.056; TCGA PAAD -0.124; TCGA PRAD -0.069; TCGA SARC -0.076; TCGA THCA -0.083; TCGA STAD -0.1; TCGA UCEC -0.139
hsa-miR-590-3p
ATM
10 cancers: BLCA; CESC; COAD; KIRP; LGG; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.148; TCGA CESC -0.117; TCGA COAD -0.064; TCGA KIRP -0.086; TCGA LGG -0.068; TCGA LUSC -0.105; TCGA PRAD -0.079; TCGA SARC -0.122; TCGA STAD -0.192; TCGA UCEC -0.116
hsa-miR-590-3p
ATP1B2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.493; TCGA BRCA -0.343; TCGA CESC -0.348; TCGA COAD -0.578; TCGA ESCA -0.411; TCGA HNSC -0.233; TCGA KIRC -0.301; TCGA KIRP -0.449; TCGA LUAD -0.4; TCGA LUSC -0.402; TCGA PRAD -0.238; TCGA THCA -0.206; TCGA STAD -0.788; TCGA UCEC -0.473
hsa-miR-590-3p
KIT
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.519; TCGA BRCA -0.4; TCGA CESC -0.377; TCGA COAD -0.443; TCGA ESCA -0.551; TCGA KIRC -0.691; TCGA KIRP -0.57; TCGA LGG -0.248; TCGA LUAD -0.222; TCGA LUSC -0.396; TCGA PAAD -0.321; TCGA PRAD -0.298; TCGA SARC -0.24; TCGA STAD -0.639; TCGA UCEC -0.457
hsa-miR-590-3p
ENPP1
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.617; TCGA BRCA -0.293; TCGA CESC -0.576; TCGA ESCA -0.305; TCGA HNSC -0.34; TCGA LUSC -0.241; TCGA PAAD -0.261; TCGA PRAD -0.103; TCGA STAD -0.189; TCGA UCEC -0.384
hsa-miR-590-3p
SOBP
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.591; TCGA BRCA -0.274; TCGA CESC -0.456; TCGA COAD -0.314; TCGA ESCA -0.392; TCGA HNSC -0.279; TCGA KIRC -0.336; TCGA LGG -0.179; TCGA LUAD -0.268; TCGA LUSC -0.344; TCGA PRAD -0.273; TCGA STAD -0.701; TCGA UCEC -0.453
hsa-miR-590-3p
ADAMTS6
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUSC; SARC; STAD
miRanda
TCGA BLCA -0.265; TCGA BRCA -0.089; TCGA CESC -0.228; TCGA COAD -0.401; TCGA ESCA -0.234; TCGA KIRC -0.247; TCGA LGG -0.293; TCGA LUSC -0.366; TCGA SARC -0.201; TCGA STAD -0.244
hsa-miR-590-3p
SYNC
10 cancers: BLCA; BRCA; COAD; ESCA; LIHC; LUAD; LUSC; PAAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.312; TCGA BRCA -0.202; TCGA COAD -0.535; TCGA ESCA -0.534; TCGA LIHC -0.602; TCGA LUAD -0.138; TCGA LUSC -0.499; TCGA PAAD -0.288; TCGA SARC -0.191; TCGA STAD -0.233
hsa-miR-590-3p
PRRX1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.387; TCGA BRCA -0.188; TCGA CESC -0.214; TCGA COAD -0.598; TCGA ESCA -0.314; TCGA HNSC -0.259; TCGA LIHC -0.298; TCGA LUSC -0.259; TCGA PAAD -0.534; TCGA PRAD -0.296; TCGA SARC -0.228; TCGA STAD -0.394; TCGA UCEC -0.478
hsa-miR-590-3p
PCDHB10
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.152; TCGA CESC -0.24; TCGA COAD -0.37; TCGA ESCA -0.267; TCGA HNSC -0.229; TCGA LGG -0.161; TCGA LIHC -0.268; TCGA LUAD -0.2; TCGA LUSC -0.213; TCGA PAAD -0.235; TCGA PRAD -0.234; TCGA THCA -0.134; TCGA STAD -0.378
hsa-miR-590-3p
ANO4
9 cancers: BLCA; BRCA; CESC; LGG; LUAD; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.246; TCGA BRCA -0.154; TCGA CESC -0.473; TCGA LGG -0.207; TCGA LUAD -0.347; TCGA PAAD -0.602; TCGA PRAD -0.457; TCGA STAD -0.323; TCGA UCEC -0.254
hsa-miR-590-3p
TMEM43
11 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.067; TCGA CESC -0.094; TCGA COAD -0.088; TCGA ESCA -0.162; TCGA LUAD -0.135; TCGA LUSC -0.135; TCGA PAAD -0.232; TCGA PRAD -0.129; TCGA SARC -0.114; TCGA STAD -0.284; TCGA UCEC -0.234
hsa-miR-590-3p
MTUS1
11 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA
miRanda
TCGA BLCA -0.192; TCGA BRCA -0.287; TCGA CESC -0.211; TCGA KIRC -0.332; TCGA KIRP -0.296; TCGA LUAD -0.244; TCGA LUSC -0.128; TCGA PAAD -0.169; TCGA PRAD -0.158; TCGA SARC -0.25; TCGA THCA -0.092
hsa-miR-590-3p
TP53INP2
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.31; TCGA CESC -0.178; TCGA COAD -0.138; TCGA ESCA -0.218; TCGA HNSC -0.206; TCGA KIRC -0.088; TCGA LUSC -0.161; TCGA PRAD -0.159; TCGA SARC -0.292; TCGA THCA -0.111; TCGA STAD -0.392; TCGA UCEC -0.074
hsa-miR-590-3p
C7
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -1.301; TCGA BRCA -0.79; TCGA CESC -0.532; TCGA COAD -1.141; TCGA ESCA -1.575; TCGA KIRC -1.23; TCGA LUAD -0.608; TCGA LUSC -0.839; TCGA PRAD -0.392; TCGA SARC -1.03; TCGA STAD -1.341; TCGA UCEC -1.358
hsa-miR-590-3p
RRAGB
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LIHC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.141; TCGA BRCA -0.112; TCGA CESC -0.17; TCGA COAD -0.136; TCGA ESCA -0.127; TCGA KIRC -0.211; TCGA KIRP -0.192; TCGA LGG -0.173; TCGA LIHC -0.146; TCGA SARC -0.177; TCGA THCA -0.103; TCGA STAD -0.207; TCGA UCEC -0.323
hsa-miR-590-3p
ITGA1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.426; TCGA BRCA -0.173; TCGA CESC -0.236; TCGA COAD -0.262; TCGA ESCA -0.338; TCGA HNSC -0.156; TCGA KIRP -0.325; TCGA LUAD -0.197; TCGA LUSC -0.55; TCGA PAAD -0.325; TCGA PRAD -0.399; TCGA SARC -0.472; TCGA THCA -0.173; TCGA STAD -0.537; TCGA UCEC -0.222
hsa-miR-590-3p
IGSF9B
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.681; TCGA BRCA -0.614; TCGA CESC -0.443; TCGA COAD -0.248; TCGA ESCA -0.785; TCGA KIRC -0.162; TCGA KIRP -0.467; TCGA LGG -0.208; TCGA LUAD -0.625; TCGA PRAD -0.421; TCGA SARC -1.325; TCGA STAD -0.628; TCGA UCEC -0.538
hsa-miR-590-3p
THRB
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.201; TCGA BRCA -0.412; TCGA CESC -0.293; TCGA COAD -0.474; TCGA ESCA -0.463; TCGA HNSC -0.392; TCGA KIRC -0.79; TCGA KIRP -0.376; TCGA LGG -0.177; TCGA LUAD -0.283; TCGA LUSC -0.284; TCGA SARC -0.505; TCGA STAD -0.506; TCGA UCEC -0.425
hsa-miR-590-3p
PPP1R12B
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.679; TCGA BRCA -0.305; TCGA CESC -0.217; TCGA COAD -0.452; TCGA ESCA -0.723; TCGA KIRC -0.288; TCGA LGG -0.06; TCGA LUAD -0.286; TCGA LUSC -0.381; TCGA PRAD -0.429; TCGA SARC -1.084; TCGA STAD -1.042; TCGA UCEC -0.659
hsa-miR-590-3p
LRRC70
9 cancers: BLCA; BRCA; COAD; KIRC; LUSC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.254; TCGA BRCA -0.386; TCGA COAD -0.245; TCGA KIRC -0.155; TCGA LUSC -0.18; TCGA SARC -0.154; TCGA THCA -0.121; TCGA STAD -0.303; TCGA UCEC -0.349
hsa-miR-590-3p
RORB
10 cancers: BLCA; BRCA; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.291; TCGA BRCA -0.383; TCGA ESCA -0.357; TCGA KIRC -0.606; TCGA LUAD -0.377; TCGA LUSC -0.246; TCGA PAAD -0.381; TCGA PRAD -0.412; TCGA STAD -0.549; TCGA UCEC -0.229
hsa-miR-590-3p
GPRASP2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; UCEC
miRanda; mirMAP
TCGA BLCA -0.209; TCGA BRCA -0.303; TCGA CESC -0.221; TCGA COAD -0.293; TCGA ESCA -0.232; TCGA HNSC -0.182; TCGA KIRC -0.355; TCGA KIRP -0.262; TCGA LGG -0.109; TCGA LUAD -0.251; TCGA LUSC -0.122; TCGA PRAD -0.165; TCGA SARC -0.352; TCGA THCA -0.134; TCGA UCEC -0.483
hsa-miR-590-3p
SLC25A30
12 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.122; TCGA BRCA -0.098; TCGA CESC -0.207; TCGA COAD -0.091; TCGA KIRC -0.346; TCGA KIRP -0.257; TCGA LUAD -0.097; TCGA LUSC -0.16; TCGA PAAD -0.105; TCGA PRAD -0.082; TCGA STAD -0.091; TCGA UCEC -0.116
hsa-miR-590-3p
CACNB4
14 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.625; TCGA BRCA -0.322; TCGA COAD -0.405; TCGA ESCA -0.307; TCGA KIRC -0.433; TCGA KIRP -0.467; TCGA LGG -0.203; TCGA LUAD -0.292; TCGA LUSC -0.234; TCGA PAAD -0.25; TCGA PRAD -0.299; TCGA SARC -0.371; TCGA STAD -0.437; TCGA UCEC -0.368
hsa-miR-590-3p
MAP3K2
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; PAAD; PRAD; SARC; STAD
miRanda; miRNATAP
TCGA BLCA -0.088; TCGA CESC -0.136; TCGA COAD -0.089; TCGA ESCA -0.107; TCGA HNSC -0.126; TCGA KIRP -0.264; TCGA PAAD -0.204; TCGA PRAD -0.208; TCGA SARC -0.152; TCGA STAD -0.098
hsa-miR-590-3p
ZSCAN23
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.192; TCGA BRCA -0.396; TCGA CESC -0.427; TCGA COAD -0.747; TCGA ESCA -0.391; TCGA KIRC -0.531; TCGA KIRP -0.443; TCGA LGG -0.252; TCGA PAAD -0.301; TCGA PRAD -0.215; TCGA SARC -0.485; TCGA THCA -0.213; TCGA STAD -0.772; TCGA UCEC -0.466
hsa-miR-590-3p
FAM47E
10 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LUAD; LUSC; SARC; THCA; STAD
miRanda
TCGA BLCA -0.177; TCGA BRCA -0.539; TCGA ESCA -0.379; TCGA KIRC -0.578; TCGA KIRP -0.155; TCGA LUAD -0.145; TCGA LUSC -0.345; TCGA SARC -0.252; TCGA THCA -0.073; TCGA STAD -0.103
hsa-miR-590-3p
SESN1
10 cancers: BLCA; BRCA; CESC; KIRC; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.134; TCGA BRCA -0.219; TCGA CESC -0.114; TCGA KIRC -0.073; TCGA LUAD -0.153; TCGA LUSC -0.222; TCGA SARC -0.154; TCGA THCA -0.086; TCGA STAD -0.119; TCGA UCEC -0.195
hsa-miR-590-3p
NCKAP1
12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.114; TCGA CESC -0.137; TCGA ESCA -0.116; TCGA HNSC -0.131; TCGA KIRC -0.144; TCGA KIRP -0.278; TCGA LGG -0.095; TCGA PAAD -0.234; TCGA PRAD -0.166; TCGA SARC -0.245; TCGA THCA -0.125; TCGA STAD -0.167
hsa-miR-590-3p
SDPR
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.792; TCGA BRCA -0.801; TCGA CESC -0.321; TCGA COAD -0.635; TCGA ESCA -0.343; TCGA KIRC -0.364; TCGA LUAD -0.487; TCGA LUSC -0.429; TCGA PRAD -0.291; TCGA SARC -0.587; TCGA THCA -0.189; TCGA STAD -0.787; TCGA UCEC -0.787
hsa-miR-590-3p
PAFAH1B1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.082; TCGA BRCA -0.062; TCGA CESC -0.085; TCGA COAD -0.075; TCGA ESCA -0.081; TCGA HNSC -0.081; TCGA KIRC -0.145; TCGA KIRP -0.094; TCGA LGG -0.095; TCGA LUAD -0.095; TCGA LUSC -0.121; TCGA PRAD -0.105; TCGA THCA -0.088; TCGA STAD -0.143; TCGA UCEC -0.097
hsa-miR-590-3p
FOXO1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.184; TCGA BRCA -0.279; TCGA CESC -0.267; TCGA COAD -0.156; TCGA ESCA -0.16; TCGA HNSC -0.2; TCGA KIRC -0.294; TCGA KIRP -0.208; TCGA LUAD -0.157; TCGA LUSC -0.25; TCGA PAAD -0.155; TCGA PRAD -0.198; TCGA SARC -0.159; TCGA STAD -0.125; TCGA UCEC -0.235
hsa-miR-590-3p
SLC24A1
10 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; SARC; THCA; UCEC
miRanda; mirMAP
TCGA BLCA -0.101; TCGA BRCA -0.208; TCGA CESC -0.13; TCGA HNSC -0.072; TCGA KIRC -0.212; TCGA KIRP -0.152; TCGA LUAD -0.142; TCGA SARC -0.212; TCGA THCA -0.095; TCGA UCEC -0.069
hsa-miR-590-3p
CTSO
13 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.278; TCGA BRCA -0.206; TCGA COAD -0.228; TCGA ESCA -0.387; TCGA KIRP -0.209; TCGA LGG -0.147; TCGA LUAD -0.198; TCGA LUSC -0.401; TCGA PAAD -0.215; TCGA PRAD -0.141; TCGA SARC -0.12; TCGA STAD -0.269; TCGA UCEC -0.292
hsa-miR-590-3p
HERC3
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; STAD
miRanda
TCGA BLCA -0.193; TCGA BRCA -0.117; TCGA CESC -0.161; TCGA ESCA -0.122; TCGA HNSC -0.125; TCGA KIRC -0.148; TCGA KIRP -0.286; TCGA LUAD -0.102; TCGA LUSC -0.123; TCGA SARC -0.163; TCGA STAD -0.12
hsa-miR-590-3p
DNAJB4
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.252; TCGA BRCA -0.153; TCGA COAD -0.246; TCGA ESCA -0.203; TCGA HNSC -0.17; TCGA KIRC -0.092; TCGA KIRP -0.149; TCGA PAAD -0.251; TCGA PRAD -0.331; TCGA THCA -0.097; TCGA STAD -0.436; TCGA UCEC -0.372
hsa-miR-590-3p
UBE2QL1
11 cancers: BLCA; COAD; HNSC; KIRC; KIRP; LGG; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.311; TCGA COAD -0.71; TCGA HNSC -0.286; TCGA KIRC -0.697; TCGA KIRP -0.756; TCGA LGG -0.38; TCGA PRAD -0.322; TCGA SARC -0.733; TCGA THCA -0.295; TCGA STAD -0.462; TCGA UCEC -0.242
hsa-miR-590-3p
PIP5K1B
9 cancers: BLCA; BRCA; CESC; KIRC; LUAD; LUSC; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.302; TCGA BRCA -0.187; TCGA CESC -0.446; TCGA KIRC -0.781; TCGA LUAD -0.17; TCGA LUSC -0.311; TCGA PRAD -0.354; TCGA SARC -0.32; TCGA UCEC -0.284
hsa-miR-590-3p
FAM168B
14 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.09; TCGA CESC -0.108; TCGA COAD -0.055; TCGA HNSC -0.054; TCGA KIRC -0.203; TCGA KIRP -0.186; TCGA LGG -0.072; TCGA LUAD -0.066; TCGA PAAD -0.095; TCGA PRAD -0.138; TCGA SARC -0.216; TCGA THCA -0.074; TCGA STAD -0.217; TCGA UCEC -0.16
hsa-miR-590-3p
PCDHB3
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LUAD; PAAD; THCA; STAD
miRanda
TCGA BLCA -0.199; TCGA BRCA -0.193; TCGA CESC -0.275; TCGA COAD -0.466; TCGA HNSC -0.408; TCGA LGG -0.184; TCGA LUAD -0.139; TCGA PAAD -0.156; TCGA THCA -0.205; TCGA STAD -0.39
hsa-miR-590-3p
ARHGAP10
10 cancers: BLCA; BRCA; COAD; ESCA; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.252; TCGA BRCA -0.121; TCGA COAD -0.313; TCGA ESCA -0.23; TCGA LUSC -0.156; TCGA PAAD -0.113; TCGA PRAD -0.171; TCGA SARC -0.114; TCGA STAD -0.496; TCGA UCEC -0.126
hsa-miR-590-3p
LAMA2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.567; TCGA BRCA -0.586; TCGA CESC -0.374; TCGA COAD -0.609; TCGA ESCA -0.509; TCGA HNSC -0.486; TCGA KIRC -0.663; TCGA LUAD -0.36; TCGA LUSC -0.652; TCGA PAAD -0.637; TCGA PRAD -0.196; TCGA STAD -0.571; TCGA UCEC -0.444
hsa-miR-590-3p
ATP6V0A1
9 cancers: BLCA; BRCA; HNSC; LGG; LIHC; LUAD; LUSC; THCA; STAD
miRanda
TCGA BLCA -0.059; TCGA BRCA -0.081; TCGA HNSC -0.114; TCGA LGG -0.136; TCGA LIHC -0.178; TCGA LUAD -0.149; TCGA LUSC -0.068; TCGA THCA -0.118; TCGA STAD -0.092
hsa-miR-590-3p
CLEC14A
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.326; TCGA BRCA -0.329; TCGA CESC -0.163; TCGA COAD -0.375; TCGA ESCA -0.153; TCGA HNSC -0.134; TCGA LIHC -0.317; TCGA LUAD -0.242; TCGA LUSC -0.483; TCGA THCA -0.241; TCGA STAD -0.239; TCGA UCEC -0.374
hsa-miR-590-3p
NALCN
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD
miRanda
TCGA BLCA -0.541; TCGA BRCA -0.313; TCGA CESC -0.43; TCGA COAD -1.004; TCGA ESCA -0.892; TCGA HNSC -0.588; TCGA KIRP -0.439; TCGA LGG -0.229; TCGA LUAD -0.369; TCGA LUSC -0.703; TCGA PAAD -0.488; TCGA PRAD -0.196; TCGA THCA -0.344; TCGA STAD -0.59
hsa-miR-590-3p
STAM2
11 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.083; TCGA BRCA -0.099; TCGA CESC -0.098; TCGA KIRC -0.167; TCGA KIRP -0.171; TCGA LUSC -0.069; TCGA PAAD -0.095; TCGA PRAD -0.102; TCGA SARC -0.075; TCGA STAD -0.063; TCGA UCEC -0.078
hsa-miR-590-3p
NR3C2
13 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.707; TCGA BRCA -0.392; TCGA CESC -0.538; TCGA ESCA -0.451; TCGA KIRC -0.902; TCGA KIRP -0.485; TCGA LGG -0.18; TCGA LUAD -0.372; TCGA LUSC -0.331; TCGA PRAD -0.162; TCGA SARC -0.43; TCGA STAD -0.368; TCGA UCEC -0.467
hsa-miR-590-3p
ARSD
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; THCA
miRanda
TCGA BLCA -0.111; TCGA BRCA -0.077; TCGA HNSC -0.109; TCGA KIRC -0.283; TCGA KIRP -0.152; TCGA LUAD -0.174; TCGA LUSC -0.147; TCGA SARC -0.138; TCGA THCA -0.076
hsa-miR-590-3p
UTRN
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.341; TCGA BRCA -0.259; TCGA CESC -0.195; TCGA COAD -0.189; TCGA ESCA -0.189; TCGA HNSC -0.163; TCGA KIRC -0.291; TCGA KIRP -0.32; TCGA LUAD -0.214; TCGA LUSC -0.333; TCGA SARC -0.253; TCGA THCA -0.116; TCGA STAD -0.272; TCGA UCEC -0.185
hsa-miR-590-3p
TSPYL1
14 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.111; TCGA BRCA -0.127; TCGA CESC -0.106; TCGA HNSC -0.086; TCGA KIRC -0.396; TCGA KIRP -0.251; TCGA LGG -0.136; TCGA LUAD -0.114; TCGA LUSC -0.092; TCGA PRAD -0.145; TCGA SARC -0.162; TCGA THCA -0.106; TCGA STAD -0.149; TCGA UCEC -0.126
hsa-miR-590-3p
TCEAL6
11 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUAD; PRAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.293; TCGA BRCA -0.257; TCGA CESC -0.206; TCGA COAD -0.383; TCGA KIRC -0.394; TCGA KIRP -0.175; TCGA LUAD -0.123; TCGA PRAD -0.055; TCGA SARC -0.435; TCGA THCA -0.097; TCGA UCEC -0.243
hsa-miR-590-3p
EPHA6
9 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LGG; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.66; TCGA BRCA -0.276; TCGA CESC -0.507; TCGA ESCA -0.718; TCGA KIRP -0.684; TCGA LGG -0.298; TCGA PAAD -0.534; TCGA STAD -1.394; TCGA UCEC -0.213
hsa-miR-590-3p
FAM155A
15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LGG; LIHC; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.387; TCGA BRCA -0.307; TCGA CESC -0.324; TCGA COAD -0.548; TCGA HNSC -0.329; TCGA KIRP -1.254; TCGA LGG -0.641; TCGA LIHC -0.269; TCGA LUSC -0.635; TCGA PAAD -0.29; TCGA PRAD -0.301; TCGA SARC -0.345; TCGA THCA -0.218; TCGA STAD -0.164; TCGA UCEC -0.426
hsa-miR-590-3p
GAS6
13 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.449; TCGA BRCA -0.346; TCGA ESCA -0.284; TCGA KIRC -0.31; TCGA KIRP -0.25; TCGA LIHC -0.238; TCGA LUAD -0.272; TCGA LUSC -0.525; TCGA PAAD -0.278; TCGA PRAD -0.147; TCGA SARC -0.36; TCGA STAD -0.229; TCGA UCEC -0.457
hsa-miR-590-3p
RASL11A
11 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.342; TCGA BRCA -0.327; TCGA ESCA -0.234; TCGA KIRC -0.382; TCGA KIRP -0.142; TCGA LUAD -0.186; TCGA LUSC -0.199; TCGA PRAD -0.218; TCGA SARC -0.578; TCGA STAD -0.246; TCGA UCEC -0.234
hsa-miR-590-3p
OPHN1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.212; TCGA BRCA -0.069; TCGA CESC -0.247; TCGA COAD -0.117; TCGA ESCA -0.208; TCGA HNSC -0.088; TCGA KIRC -0.602; TCGA KIRP -0.348; TCGA LGG -0.363; TCGA LUAD -0.135; TCGA LUSC -0.17; TCGA PAAD -0.145; TCGA PRAD -0.09; TCGA SARC -0.187; TCGA THCA -0.114; TCGA STAD -0.223
hsa-miR-590-3p
RBM20
9 cancers: BLCA; BRCA; CESC; COAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.484; TCGA BRCA -0.286; TCGA CESC -0.41; TCGA COAD -0.554; TCGA LUSC -0.271; TCGA PRAD -0.247; TCGA SARC -0.428; TCGA STAD -0.797; TCGA UCEC -0.436
hsa-miR-590-3p
CSRP1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.597; TCGA BRCA -0.167; TCGA CESC -0.14; TCGA COAD -0.282; TCGA ESCA -0.381; TCGA HNSC -0.113; TCGA KIRC -0.195; TCGA KIRP -0.13; TCGA LUAD -0.135; TCGA LUSC -0.309; TCGA PAAD -0.163; TCGA PRAD -0.397; TCGA SARC -0.727; TCGA STAD -0.729; TCGA UCEC -0.393
hsa-miR-590-3p
MORC3
10 cancers: BLCA; BRCA; KIRP; LGG; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.057; TCGA BRCA -0.061; TCGA KIRP -0.127; TCGA LGG -0.063; TCGA LUSC -0.075; TCGA PRAD -0.119; TCGA SARC -0.117; TCGA THCA -0.064; TCGA STAD -0.133; TCGA UCEC -0.185
hsa-miR-590-3p
USP54
10 cancers: BLCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC
miRanda
TCGA BLCA -0.092; TCGA CESC -0.181; TCGA ESCA -0.159; TCGA HNSC -0.112; TCGA KIRC -0.262; TCGA KIRP -0.149; TCGA LGG -0.186; TCGA LUAD -0.199; TCGA LUSC -0.168; TCGA SARC -0.191
hsa-miR-590-3p
MRGPRF
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.842; TCGA BRCA -0.513; TCGA CESC -0.402; TCGA COAD -0.765; TCGA ESCA -0.67; TCGA HNSC -0.282; TCGA KIRC -0.664; TCGA LUAD -0.183; TCGA LUSC -0.596; TCGA PAAD -0.287; TCGA PRAD -0.369; TCGA SARC -0.602; TCGA STAD -0.972; TCGA UCEC -0.67
hsa-miR-590-3p
EPB41L4A
11 cancers: BLCA; BRCA; CESC; COAD; LGG; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.112; TCGA BRCA -0.272; TCGA CESC -0.215; TCGA COAD -0.161; TCGA LGG -0.081; TCGA LUAD -0.225; TCGA LUSC -0.183; TCGA SARC -0.173; TCGA THCA -0.107; TCGA STAD -0.199; TCGA UCEC -0.114
hsa-miR-590-3p
FAM66C
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.174; TCGA BRCA -0.139; TCGA CESC -0.24; TCGA ESCA -0.294; TCGA KIRC -0.177; TCGA KIRP -0.252; TCGA LGG -0.209; TCGA SARC -0.326; TCGA THCA -0.137; TCGA STAD -0.582; TCGA UCEC -0.078
hsa-miR-590-3p
WDR7
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.119; TCGA BRCA -0.066; TCGA CESC -0.11; TCGA COAD -0.09; TCGA ESCA -0.135; TCGA HNSC -0.094; TCGA KIRC -0.108; TCGA KIRP -0.079; TCGA LGG -0.087; TCGA LUAD -0.106; TCGA LUSC -0.138; TCGA PRAD -0.187; TCGA SARC -0.141; TCGA THCA -0.054; TCGA STAD -0.151; TCGA UCEC -0.066
hsa-miR-590-3p
ADAMTS1
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.589; TCGA BRCA -0.303; TCGA COAD -0.421; TCGA ESCA -0.386; TCGA HNSC -0.214; TCGA LUAD -0.278; TCGA LUSC -0.399; TCGA PRAD -0.244; TCGA SARC -0.335; TCGA STAD -0.569; TCGA UCEC -0.325
hsa-miR-590-3p
KLHL29
9 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.175; TCGA BRCA -0.348; TCGA COAD -0.149; TCGA ESCA -0.214; TCGA LUAD -0.364; TCGA LUSC -0.243; TCGA PRAD -0.174; TCGA STAD -0.494; TCGA UCEC -0.165
hsa-miR-590-3p
ENPP4
9 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; LUSC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.226; TCGA BRCA -0.139; TCGA CESC -0.535; TCGA KIRC -0.269; TCGA KIRP -0.271; TCGA LUAD -0.121; TCGA LUSC -0.461; TCGA THCA -0.077; TCGA STAD -0.119
hsa-miR-590-3p
GALNT10
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD
miRanda; mirMAP
TCGA BLCA -0.157; TCGA BRCA -0.279; TCGA CESC -0.145; TCGA COAD -0.148; TCGA ESCA -0.173; TCGA HNSC -0.13; TCGA KIRC -0.104; TCGA KIRP -0.363; TCGA LUAD -0.254; TCGA LUSC -0.356; TCGA PAAD -0.247; TCGA PRAD -0.116
hsa-miR-590-3p
ADCY9
13 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.264; TCGA BRCA -0.217; TCGA ESCA -0.232; TCGA HNSC -0.14; TCGA KIRC -0.147; TCGA LUAD -0.332; TCGA LUSC -0.396; TCGA PAAD -0.15; TCGA PRAD -0.123; TCGA SARC -0.268; TCGA THCA -0.092; TCGA STAD -0.342; TCGA UCEC -0.185
hsa-miR-590-3p
MAP2K5
9 cancers: BLCA; BRCA; KIRC; KIRP; LIHC; LUAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.097; TCGA BRCA -0.137; TCGA KIRC -0.07; TCGA KIRP -0.096; TCGA LIHC -0.103; TCGA LUAD -0.09; TCGA SARC -0.077; TCGA STAD -0.059; TCGA UCEC -0.132
hsa-miR-590-3p
NAP1L3
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.549; TCGA BRCA -0.337; TCGA CESC -0.447; TCGA COAD -0.83; TCGA ESCA -0.513; TCGA HNSC -0.448; TCGA KIRC -0.566; TCGA KIRP -0.27; TCGA LGG -0.354; TCGA LUAD -0.241; TCGA LUSC -0.45; TCGA PRAD -0.099; TCGA SARC -0.303; TCGA THCA -0.266; TCGA STAD -0.745; TCGA UCEC -0.609
hsa-miR-590-3p
NOVA1
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; PRAD; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.773; TCGA BRCA -0.747; TCGA CESC -0.406; TCGA COAD -0.678; TCGA ESCA -0.642; TCGA LGG -0.17; TCGA LUAD -0.249; TCGA PRAD -0.341; TCGA STAD -0.973; TCGA UCEC -0.746
hsa-miR-590-3p
SPTAN1
15 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.118; TCGA BRCA -0.062; TCGA CESC -0.094; TCGA HNSC -0.098; TCGA KIRC -0.243; TCGA KIRP -0.077; TCGA LGG -0.073; TCGA LIHC -0.082; TCGA LUAD -0.124; TCGA LUSC -0.166; TCGA PAAD -0.074; TCGA PRAD -0.074; TCGA THCA -0.143; TCGA STAD -0.076; TCGA UCEC -0.1
hsa-miR-590-3p
FZD7
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.352; TCGA BRCA -0.113; TCGA CESC -0.403; TCGA COAD -0.263; TCGA ESCA -0.249; TCGA HNSC -0.211; TCGA KIRC -0.26; TCGA KIRP -0.261; TCGA LUAD -0.151; TCGA PAAD -0.343; TCGA PRAD -0.308; TCGA SARC -0.388; TCGA STAD -0.369; TCGA UCEC -0.481
hsa-miR-590-3p
FHL5
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.554; TCGA BRCA -0.543; TCGA CESC -0.403; TCGA COAD -0.514; TCGA ESCA -0.348; TCGA HNSC -0.288; TCGA KIRC -0.209; TCGA KIRP -0.318; TCGA LUAD -0.343; TCGA LUSC -0.832; TCGA PAAD -0.237; TCGA PRAD -0.277; TCGA SARC -0.464; TCGA THCA -0.361; TCGA STAD -0.523; TCGA UCEC -0.582
hsa-miR-590-3p
ITGA9
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.398; TCGA BRCA -0.215; TCGA CESC -0.306; TCGA COAD -0.523; TCGA ESCA -0.586; TCGA HNSC -0.203; TCGA KIRC -0.33; TCGA KIRP -0.226; TCGA LUAD -0.456; TCGA LUSC -0.602; TCGA PAAD -0.378; TCGA PRAD -0.516; TCGA SARC -0.316; TCGA THCA -0.204; TCGA STAD -0.643; TCGA UCEC -0.414
hsa-miR-590-3p
NAP1L2
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.382; TCGA BRCA -0.504; TCGA COAD -0.773; TCGA ESCA -0.389; TCGA HNSC -0.425; TCGA KIRC -1; TCGA KIRP -0.596; TCGA LGG -0.355; TCGA LUAD -0.184; TCGA PRAD -0.1; TCGA THCA -0.172; TCGA STAD -0.989; TCGA UCEC -0.611
hsa-miR-590-3p
FAM188A
9 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LUSC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.129; TCGA BRCA -0.062; TCGA CESC -0.112; TCGA KIRC -0.131; TCGA KIRP -0.148; TCGA LGG -0.079; TCGA LUSC -0.121; TCGA STAD -0.172; TCGA UCEC -0.164
hsa-miR-590-3p
FGF2
13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.518; TCGA BRCA -0.435; TCGA COAD -0.58; TCGA ESCA -0.502; TCGA KIRC -0.224; TCGA KIRP -0.238; TCGA LUAD -0.153; TCGA LUSC -0.246; TCGA PAAD -0.408; TCGA PRAD -0.382; TCGA SARC -0.317; TCGA STAD -0.685; TCGA UCEC -0.559
hsa-miR-590-3p
CMYA5
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.274; TCGA BRCA -0.519; TCGA CESC -0.292; TCGA COAD -0.483; TCGA ESCA -0.468; TCGA HNSC -0.439; TCGA KIRC -0.241; TCGA LUAD -0.201; TCGA PAAD -0.384; TCGA PRAD -0.179; TCGA THCA -0.122; TCGA STAD -0.79; TCGA UCEC -0.351
hsa-miR-590-3p
KLF15
9 cancers: BLCA; BRCA; ESCA; KIRC; LGG; LUAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.414; TCGA BRCA -0.409; TCGA ESCA -0.431; TCGA KIRC -0.433; TCGA LGG -0.246; TCGA LUAD -0.278; TCGA SARC -0.78; TCGA STAD -0.78; TCGA UCEC -0.27
hsa-miR-590-3p
SLC25A42
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; STAD; UCEC
miRanda
TCGA BLCA -0.093; TCGA BRCA -0.107; TCGA CESC -0.152; TCGA COAD -0.115; TCGA ESCA -0.21; TCGA LGG -0.051; TCGA LUAD -0.18; TCGA LUSC -0.106; TCGA STAD -0.13; TCGA UCEC -0.173
hsa-miR-590-3p
PCDH10
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.555; TCGA BRCA -0.315; TCGA CESC -0.549; TCGA ESCA -0.817; TCGA HNSC -0.458; TCGA LUAD -0.48; TCGA LUSC -0.434; TCGA PRAD -0.512; TCGA THCA -0.255; TCGA STAD -1.54; TCGA UCEC -0.463
hsa-miR-590-3p
PAPPA2
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.23; TCGA BRCA -0.582; TCGA COAD -0.73; TCGA HNSC -0.383; TCGA KIRC -1.475; TCGA KIRP -1.155; TCGA LUAD -0.333; TCGA LUSC -0.374; TCGA SARC -0.529; TCGA STAD -0.502; TCGA UCEC -0.602
hsa-miR-590-3p
FZD4
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.205; TCGA BRCA -0.407; TCGA CESC -0.23; TCGA COAD -0.317; TCGA ESCA -0.185; TCGA HNSC -0.128; TCGA LUAD -0.125; TCGA LUSC -0.41; TCGA THCA -0.174; TCGA STAD -0.322; TCGA UCEC -0.331
hsa-miR-590-3p
CTF1
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.318; TCGA BRCA -0.254; TCGA COAD -0.46; TCGA ESCA -0.43; TCGA KIRC -0.356; TCGA LUAD -0.209; TCGA LUSC -0.173; TCGA PRAD -0.382; TCGA SARC -0.357; TCGA STAD -0.603; TCGA UCEC -0.228
hsa-miR-590-3p
KIF5B
12 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.092; TCGA CESC -0.089; TCGA HNSC -0.063; TCGA KIRC -0.147; TCGA KIRP -0.12; TCGA LUSC -0.087; TCGA PAAD -0.093; TCGA PRAD -0.111; TCGA SARC -0.139; TCGA THCA -0.063; TCGA STAD -0.115; TCGA UCEC -0.096
hsa-miR-590-3p
PABPC4L
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.253; TCGA CESC -0.349; TCGA COAD -0.61; TCGA ESCA -0.277; TCGA HNSC -0.21; TCGA LUAD -0.175; TCGA LUSC -0.253; TCGA PAAD -0.462; TCGA PRAD -0.374; TCGA SARC -0.294; TCGA THCA -0.1; TCGA STAD -0.652; TCGA UCEC -0.219
hsa-miR-590-3p
MAN2A1
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; UCEC
miRanda
TCGA BLCA -0.13; TCGA BRCA -0.157; TCGA CESC -0.291; TCGA COAD -0.16; TCGA HNSC -0.182; TCGA KIRC -0.215; TCGA KIRP -0.541; TCGA LUAD -0.11; TCGA LUSC -0.197; TCGA PAAD -0.261; TCGA PRAD -0.361; TCGA SARC -0.221; TCGA UCEC -0.127
hsa-miR-590-3p
SOX17
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; STAD
miRanda; miRNATAP
TCGA BLCA -0.448; TCGA BRCA -0.438; TCGA COAD -0.389; TCGA ESCA -0.236; TCGA HNSC -0.181; TCGA KIRC -0.152; TCGA LIHC -0.31; TCGA LUAD -0.244; TCGA LUSC -0.622; TCGA STAD -0.412
hsa-miR-590-3p
STAT5B
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.166; TCGA BRCA -0.172; TCGA CESC -0.134; TCGA COAD -0.093; TCGA ESCA -0.181; TCGA KIRC -0.052; TCGA LUAD -0.087; TCGA LUSC -0.12; TCGA PRAD -0.119; TCGA SARC -0.311; TCGA THCA -0.053; TCGA STAD -0.249; TCGA UCEC -0.209
hsa-miR-590-3p
ANO2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.147; TCGA BRCA -0.337; TCGA CESC -0.317; TCGA COAD -0.158; TCGA ESCA -0.208; TCGA HNSC -0.198; TCGA KIRP -0.407; TCGA LUAD -0.295; TCGA LUSC -0.476; TCGA THCA -0.217; TCGA STAD -0.269; TCGA UCEC -0.382
hsa-miR-590-3p
SEPT2
9 cancers: BLCA; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.081; TCGA KIRC -0.061; TCGA KIRP -0.067; TCGA LGG -0.061; TCGA PAAD -0.129; TCGA PRAD -0.077; TCGA SARC -0.116; TCGA STAD -0.091; TCGA UCEC -0.096
hsa-miR-590-3p
ZNF287
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.091; TCGA BRCA -0.111; TCGA COAD -0.309; TCGA ESCA -0.248; TCGA KIRC -0.26; TCGA LGG -0.056; TCGA SARC -0.114; TCGA THCA -0.108; TCGA STAD -0.294; TCGA UCEC -0.119
hsa-miR-590-3p
TAF9B
11 cancers: BLCA; BRCA; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.101; TCGA BRCA -0.077; TCGA KIRC -0.076; TCGA KIRP -0.205; TCGA LGG -0.108; TCGA LUAD -0.091; TCGA PRAD -0.072; TCGA SARC -0.168; TCGA THCA -0.058; TCGA STAD -0.263; TCGA UCEC -0.199
hsa-miR-590-3p
VIPR2
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LGG; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.849; TCGA BRCA -0.607; TCGA COAD -0.863; TCGA ESCA -0.867; TCGA KIRC -0.559; TCGA LGG -0.812; TCGA LUSC -0.372; TCGA PRAD -0.347; TCGA SARC -0.987; TCGA STAD -0.99; TCGA UCEC -0.189
hsa-miR-590-3p
MAP1B
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.598; TCGA BRCA -0.219; TCGA COAD -0.611; TCGA ESCA -0.37; TCGA HNSC -0.32; TCGA LIHC -0.264; TCGA LUAD -0.152; TCGA PAAD -0.267; TCGA PRAD -0.402; TCGA SARC -0.339; TCGA THCA -0.159; TCGA STAD -0.873; TCGA UCEC -0.266
hsa-miR-590-3p
ATG2B
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.066; TCGA BRCA -0.181; TCGA CESC -0.144; TCGA ESCA -0.125; TCGA HNSC -0.108; TCGA KIRC -0.196; TCGA KIRP -0.138; TCGA LGG -0.051; TCGA LUAD -0.12; TCGA LUSC -0.103; TCGA SARC -0.102; TCGA THCA -0.061; TCGA STAD -0.158; TCGA UCEC -0.097
hsa-miR-590-3p
DIAPH2
10 cancers: BLCA; ESCA; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.135; TCGA ESCA -0.134; TCGA KIRP -0.23; TCGA LGG -0.191; TCGA LUAD -0.154; TCGA PAAD -0.17; TCGA PRAD -0.095; TCGA SARC -0.278; TCGA STAD -0.153; TCGA UCEC -0.188
hsa-miR-590-3p
AKAP10
10 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LUAD; PRAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.1; TCGA BRCA -0.12; TCGA CESC -0.183; TCGA COAD -0.053; TCGA KIRC -0.077; TCGA KIRP -0.184; TCGA LUAD -0.066; TCGA PRAD -0.15; TCGA SARC -0.295; TCGA STAD -0.087
hsa-miR-590-3p
PCDHA10
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PAAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.235; TCGA BRCA -0.439; TCGA CESC -0.64; TCGA COAD -0.511; TCGA ESCA -0.609; TCGA KIRC -0.458; TCGA LUAD -0.289; TCGA LUSC -0.552; TCGA PAAD -0.564; TCGA UCEC -0.647
hsa-miR-590-3p
PLA2R1
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.114; TCGA BRCA -0.398; TCGA COAD -0.186; TCGA ESCA -0.194; TCGA HNSC -0.281; TCGA KIRC -0.524; TCGA KIRP -0.32; TCGA LUAD -0.146; TCGA PAAD -0.469; TCGA PRAD -0.159; TCGA SARC -0.473; TCGA STAD -0.353; TCGA UCEC -0.24
hsa-miR-590-3p
COL1A2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUSC; PAAD; PRAD; UCEC
miRanda
TCGA BLCA -0.441; TCGA BRCA -0.198; TCGA CESC -0.397; TCGA COAD -0.613; TCGA ESCA -0.235; TCGA HNSC -0.498; TCGA LIHC -0.233; TCGA LUSC -0.477; TCGA PAAD -0.618; TCGA PRAD -0.115; TCGA UCEC -0.181
hsa-miR-590-3p
UHRF1BP1L
12 cancers: BLCA; BRCA; CESC; ESCA; KIRP; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.089; TCGA BRCA -0.075; TCGA CESC -0.114; TCGA ESCA -0.084; TCGA KIRP -0.239; TCGA LGG -0.131; TCGA LUSC -0.095; TCGA PAAD -0.167; TCGA PRAD -0.124; TCGA SARC -0.094; TCGA THCA -0.106; TCGA STAD -0.199
hsa-miR-590-3p
FCER1A
13 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.628; TCGA BRCA -0.633; TCGA COAD -0.709; TCGA ESCA -0.498; TCGA HNSC -0.28; TCGA KIRC -0.236; TCGA LUAD -0.706; TCGA LUSC -0.799; TCGA PAAD -0.402; TCGA PRAD -0.383; TCGA SARC -0.568; TCGA STAD -0.928; TCGA UCEC -0.566
hsa-miR-590-3p
THBS2
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.416; TCGA BRCA -0.165; TCGA CESC -0.366; TCGA COAD -0.9; TCGA ESCA -0.546; TCGA HNSC -0.491; TCGA LUSC -0.265; TCGA PAAD -0.735; TCGA STAD -0.298; TCGA UCEC -0.28
hsa-miR-590-3p
PTGIS
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -1.132; TCGA BRCA -0.273; TCGA CESC -0.578; TCGA COAD -1.016; TCGA ESCA -1.201; TCGA HNSC -0.517; TCGA KIRC -0.364; TCGA LGG -0.129; TCGA LUAD -0.247; TCGA LUSC -0.664; TCGA PAAD -0.534; TCGA PRAD -0.468; TCGA STAD -1.01; TCGA UCEC -0.921
hsa-miR-590-3p
ELFN1
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUSC; THCA; UCEC
miRanda
TCGA BLCA -0.111; TCGA BRCA -0.177; TCGA CESC -0.209; TCGA COAD -0.141; TCGA HNSC -0.251; TCGA KIRC -0.276; TCGA KIRP -0.484; TCGA LGG -0.203; TCGA LUSC -0.257; TCGA THCA -0.198; TCGA UCEC -0.216
hsa-miR-590-3p
RALGPS1
9 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LUAD; SARC; THCA
miRanda; mirMAP
TCGA BLCA -0.11; TCGA BRCA -0.121; TCGA CESC -0.205; TCGA KIRC -0.743; TCGA KIRP -0.148; TCGA LGG -0.152; TCGA LUAD -0.157; TCGA SARC -0.222; TCGA THCA -0.084
hsa-miR-590-3p
HDX
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.228; TCGA BRCA -0.088; TCGA COAD -0.358; TCGA ESCA -0.357; TCGA HNSC -0.167; TCGA KIRC -0.132; TCGA KIRP -0.218; TCGA LGG -0.096; TCGA LUAD -0.167; TCGA LUSC -0.276; TCGA PAAD -0.195; TCGA PRAD -0.207; TCGA SARC -0.265; TCGA STAD -0.511; TCGA UCEC -0.417
hsa-miR-590-3p
PXDN
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.415; TCGA BRCA -0.078; TCGA CESC -0.343; TCGA COAD -0.461; TCGA HNSC -0.32; TCGA LUSC -0.202; TCGA PAAD -0.347; TCGA PRAD -0.195; TCGA THCA -0.198; TCGA STAD -0.168; TCGA UCEC -0.343
hsa-miR-590-3p
CYYR1
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.262; TCGA BRCA -0.207; TCGA CESC -0.245; TCGA COAD -0.395; TCGA HNSC -0.217; TCGA KIRC -0.142; TCGA KIRP -0.292; TCGA LIHC -0.294; TCGA LUAD -0.211; TCGA LUSC -0.471; TCGA PRAD -0.106; TCGA THCA -0.172; TCGA STAD -0.334; TCGA UCEC -0.466
hsa-miR-590-3p
COL12A1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.165; TCGA BRCA -0.158; TCGA CESC -0.457; TCGA COAD -0.529; TCGA ESCA -0.257; TCGA HNSC -0.335; TCGA KIRC -0.296; TCGA KIRP -0.287; TCGA LUSC -0.582; TCGA PAAD -0.682; TCGA STAD -0.299; TCGA UCEC -0.193
hsa-miR-590-3p
MAGI3
11 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.108; TCGA BRCA -0.113; TCGA CESC -0.259; TCGA KIRC -0.622; TCGA KIRP -0.366; TCGA LUAD -0.271; TCGA LUSC -0.245; TCGA PAAD -0.186; TCGA SARC -0.242; TCGA THCA -0.094; TCGA STAD -0.093
hsa-miR-590-3p
SIK3
13 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.112; TCGA BRCA -0.123; TCGA COAD -0.086; TCGA HNSC -0.095; TCGA KIRC -0.219; TCGA KIRP -0.137; TCGA LGG -0.056; TCGA LUAD -0.057; TCGA LUSC -0.117; TCGA PRAD -0.144; TCGA SARC -0.122; TCGA THCA -0.076; TCGA STAD -0.19
hsa-miR-590-3p
KATNAL1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.28; TCGA BRCA -0.117; TCGA CESC -0.21; TCGA COAD -0.274; TCGA ESCA -0.226; TCGA KIRP -0.109; TCGA LUAD -0.106; TCGA LUSC -0.214; TCGA PAAD -0.174; TCGA PRAD -0.237; TCGA SARC -0.197; TCGA STAD -0.546; TCGA UCEC -0.354
hsa-miR-590-3p
ACTC1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -1.759; TCGA BRCA -0.141; TCGA CESC -0.376; TCGA COAD -1.06; TCGA ESCA -0.9; TCGA HNSC -0.88; TCGA LUSC -0.37; TCGA PRAD -0.804; TCGA SARC -0.837; TCGA STAD -0.879; TCGA UCEC -0.398
hsa-miR-590-3p
HCG11
11 cancers: BLCA; BRCA; CESC; COAD; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.228; TCGA BRCA -0.129; TCGA CESC -0.135; TCGA COAD -0.249; TCGA KIRC -0.216; TCGA LUAD -0.1; TCGA LUSC -0.066; TCGA PAAD -0.292; TCGA PRAD -0.331; TCGA SARC -0.188; TCGA STAD -0.389
hsa-miR-590-3p
PRDM6
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.729; TCGA BRCA -0.282; TCGA COAD -0.851; TCGA ESCA -0.56; TCGA HNSC -0.162; TCGA LIHC -0.215; TCGA LUAD -0.343; TCGA LUSC -0.48; TCGA PAAD -0.524; TCGA PRAD -0.377; TCGA SARC -0.445; TCGA STAD -0.534
hsa-miR-590-3p
RYR3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.481; TCGA BRCA -0.324; TCGA CESC -0.274; TCGA COAD -0.355; TCGA ESCA -0.485; TCGA KIRC -0.177; TCGA KIRP -0.378; TCGA LUAD -0.298; TCGA PRAD -0.237; TCGA SARC -0.926; TCGA STAD -1.053; TCGA UCEC -0.702
hsa-miR-590-3p
RFTN2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.318; TCGA BRCA -0.257; TCGA CESC -0.205; TCGA COAD -0.379; TCGA ESCA -0.187; TCGA HNSC -0.242; TCGA KIRC -0.136; TCGA KIRP -0.239; TCGA LGG -0.243; TCGA LUAD -0.155; TCGA LUSC -0.353; TCGA PAAD -0.279; TCGA PRAD -0.104; TCGA STAD -0.33; TCGA UCEC -0.303
hsa-miR-590-3p
PLEKHA5
10 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LUAD; PAAD; PRAD; SARC; STAD
miRanda; mirMAP
TCGA BLCA -0.077; TCGA CESC -0.246; TCGA ESCA -0.148; TCGA HNSC -0.098; TCGA KIRP -0.126; TCGA LUAD -0.081; TCGA PAAD -0.265; TCGA PRAD -0.058; TCGA SARC -0.242; TCGA STAD -0.239
hsa-miR-590-3p
PCDHB15
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.219; TCGA BRCA -0.275; TCGA CESC -0.364; TCGA COAD -0.333; TCGA ESCA -0.365; TCGA HNSC -0.221; TCGA LGG -0.144; TCGA LUAD -0.142; TCGA LUSC -0.375; TCGA PRAD -0.166; TCGA SARC -0.347; TCGA STAD -0.397
hsa-miR-590-3p
MR1
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.105; TCGA BRCA -0.062; TCGA COAD -0.175; TCGA ESCA -0.177; TCGA HNSC -0.078; TCGA KIRP -0.109; TCGA LUAD -0.097; TCGA LUSC -0.186; TCGA PAAD -0.19; TCGA PRAD -0.289; TCGA SARC -0.152; TCGA THCA -0.076; TCGA STAD -0.139; TCGA UCEC -0.102
hsa-miR-590-3p
FAM127C
9 cancers: BLCA; COAD; HNSC; LUAD; PAAD; PRAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.127; TCGA COAD -0.428; TCGA HNSC -0.099; TCGA LUAD -0.082; TCGA PAAD -0.132; TCGA PRAD -0.084; TCGA SARC -0.109; TCGA THCA -0.055; TCGA STAD -0.506
hsa-miR-590-3p
RAB30
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.182; TCGA BRCA -0.3; TCGA COAD -0.241; TCGA HNSC -0.15; TCGA KIRC -0.18; TCGA KIRP -0.388; TCGA LGG -0.139; TCGA PRAD -0.192; TCGA SARC -0.274; TCGA STAD -0.118; TCGA UCEC -0.133
hsa-miR-590-3p
CACNA2D3
11 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LIHC; LUAD; PRAD; SARC; STAD
miRanda
TCGA BLCA -0.17; TCGA BRCA -0.286; TCGA COAD -0.49; TCGA KIRC -0.578; TCGA KIRP -0.299; TCGA LGG -0.472; TCGA LIHC -0.478; TCGA LUAD -0.379; TCGA PRAD -0.325; TCGA SARC -0.269; TCGA STAD -0.683
hsa-miR-590-3p
PLCXD3
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.404; TCGA BRCA -0.785; TCGA CESC -0.583; TCGA COAD -0.907; TCGA ESCA -0.697; TCGA KIRC -0.789; TCGA LUAD -0.683; TCGA LUSC -0.599; TCGA PRAD -0.33; TCGA SARC -0.652; TCGA STAD -0.997; TCGA UCEC -0.856
hsa-miR-590-3p
LRP10
11 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; THCA
miRanda; mirMAP
TCGA BLCA -0.158; TCGA BRCA -0.197; TCGA ESCA -0.151; TCGA HNSC -0.094; TCGA KIRC -0.211; TCGA KIRP -0.148; TCGA LUAD -0.081; TCGA LUSC -0.225; TCGA PRAD -0.075; TCGA SARC -0.142; TCGA THCA -0.068
hsa-miR-590-3p
GSTM3
9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.356; TCGA BRCA -0.428; TCGA COAD -0.22; TCGA KIRC -1.032; TCGA KIRP -0.495; TCGA PRAD -0.175; TCGA SARC -0.204; TCGA STAD -0.339; TCGA UCEC -0.159
hsa-miR-590-3p
RGMB
13 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.156; TCGA BRCA -0.163; TCGA CESC -0.127; TCGA ESCA -0.401; TCGA KIRC -0.077; TCGA KIRP -0.152; TCGA LGG -0.426; TCGA LUAD -0.187; TCGA PAAD -0.132; TCGA PRAD -0.21; TCGA THCA -0.128; TCGA STAD -0.531; TCGA UCEC -0.16
hsa-miR-590-3p
SHISA3
13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.545; TCGA BRCA -0.296; TCGA COAD -0.757; TCGA ESCA -0.764; TCGA KIRC -1; TCGA KIRP -0.886; TCGA LGG -0.154; TCGA LIHC -0.475; TCGA LUAD -0.655; TCGA LUSC -0.578; TCGA SARC -0.67; TCGA STAD -0.965; TCGA UCEC -0.454
hsa-miR-590-3p
NIPSNAP3B
10 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; PRAD; SARC; THCA; UCEC
miRanda
TCGA BLCA -0.138; TCGA BRCA -0.328; TCGA CESC -0.19; TCGA COAD -0.364; TCGA KIRC -0.099; TCGA KIRP -0.146; TCGA PRAD -0.113; TCGA SARC -0.457; TCGA THCA -0.116; TCGA UCEC -0.139
hsa-miR-590-3p
PTPRS
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LUAD; SARC; THCA; STAD
miRanda
TCGA BLCA -0.175; TCGA BRCA -0.128; TCGA COAD -0.454; TCGA ESCA -0.382; TCGA HNSC -0.148; TCGA KIRP -0.128; TCGA LGG -0.161; TCGA LUAD -0.197; TCGA SARC -0.18; TCGA THCA -0.105; TCGA STAD -0.57
hsa-miR-590-3p
BAG3
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LIHC; LUAD; PAAD; PRAD; STAD
miRanda
TCGA BLCA -0.147; TCGA BRCA -0.096; TCGA HNSC -0.099; TCGA KIRC -0.109; TCGA KIRP -0.18; TCGA LIHC -0.123; TCGA LUAD -0.076; TCGA PAAD -0.188; TCGA PRAD -0.117; TCGA STAD -0.323
hsa-miR-590-3p
TTC28
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.288; TCGA BRCA -0.348; TCGA CESC -0.2; TCGA COAD -0.466; TCGA ESCA -0.248; TCGA HNSC -0.205; TCGA LGG -0.051; TCGA LUAD -0.256; TCGA LUSC -0.273; TCGA PAAD -0.184; TCGA PRAD -0.278; TCGA SARC -0.223; TCGA THCA -0.083; TCGA STAD -0.54
hsa-miR-590-3p
SEC62
13 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.087; TCGA CESC -0.111; TCGA COAD -0.062; TCGA ESCA -0.12; TCGA HNSC -0.079; TCGA KIRC -0.169; TCGA KIRP -0.203; TCGA LGG -0.062; TCGA LUSC -0.107; TCGA PAAD -0.093; TCGA PRAD -0.111; TCGA STAD -0.159; TCGA UCEC -0.132
hsa-miR-590-3p
RNF180
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.525; TCGA BRCA -0.377; TCGA CESC -0.44; TCGA COAD -0.687; TCGA ESCA -0.606; TCGA HNSC -0.307; TCGA KIRC -0.564; TCGA KIRP -0.451; TCGA LGG -0.153; TCGA LIHC -0.232; TCGA LUAD -0.396; TCGA LUSC -0.549; TCGA PRAD -0.286; TCGA SARC -0.589; TCGA STAD -0.742; TCGA UCEC -0.398
hsa-miR-590-3p
PTCHD1
10 cancers: BLCA; CESC; COAD; ESCA; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.653; TCGA CESC -0.505; TCGA COAD -0.781; TCGA ESCA -0.72; TCGA LUAD -0.382; TCGA LUSC -0.457; TCGA PRAD -0.729; TCGA SARC -1.153; TCGA STAD -1.432; TCGA UCEC -0.657
hsa-miR-590-3p
MAGEH1
10 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; LUSC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.2; TCGA BRCA -0.058; TCGA COAD -0.448; TCGA HNSC -0.104; TCGA KIRC -0.21; TCGA KIRP -0.241; TCGA LGG -0.222; TCGA LUSC -0.174; TCGA STAD -0.316; TCGA UCEC -0.55
hsa-miR-590-3p
GSPT2
11 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; STAD; UCEC
miRanda; miRNATAP
TCGA BLCA -0.198; TCGA BRCA -0.194; TCGA COAD -0.314; TCGA KIRC -0.215; TCGA KIRP -0.203; TCGA LGG -0.125; TCGA LUAD -0.184; TCGA LUSC -0.173; TCGA PRAD -0.165; TCGA STAD -0.34; TCGA UCEC -0.544
hsa-miR-590-3p
ITGBL1
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; STAD; UCEC
miRanda
TCGA BLCA -0.634; TCGA BRCA -0.332; TCGA CESC -0.605; TCGA COAD -1.031; TCGA ESCA -0.822; TCGA HNSC -0.597; TCGA LUAD -0.302; TCGA LUSC -0.688; TCGA PAAD -0.769; TCGA STAD -0.583; TCGA UCEC -0.275
hsa-miR-590-3p
RGS9
11 cancers: BLCA; COAD; ESCA; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.399; TCGA COAD -0.449; TCGA ESCA -0.584; TCGA KIRP -0.325; TCGA LGG -0.137; TCGA LUAD -0.195; TCGA LUSC -0.222; TCGA PRAD -0.379; TCGA SARC -0.676; TCGA STAD -0.583; TCGA UCEC -0.369
hsa-miR-590-3p
INHBB
9 cancers: BLCA; BRCA; COAD; HNSC; LUSC; PAAD; PRAD; THCA; STAD
miRanda
TCGA BLCA -0.37; TCGA BRCA -0.375; TCGA COAD -0.352; TCGA HNSC -0.214; TCGA LUSC -0.188; TCGA PAAD -0.163; TCGA PRAD -0.094; TCGA THCA -0.227; TCGA STAD -0.188
hsa-miR-590-3p
COL15A1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.343; TCGA BRCA -0.192; TCGA CESC -0.292; TCGA COAD -0.45; TCGA ESCA -0.178; TCGA HNSC -0.215; TCGA LIHC -0.655; TCGA LUAD -0.135; TCGA LUSC -0.389; TCGA PAAD -0.518; TCGA PRAD -0.113; TCGA SARC -0.293; TCGA THCA -0.157; TCGA STAD -0.317; TCGA UCEC -0.272
hsa-miR-590-3p
ACOX2
14 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.714; TCGA BRCA -0.512; TCGA CESC -0.293; TCGA ESCA -0.346; TCGA HNSC -0.149; TCGA KIRC -0.415; TCGA LUAD -0.303; TCGA LUSC -0.616; TCGA PAAD -0.221; TCGA PRAD -0.513; TCGA SARC -0.594; TCGA THCA -0.082; TCGA STAD -0.572; TCGA UCEC -0.308
hsa-miR-590-3p
RAB31
10 cancers: BLCA; BRCA; COAD; HNSC; LGG; LUSC; PAAD; PRAD; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.204; TCGA BRCA -0.097; TCGA COAD -0.585; TCGA HNSC -0.097; TCGA LGG -0.228; TCGA LUSC -0.357; TCGA PAAD -0.441; TCGA PRAD -0.228; TCGA STAD -0.412; TCGA UCEC -0.239
hsa-miR-590-3p
SLC2A4
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.996; TCGA BRCA -0.598; TCGA COAD -0.196; TCGA ESCA -0.678; TCGA KIRC -0.275; TCGA LUAD -0.157; TCGA PRAD -0.502; TCGA SARC -0.685; TCGA THCA -0.185; TCGA STAD -1.093; TCGA UCEC -0.61
hsa-miR-590-3p
SPATA6
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.287; TCGA BRCA -0.218; TCGA CESC -0.761; TCGA ESCA -0.219; TCGA HNSC -0.253; TCGA KIRC -0.305; TCGA KIRP -0.349; TCGA LUAD -0.242; TCGA LUSC -0.346; TCGA PAAD -0.135; TCGA PRAD -0.403; TCGA SARC -0.149; TCGA THCA -0.145; TCGA STAD -0.2; TCGA UCEC -0.125
hsa-miR-590-3p
ZBTB46
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.096; TCGA BRCA -0.071; TCGA CESC -0.172; TCGA COAD -0.295; TCGA ESCA -0.153; TCGA KIRC -0.129; TCGA LUAD -0.107; TCGA LUSC -0.329; TCGA THCA -0.1; TCGA STAD -0.075; TCGA UCEC -0.301
hsa-miR-590-3p
ARHGAP31
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.251; TCGA BRCA -0.093; TCGA CESC -0.159; TCGA COAD -0.391; TCGA ESCA -0.23; TCGA HNSC -0.226; TCGA LGG -0.217; TCGA LUAD -0.313; TCGA LUSC -0.597; TCGA PAAD -0.206; TCGA PRAD -0.168; TCGA THCA -0.126; TCGA STAD -0.291; TCGA UCEC -0.281
hsa-miR-590-3p
KIAA0430
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.142; TCGA BRCA -0.118; TCGA CESC -0.137; TCGA COAD -0.082; TCGA ESCA -0.173; TCGA HNSC -0.075; TCGA KIRC -0.083; TCGA KIRP -0.132; TCGA LGG -0.109; TCGA LUAD -0.161; TCGA LUSC -0.139; TCGA PRAD -0.115; TCGA SARC -0.154; TCGA STAD -0.217; TCGA UCEC -0.186
hsa-miR-590-3p
HINT3
11 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LUSC; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.102; TCGA CESC -0.085; TCGA HNSC -0.083; TCGA KIRC -0.206; TCGA KIRP -0.174; TCGA LGG -0.068; TCGA LUSC -0.075; TCGA SARC -0.091; TCGA THCA -0.075; TCGA STAD -0.138; TCGA UCEC -0.081
hsa-miR-590-3p
PCDHB12
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.209; TCGA BRCA -0.376; TCGA CESC -0.301; TCGA COAD -0.444; TCGA ESCA -0.28; TCGA HNSC -0.287; TCGA LIHC -0.228; TCGA LUAD -0.186; TCGA LUSC -0.311; TCGA PAAD -0.229; TCGA PRAD -0.153; TCGA SARC -0.197; TCGA STAD -0.424; TCGA UCEC -0.14
hsa-miR-590-3p
CHSY3
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.277; TCGA BRCA -0.161; TCGA CESC -0.233; TCGA COAD -0.459; TCGA HNSC -0.277; TCGA LUAD -0.192; TCGA LUSC -0.417; TCGA PAAD -0.531; TCGA THCA -0.097; TCGA STAD -0.119; TCGA UCEC -0.321
hsa-miR-590-3p
MTMR6
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.111; TCGA BRCA -0.052; TCGA CESC -0.172; TCGA COAD -0.1; TCGA HNSC -0.063; TCGA KIRP -0.108; TCGA LUAD -0.057; TCGA LUSC -0.223; TCGA PAAD -0.071; TCGA PRAD -0.098; TCGA SARC -0.063; TCGA THCA -0.053; TCGA STAD -0.128; TCGA UCEC -0.188
hsa-miR-590-3p
NLRP1
9 cancers: BLCA; BRCA; COAD; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.158; TCGA BRCA -0.159; TCGA COAD -0.319; TCGA LUAD -0.178; TCGA LUSC -0.303; TCGA PRAD -0.11; TCGA SARC -0.122; TCGA STAD -0.14; TCGA UCEC -0.195
hsa-miR-590-3p
PRDM5
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.261; TCGA BRCA -0.349; TCGA CESC -0.28; TCGA COAD -0.23; TCGA ESCA -0.446; TCGA HNSC -0.219; TCGA KIRC -0.363; TCGA KIRP -0.419; TCGA LUAD -0.181; TCGA LUSC -0.316; TCGA PAAD -0.231; TCGA PRAD -0.38; TCGA SARC -0.31; TCGA THCA -0.155; TCGA STAD -0.563; TCGA UCEC -0.341
hsa-miR-590-3p
COL14A1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda
TCGA BLCA -0.694; TCGA BRCA -0.722; TCGA CESC -0.418; TCGA COAD -0.721; TCGA ESCA -0.512; TCGA HNSC -0.398; TCGA KIRC -0.569; TCGA KIRP -0.396; TCGA LUAD -0.478; TCGA LUSC -0.663; TCGA PAAD -0.344; TCGA PRAD -0.251; TCGA SARC -0.535; TCGA THCA -0.319; TCGA STAD -0.761; TCGA UCEC -0.403
hsa-miR-590-3p
CHRNA3
9 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; PAAD; SARC; STAD
miRanda
TCGA BLCA -0.149; TCGA CESC -0.324; TCGA COAD -1.027; TCGA ESCA -0.557; TCGA HNSC -0.224; TCGA LGG -0.212; TCGA PAAD -0.392; TCGA SARC -0.339; TCGA STAD -1.052
hsa-miR-590-3p
FYCO1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.381; TCGA BRCA -0.228; TCGA CESC -0.238; TCGA COAD -0.13; TCGA ESCA -0.364; TCGA HNSC -0.229; TCGA KIRC -0.237; TCGA LUAD -0.235; TCGA LUSC -0.312; TCGA PAAD -0.133; TCGA PRAD -0.212; TCGA SARC -0.474; TCGA THCA -0.093; TCGA STAD -0.447; TCGA UCEC -0.209
hsa-miR-590-3p
TSPAN2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.569; TCGA BRCA -0.138; TCGA CESC -0.47; TCGA COAD -0.605; TCGA ESCA -0.633; TCGA HNSC -0.277; TCGA KIRC -0.259; TCGA LIHC -0.275; TCGA LUAD -0.116; TCGA LUSC -0.546; TCGA PAAD -0.311; TCGA PRAD -0.442; TCGA SARC -0.903; TCGA STAD -0.831; TCGA UCEC -1.005
hsa-miR-590-3p
ROCK2
14 cancers: BLCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.186; TCGA CESC -0.285; TCGA COAD -0.11; TCGA HNSC -0.158; TCGA KIRC -0.242; TCGA KIRP -0.48; TCGA LUAD -0.108; TCGA LUSC -0.155; TCGA PAAD -0.264; TCGA PRAD -0.317; TCGA SARC -0.5; TCGA THCA -0.168; TCGA STAD -0.177; TCGA UCEC -0.229
hsa-miR-590-3p
GNPTAB
9 cancers: BLCA; CESC; COAD; KIRP; LUAD; LUSC; PAAD; PRAD; THCA
miRanda
TCGA BLCA -0.06; TCGA CESC -0.085; TCGA COAD -0.06; TCGA KIRP -0.097; TCGA LUAD -0.116; TCGA LUSC -0.109; TCGA PAAD -0.083; TCGA PRAD -0.267; TCGA THCA -0.073
hsa-miR-590-3p
EID1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRanda; mirMAP; miRNATAP
TCGA BLCA -0.197; TCGA BRCA -0.163; TCGA CESC -0.113; TCGA COAD -0.164; TCGA ESCA -0.097; TCGA KIRC -0.062; TCGA KIRP -0.185; TCGA LGG -0.051; TCGA LUAD -0.082; TCGA LUSC -0.06; TCGA PAAD -0.097; TCGA PRAD -0.076; TCGA SARC -0.149; TCGA THCA -0.055; TCGA STAD -0.32; TCGA UCEC -0.265
hsa-miR-590-3p
HPGDS
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRanda
TCGA BLCA -0.593; TCGA BRCA -0.457; TCGA COAD -0.603; TCGA ESCA -0.467; TCGA HNSC -0.157; TCGA LUAD -0.575; TCGA LUSC -0.715; TCGA PAAD -0.522; TCGA PRAD -0.135; TCGA STAD -0.429; TCGA UCEC -0.36
hsa-miR-590-3p
LDB3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
miRanda
TCGA BLCA -0.735; TCGA BRCA -0.344; TCGA CESC -0.403; TCGA COAD -0.935; TCGA ESCA -0.949; TCGA HNSC -0.502; TCGA KIRC -0.183; TCGA LIHC -0.262; TCGA LUAD -0.348; TCGA LUSC -0.452; TCGA PRAD -0.612; TCGA SARC -0.815; TCGA STAD -1.431; TCGA UCEC -0.348
hsa-miR-590-3p
BCHE
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
miRanda; mirMAP
TCGA BLCA -0.839; TCGA BRCA -0.54; TCGA CESC -0.561; TCGA COAD -1.021; TCGA ESCA -0.849; TCGA HNSC -0.608; TCGA KIRC -0.438; TCGA LGG -0.271; TCGA LUAD -0.582; TCGA LUSC -0.474; TCGA PAAD -0.414; TCGA PRAD -0.496; TCGA SARC -1.189; TCGA STAD -1.235; TCGA UCEC -1.356
hsa-miR-590-3p
NAV1
10 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LIHC; PAAD; THCA; STAD
miRanda; mirMAP
TCGA BLCA -0.185; TCGA BRCA -0.088; TCGA CESC -0.206; TCGA COAD -0.387; TCGA HNSC -0.162; TCGA LGG -0.241; TCGA LIHC -0.131; TCGA PAAD -0.141; TCGA THCA -0.178; TCGA STAD -0.186
hsa-miR-590-3p
CD36
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; STAD; UCEC
miRanda
TCGA BLCA -0.314; TCGA BRCA -0.664; TCGA CESC -0.328; TCGA COAD -0.516; TCGA ESCA -0.271; TCGA HNSC -0.404; TCGA LUAD -0.349; TCGA LUSC -0.746; TCGA STAD -0.356; TCGA UCEC -0.338
hsa-miR-590-3p
MYCBP2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.129; TCGA BRCA -0.126; TCGA CESC -0.162; TCGA COAD -0.147; TCGA ESCA -0.139; TCGA HNSC -0.156; TCGA KIRC -0.174; TCGA KIRP -0.124; TCGA LGG -0.142; TCGA LUAD -0.129; TCGA LUSC -0.168; TCGA PRAD -0.231; TCGA SARC -0.13; TCGA STAD -0.133; TCGA UCEC -0.139
hsa-miR-590-3p
NFIX
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.347; TCGA BRCA -0.108; TCGA CESC -0.206; TCGA COAD -0.107; TCGA ESCA -0.261; TCGA HNSC -0.128; TCGA KIRP -0.229; TCGA LGG -0.131; TCGA LUAD -0.465; TCGA LUSC -0.349; TCGA PAAD -0.327; TCGA SARC -0.276; TCGA THCA -0.171; TCGA STAD -0.349; TCGA UCEC -0.263
hsa-miR-590-3p
ST3GAL1
10 cancers: BLCA; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.106; TCGA COAD -0.307; TCGA HNSC -0.115; TCGA LUAD -0.194; TCGA LUSC -0.223; TCGA PAAD -0.232; TCGA PRAD -0.134; TCGA SARC -0.236; TCGA THCA -0.127; TCGA UCEC -0.11
hsa-miR-590-3p
VIM
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.322; TCGA BRCA -0.145; TCGA CESC -0.219; TCGA COAD -0.435; TCGA ESCA -0.183; TCGA HNSC -0.118; TCGA LIHC -0.17; TCGA LUAD -0.13; TCGA LUSC -0.508; TCGA PAAD -0.164; TCGA PRAD -0.079; TCGA STAD -0.21; TCGA UCEC -0.164
hsa-miR-590-3p
PREX2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.59; TCGA BRCA -0.682; TCGA CESC -0.463; TCGA COAD -0.759; TCGA ESCA -0.509; TCGA HNSC -0.364; TCGA KIRP -0.759; TCGA LGG -0.234; TCGA LUAD -0.489; TCGA LUSC -0.78; TCGA PAAD -0.525; TCGA PRAD -0.337; TCGA SARC -0.406; TCGA STAD -0.503
hsa-miR-590-3p
FOXN3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.271; TCGA BRCA -0.186; TCGA CESC -0.176; TCGA COAD -0.203; TCGA ESCA -0.274; TCGA HNSC -0.17; TCGA LGG -0.092; TCGA LUAD -0.107; TCGA LUSC -0.198; TCGA PAAD -0.111; TCGA PRAD -0.112; TCGA SARC -0.321; TCGA STAD -0.392; TCGA UCEC -0.206
hsa-miR-590-3p
ATP2B4
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.402; TCGA BRCA -0.107; TCGA CESC -0.192; TCGA COAD -0.425; TCGA ESCA -0.381; TCGA HNSC -0.129; TCGA KIRP -0.105; TCGA LUAD -0.218; TCGA LUSC -0.276; TCGA PAAD -0.282; TCGA PRAD -0.517; TCGA SARC -0.489; TCGA STAD -0.7; TCGA UCEC -0.21
hsa-miR-590-3p
ASB1
11 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LGG; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.061; TCGA BRCA -0.176; TCGA COAD -0.079; TCGA HNSC -0.081; TCGA KIRC -0.251; TCGA KIRP -0.185; TCGA LGG -0.161; TCGA PRAD -0.125; TCGA SARC -0.125; TCGA STAD -0.208; TCGA UCEC -0.136
hsa-miR-590-3p
FBXW11
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.094; TCGA BRCA -0.083; TCGA CESC -0.101; TCGA COAD -0.066; TCGA ESCA -0.122; TCGA KIRC -0.16; TCGA KIRP -0.209; TCGA LGG -0.091; TCGA LUAD -0.15; TCGA LUSC -0.13; TCGA PRAD -0.061; TCGA SARC -0.107; TCGA THCA -0.084; TCGA STAD -0.112; TCGA UCEC -0.133
hsa-miR-590-3p
MRVI1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.785; TCGA BRCA -0.319; TCGA CESC -0.379; TCGA COAD -0.693; TCGA ESCA -0.766; TCGA HNSC -0.288; TCGA LGG -0.272; TCGA LIHC -0.363; TCGA LUAD -0.288; TCGA LUSC -0.571; TCGA PAAD -0.447; TCGA PRAD -0.436; TCGA SARC -1.093; TCGA THCA -0.224; TCGA STAD -0.868; TCGA UCEC -0.485
hsa-miR-590-3p
WSCD2
13 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.723; TCGA BRCA -0.516; TCGA COAD -1.022; TCGA ESCA -1.218; TCGA KIRC -1.085; TCGA KIRP -0.531; TCGA LGG -0.822; TCGA LUAD -0.401; TCGA PAAD -0.371; TCGA PRAD -0.587; TCGA SARC -0.942; TCGA STAD -1.081; TCGA UCEC -0.905
hsa-miR-590-3p
ADCY2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.748; TCGA BRCA -0.231; TCGA CESC -0.567; TCGA COAD -0.816; TCGA ESCA -1.049; TCGA HNSC -0.511; TCGA LGG -0.238; TCGA LUAD -0.56; TCGA PAAD -0.355; TCGA PRAD -0.263; TCGA SARC -1.074; TCGA STAD -0.963; TCGA UCEC -0.575
hsa-miR-590-3p
RUNX1T1
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.788; TCGA BRCA -0.565; TCGA CESC -0.657; TCGA COAD -0.885; TCGA ESCA -0.718; TCGA HNSC -0.413; TCGA KIRC -0.406; TCGA KIRP -0.434; TCGA LGG -0.325; TCGA LUAD -0.337; TCGA LUSC -0.767; TCGA PAAD -0.422; TCGA PRAD -0.481; TCGA SARC -0.343; TCGA STAD -0.78; TCGA UCEC -0.422
hsa-miR-590-3p
MEF2C
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.409; TCGA BRCA -0.148; TCGA COAD -0.436; TCGA ESCA -0.248; TCGA HNSC -0.26; TCGA LIHC -0.105; TCGA LUAD -0.21; TCGA LUSC -0.423; TCGA PRAD -0.156; TCGA SARC -0.199; TCGA STAD -0.343; TCGA UCEC -0.391
hsa-miR-590-3p
ULK2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.166; TCGA BRCA -0.116; TCGA CESC -0.131; TCGA COAD -0.173; TCGA ESCA -0.188; TCGA KIRC -0.051; TCGA LUAD -0.147; TCGA LUSC -0.145; TCGA SARC -0.279; TCGA THCA -0.089; TCGA STAD -0.413; TCGA UCEC -0.126
hsa-miR-590-3p
CD59
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.076; TCGA BRCA -0.063; TCGA COAD -0.12; TCGA ESCA -0.139; TCGA HNSC -0.109; TCGA KIRC -0.112; TCGA LIHC -0.176; TCGA LUAD -0.126; TCGA LUSC -0.305; TCGA PAAD -0.216; TCGA PRAD -0.111; TCGA THCA -0.114; TCGA STAD -0.135; TCGA UCEC -0.154
hsa-miR-590-3p
ARHGAP28
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LGG; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.184; TCGA BRCA -0.156; TCGA CESC -0.301; TCGA COAD -0.429; TCGA HNSC -0.418; TCGA LGG -0.264; TCGA LUAD -0.169; TCGA LUSC -0.237; TCGA PAAD -0.296; TCGA STAD -0.329; TCGA UCEC -0.482
hsa-miR-590-3p
ZFHX4
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; PAAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.497; TCGA BRCA -0.444; TCGA CESC -0.348; TCGA COAD -0.995; TCGA ESCA -0.469; TCGA HNSC -0.337; TCGA LGG -0.102; TCGA LUAD -0.216; TCGA PAAD -0.603; TCGA STAD -0.673; TCGA UCEC -0.419
hsa-miR-590-3p
TGFB2
12 cancers: BLCA; BRCA; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.266; TCGA BRCA -0.219; TCGA COAD -0.534; TCGA HNSC -0.18; TCGA KIRC -0.293; TCGA KIRP -0.192; TCGA LUAD -0.247; TCGA LUSC -0.511; TCGA PAAD -0.529; TCGA PRAD -0.223; TCGA STAD -0.301; TCGA UCEC -0.395
hsa-miR-590-3p
PCSK5
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.477; TCGA BRCA -0.455; TCGA CESC -0.508; TCGA COAD -0.319; TCGA ESCA -0.289; TCGA HNSC -0.353; TCGA LUAD -0.367; TCGA LUSC -0.573; TCGA PAAD -0.56; TCGA PRAD -0.159; TCGA STAD -0.194; TCGA UCEC -0.314
hsa-miR-590-3p
TRIP11
14 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.089; TCGA BRCA -0.077; TCGA ESCA -0.138; TCGA HNSC -0.118; TCGA KIRC -0.327; TCGA KIRP -0.351; TCGA LUAD -0.083; TCGA LUSC -0.091; TCGA PAAD -0.125; TCGA PRAD -0.124; TCGA SARC -0.098; TCGA THCA -0.116; TCGA STAD -0.104; TCGA UCEC -0.077
hsa-miR-590-3p
NFATC2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; UCEC
mirMAP
TCGA BLCA -0.322; TCGA BRCA -0.208; TCGA CESC -0.384; TCGA COAD -0.338; TCGA ESCA -0.274; TCGA HNSC -0.237; TCGA KIRP -0.424; TCGA LUAD -0.265; TCGA LUSC -0.624; TCGA PRAD -0.416; TCGA UCEC -0.236
hsa-miR-590-3p
DRP2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.245; TCGA CESC -0.177; TCGA COAD -0.307; TCGA ESCA -0.364; TCGA HNSC -0.229; TCGA LGG -0.353; TCGA PAAD -0.391; TCGA PRAD -0.259; TCGA SARC -0.287; TCGA STAD -0.629; TCGA UCEC -0.263
hsa-miR-590-3p
SEC14L5
10 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; SARC; STAD
mirMAP
TCGA BLCA -0.205; TCGA BRCA -0.205; TCGA CESC -0.236; TCGA ESCA -0.248; TCGA HNSC -0.218; TCGA KIRC -0.198; TCGA KIRP -0.205; TCGA LUAD -0.286; TCGA SARC -0.358; TCGA STAD -0.377
hsa-miR-590-3p
CRISPLD2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.53; TCGA BRCA -0.192; TCGA CESC -0.246; TCGA COAD -0.485; TCGA ESCA -0.433; TCGA HNSC -0.354; TCGA KIRC -0.191; TCGA LGG -0.116; TCGA LUAD -0.098; TCGA LUSC -0.57; TCGA PAAD -0.394; TCGA PRAD -0.27; TCGA STAD -0.488; TCGA UCEC -0.392
hsa-miR-590-3p
SLC30A4
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.189; TCGA BRCA -0.186; TCGA CESC -0.195; TCGA COAD -0.198; TCGA ESCA -0.168; TCGA HNSC -0.294; TCGA KIRC -0.203; TCGA KIRP -0.267; TCGA LGG -0.112; TCGA LUAD -0.093; TCGA LUSC -0.132; TCGA PRAD -0.25; TCGA SARC -0.278; TCGA STAD -0.326
hsa-miR-590-3p
CAV1
10 cancers: BLCA; BRCA; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.302; TCGA BRCA -0.483; TCGA COAD -0.403; TCGA ESCA -0.293; TCGA LUAD -0.229; TCGA LUSC -0.673; TCGA PAAD -0.273; TCGA PRAD -0.433; TCGA STAD -0.577; TCGA UCEC -0.472
hsa-miR-590-3p
FKBP14
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.078; TCGA BRCA -0.068; TCGA CESC -0.171; TCGA COAD -0.198; TCGA ESCA -0.133; TCGA HNSC -0.142; TCGA KIRP -0.112; TCGA PAAD -0.329; TCGA PRAD -0.116; TCGA THCA -0.119; TCGA STAD -0.235; TCGA UCEC -0.084
hsa-miR-590-3p
TBC1D12
9 cancers: BLCA; BRCA; CESC; LUAD; LUSC; PAAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.064; TCGA BRCA -0.129; TCGA CESC -0.149; TCGA LUAD -0.058; TCGA LUSC -0.115; TCGA PAAD -0.098; TCGA THCA -0.11; TCGA STAD -0.107; TCGA UCEC -0.086
hsa-miR-590-3p
GHR
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.634; TCGA BRCA -0.559; TCGA CESC -0.297; TCGA COAD -0.66; TCGA ESCA -0.378; TCGA HNSC -0.443; TCGA KIRC -0.447; TCGA KIRP -0.251; TCGA LUAD -0.443; TCGA LUSC -0.333; TCGA PRAD -0.418; TCGA SARC -0.527; TCGA STAD -0.856; TCGA UCEC -0.677
hsa-miR-590-3p
ARRDC3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.145; TCGA BRCA -0.159; TCGA CESC -0.128; TCGA COAD -0.158; TCGA ESCA -0.218; TCGA HNSC -0.132; TCGA KIRP -0.301; TCGA LUAD -0.209; TCGA LUSC -0.234; TCGA PRAD -0.174; TCGA SARC -0.14; TCGA THCA -0.092; TCGA STAD -0.258; TCGA UCEC -0.108
hsa-miR-590-3p
DNAJC27
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.115; TCGA BRCA -0.132; TCGA CESC -0.086; TCGA ESCA -0.121; TCGA KIRC -0.238; TCGA KIRP -0.233; TCGA LGG -0.053; TCGA LUAD -0.073; TCGA PRAD -0.108; TCGA SARC -0.152; TCGA STAD -0.266; TCGA UCEC -0.17
hsa-miR-590-3p
RTN4
10 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.083; TCGA BRCA -0.086; TCGA HNSC -0.122; TCGA KIRC -0.128; TCGA KIRP -0.18; TCGA LUSC -0.11; TCGA PAAD -0.168; TCGA PRAD -0.12; TCGA STAD -0.21; TCGA UCEC -0.141
hsa-miR-590-3p
PARD3B
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.478; TCGA BRCA -0.384; TCGA CESC -0.654; TCGA COAD -0.302; TCGA ESCA -0.429; TCGA HNSC -0.255; TCGA KIRC -0.715; TCGA KIRP -0.642; TCGA LGG -0.176; TCGA LUAD -0.341; TCGA LUSC -0.61; TCGA PAAD -0.538; TCGA PRAD -0.276; TCGA SARC -0.507; TCGA THCA -0.277; TCGA STAD -0.374
hsa-miR-590-3p
QSOX1
9 cancers: BLCA; BRCA; CESC; HNSC; KIRP; LUAD; LUSC; PRAD; THCA
mirMAP
TCGA BLCA -0.109; TCGA BRCA -0.089; TCGA CESC -0.164; TCGA HNSC -0.204; TCGA KIRP -0.172; TCGA LUAD -0.132; TCGA LUSC -0.288; TCGA PRAD -0.157; TCGA THCA -0.144
hsa-miR-590-3p
MTR
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.114; TCGA BRCA -0.057; TCGA CESC -0.116; TCGA ESCA -0.137; TCGA KIRC -0.078; TCGA LUAD -0.157; TCGA LUSC -0.09; TCGA PAAD -0.136; TCGA PRAD -0.103; TCGA SARC -0.254; TCGA STAD -0.272; TCGA UCEC -0.147
hsa-miR-590-3p
PROX1
12 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.254; TCGA BRCA -0.314; TCGA CESC -0.443; TCGA COAD -0.188; TCGA HNSC -0.408; TCGA KIRC -1.33; TCGA KIRP -0.947; TCGA LGG -0.125; TCGA LUAD -0.441; TCGA LUSC -0.305; TCGA PRAD -0.575; TCGA UCEC -0.346
hsa-miR-590-3p
C1orf198
12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.095; TCGA CESC -0.152; TCGA ESCA -0.085; TCGA HNSC -0.18; TCGA KIRC -0.083; TCGA LIHC -0.24; TCGA LUAD -0.162; TCGA LUSC -0.247; TCGA PAAD -0.214; TCGA SARC -0.179; TCGA STAD -0.246; TCGA UCEC -0.082
hsa-miR-590-3p
CNRIP1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.495; TCGA BRCA -0.36; TCGA CESC -0.28; TCGA COAD -0.459; TCGA ESCA -0.346; TCGA HNSC -0.215; TCGA LGG -0.283; TCGA LUAD -0.173; TCGA LUSC -0.531; TCGA PAAD -0.146; TCGA PRAD -0.179; TCGA SARC -0.107; TCGA STAD -0.454; TCGA UCEC -0.438
hsa-miR-590-3p
PLEKHG1
10 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUSC; PRAD; THCA; STAD
mirMAP
TCGA BLCA -0.118; TCGA CESC -0.359; TCGA COAD -0.164; TCGA ESCA -0.176; TCGA HNSC -0.211; TCGA KIRP -0.176; TCGA LUSC -0.185; TCGA PRAD -0.13; TCGA THCA -0.118; TCGA STAD -0.092
hsa-miR-590-3p
ARAP3
12 cancers: BLCA; BRCA; CESC; COAD; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.085; TCGA BRCA -0.173; TCGA CESC -0.295; TCGA COAD -0.204; TCGA LIHC -0.188; TCGA LUAD -0.186; TCGA LUSC -0.366; TCGA PAAD -0.154; TCGA PRAD -0.149; TCGA SARC -0.181; TCGA THCA -0.196; TCGA UCEC -0.183
hsa-miR-590-3p
SMAD9
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.494; TCGA BRCA -0.314; TCGA CESC -0.466; TCGA COAD -0.514; TCGA ESCA -0.59; TCGA HNSC -0.412; TCGA KIRC -0.246; TCGA KIRP -0.316; TCGA LGG -0.351; TCGA LUAD -0.408; TCGA LUSC -0.464; TCGA PRAD -0.305; TCGA SARC -0.476; TCGA STAD -0.776
hsa-miR-590-3p
SOCS2
10 cancers: BLCA; BRCA; COAD; ESCA; KIRC; LUAD; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.138; TCGA BRCA -0.473; TCGA COAD -0.124; TCGA ESCA -0.275; TCGA KIRC -0.418; TCGA LUAD -0.166; TCGA LUSC -0.252; TCGA SARC -0.616; TCGA STAD -0.283; TCGA UCEC -0.497
hsa-miR-590-3p
CPXM2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.85; TCGA BRCA -0.285; TCGA CESC -0.335; TCGA COAD -0.801; TCGA ESCA -0.805; TCGA HNSC -0.28; TCGA KIRC -0.23; TCGA LIHC -0.441; TCGA LUAD -0.287; TCGA LUSC -0.312; TCGA PAAD -0.527; TCGA PRAD -0.203; TCGA SARC -0.652; TCGA STAD -0.989; TCGA UCEC -0.5
hsa-miR-590-3p
BICC1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.428; TCGA BRCA -0.357; TCGA CESC -0.464; TCGA COAD -0.913; TCGA ESCA -0.535; TCGA HNSC -0.501; TCGA KIRC -0.418; TCGA KIRP -0.55; TCGA LUAD -0.256; TCGA LUSC -0.751; TCGA PAAD -0.901; TCGA PRAD -0.395; TCGA STAD -0.364; TCGA UCEC -0.209
hsa-miR-590-3p
ITIH5
14 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.737; TCGA BRCA -0.648; TCGA COAD -0.507; TCGA ESCA -0.331; TCGA KIRC -0.198; TCGA KIRP -0.477; TCGA LUAD -0.469; TCGA LUSC -0.801; TCGA PAAD -0.303; TCGA PRAD -0.364; TCGA SARC -0.535; TCGA THCA -0.22; TCGA STAD -0.748; TCGA UCEC -0.216
hsa-miR-590-3p
CD93
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.311; TCGA BRCA -0.253; TCGA CESC -0.207; TCGA COAD -0.389; TCGA ESCA -0.176; TCGA HNSC -0.21; TCGA KIRP -0.163; TCGA LIHC -0.137; TCGA LUAD -0.275; TCGA LUSC -0.686; TCGA PAAD -0.246; TCGA PRAD -0.119; TCGA THCA -0.22; TCGA STAD -0.198; TCGA UCEC -0.332
hsa-miR-590-3p
AMOT
9 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LUAD; PRAD; SARC; UCEC
mirMAP
TCGA BLCA -0.244; TCGA CESC -0.434; TCGA HNSC -0.254; TCGA KIRC -0.295; TCGA KIRP -0.26; TCGA LUAD -0.205; TCGA PRAD -0.292; TCGA SARC -0.366; TCGA UCEC -0.197
hsa-miR-590-3p
HIP1
12 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.111; TCGA BRCA -0.107; TCGA COAD -0.223; TCGA KIRC -0.315; TCGA KIRP -0.365; TCGA LUAD -0.241; TCGA LUSC -0.174; TCGA PAAD -0.396; TCGA PRAD -0.276; TCGA SARC -0.221; TCGA THCA -0.186; TCGA STAD -0.177
hsa-miR-590-3p
CGNL1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.578; TCGA BRCA -0.22; TCGA CESC -0.57; TCGA COAD -0.441; TCGA ESCA -0.285; TCGA HNSC -0.309; TCGA KIRC -0.739; TCGA KIRP -0.491; TCGA LUAD -0.398; TCGA LUSC -0.653; TCGA PAAD -0.256; TCGA PRAD -0.174; TCGA SARC -0.398; TCGA STAD -0.675; TCGA UCEC -0.319
hsa-miR-590-3p
TMOD2
15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.159; TCGA CESC -0.307; TCGA COAD -0.249; TCGA ESCA -0.176; TCGA HNSC -0.103; TCGA KIRC -0.111; TCGA KIRP -0.372; TCGA LGG -0.18; TCGA LIHC -0.234; TCGA LUAD -0.22; TCGA LUSC -0.243; TCGA PRAD -0.205; TCGA THCA -0.158; TCGA STAD -0.481; TCGA UCEC -0.421
hsa-miR-590-3p
LDLR
9 cancers: BLCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC
mirMAP
TCGA BLCA -0.145; TCGA KIRC -0.417; TCGA KIRP -0.327; TCGA LGG -0.111; TCGA LUAD -0.236; TCGA LUSC -0.374; TCGA PAAD -0.298; TCGA PRAD -0.16; TCGA SARC -0.333
hsa-miR-590-3p
SERINC3
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.058; TCGA BRCA -0.09; TCGA CESC -0.146; TCGA COAD -0.082; TCGA ESCA -0.087; TCGA HNSC -0.146; TCGA KIRP -0.206; TCGA LUAD -0.067; TCGA LUSC -0.131; TCGA PAAD -0.115; TCGA PRAD -0.132; TCGA SARC -0.063; TCGA THCA -0.152; TCGA STAD -0.056; TCGA UCEC -0.129
hsa-miR-590-3p
BHMT2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.958; TCGA BRCA -0.506; TCGA CESC -0.389; TCGA COAD -0.924; TCGA ESCA -0.774; TCGA HNSC -0.203; TCGA LUSC -0.516; TCGA PAAD -0.321; TCGA PRAD -0.461; TCGA SARC -0.619; TCGA STAD -0.961; TCGA UCEC -0.43
hsa-miR-590-3p
ZBED3
13 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.153; TCGA BRCA -0.197; TCGA CESC -0.302; TCGA KIRC -0.258; TCGA KIRP -0.247; TCGA LGG -0.088; TCGA LUAD -0.217; TCGA LUSC -0.135; TCGA PAAD -0.178; TCGA PRAD -0.22; TCGA SARC -0.436; TCGA THCA -0.134; TCGA STAD -0.108
hsa-miR-590-3p
DSTYK
17 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.071; TCGA CESC -0.183; TCGA COAD -0.137; TCGA ESCA -0.138; TCGA HNSC -0.123; TCGA KIRC -0.259; TCGA KIRP -0.208; TCGA LGG -0.105; TCGA LIHC -0.195; TCGA LUAD -0.136; TCGA LUSC -0.127; TCGA PAAD -0.122; TCGA PRAD -0.085; TCGA SARC -0.153; TCGA THCA -0.137; TCGA STAD -0.255; TCGA UCEC -0.189
hsa-miR-590-3p
RNF38
14 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.145; TCGA CESC -0.103; TCGA COAD -0.11; TCGA ESCA -0.154; TCGA KIRC -0.233; TCGA KIRP -0.219; TCGA LGG -0.083; TCGA LUAD -0.146; TCGA LUSC -0.106; TCGA PRAD -0.123; TCGA SARC -0.329; TCGA THCA -0.078; TCGA STAD -0.283; TCGA UCEC -0.162
hsa-miR-590-3p
KIF13A
16 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.225; TCGA BRCA -0.211; TCGA CESC -0.14; TCGA ESCA -0.179; TCGA HNSC -0.167; TCGA KIRC -0.214; TCGA KIRP -0.315; TCGA LGG -0.197; TCGA LUAD -0.229; TCGA LUSC -0.111; TCGA PAAD -0.214; TCGA PRAD -0.209; TCGA SARC -0.248; TCGA THCA -0.138; TCGA STAD -0.231; TCGA UCEC -0.194
hsa-miR-590-3p
C11orf70
11 cancers: BLCA; BRCA; CESC; COAD; KIRC; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.17; TCGA BRCA -0.244; TCGA CESC -0.297; TCGA COAD -0.274; TCGA KIRC -0.351; TCGA LUSC -0.251; TCGA PAAD -0.355; TCGA PRAD -0.375; TCGA SARC -0.17; TCGA STAD -0.235; TCGA UCEC -0.207
hsa-miR-590-3p
FAM13A
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.127; TCGA BRCA -0.214; TCGA CESC -0.21; TCGA ESCA -0.234; TCGA HNSC -0.142; TCGA LGG -0.073; TCGA PRAD -0.081; TCGA SARC -0.213; TCGA STAD -0.216
hsa-miR-590-3p
KIAA1644
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.957; TCGA CESC -0.493; TCGA COAD -0.785; TCGA ESCA -0.408; TCGA HNSC -0.305; TCGA LGG -0.634; TCGA LUSC -0.427; TCGA PAAD -0.367; TCGA PRAD -0.629; TCGA STAD -0.954; TCGA UCEC -0.699
hsa-miR-590-3p
C14orf37
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.203; TCGA BRCA -0.313; TCGA CESC -0.281; TCGA COAD -0.405; TCGA ESCA -0.349; TCGA HNSC -0.446; TCGA KIRC -1.022; TCGA KIRP -0.502; TCGA LGG -0.112; TCGA LUAD -0.142; TCGA PAAD -0.353; TCGA PRAD -0.365; TCGA THCA -0.115; TCGA STAD -0.124; TCGA UCEC -0.299
hsa-miR-590-3p
DCAF5
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUAD; LUSC; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.061; TCGA BRCA -0.115; TCGA CESC -0.082; TCGA ESCA -0.133; TCGA HNSC -0.096; TCGA LGG -0.079; TCGA LUAD -0.08; TCGA LUSC -0.107; TCGA PRAD -0.055; TCGA SARC -0.072; TCGA STAD -0.152
hsa-miR-590-3p
NTRK3
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.729; TCGA BRCA -0.509; TCGA CESC -0.474; TCGA COAD -0.862; TCGA ESCA -0.716; TCGA KIRC -0.531; TCGA LGG -0.17; TCGA LUAD -0.422; TCGA LUSC -0.657; TCGA PRAD -0.409; TCGA SARC -0.73; TCGA STAD -0.873; TCGA UCEC -0.6
hsa-miR-590-3p
ZFHX3
14 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.146; TCGA BRCA -0.124; TCGA CESC -0.123; TCGA COAD -0.193; TCGA HNSC -0.196; TCGA KIRC -0.179; TCGA KIRP -0.191; TCGA LUAD -0.215; TCGA LUSC -0.135; TCGA PAAD -0.117; TCGA PRAD -0.13; TCGA SARC -0.202; TCGA THCA -0.128; TCGA STAD -0.317
hsa-miR-590-3p
MYOCD
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -1.158; TCGA BRCA -0.594; TCGA CESC -0.775; TCGA COAD -0.958; TCGA ESCA -1.125; TCGA KIRC -0.419; TCGA KIRP -0.323; TCGA LIHC -0.375; TCGA LUAD -0.57; TCGA LUSC -0.946; TCGA PAAD -0.392; TCGA PRAD -0.811; TCGA SARC -2.046; TCGA THCA -0.233; TCGA STAD -1.197; TCGA UCEC -0.938
hsa-miR-590-3p
ASXL3
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.664; TCGA BRCA -0.514; TCGA CESC -0.685; TCGA COAD -0.268; TCGA ESCA -0.559; TCGA KIRC -0.674; TCGA KIRP -0.379; TCGA LGG -0.166; TCGA LUAD -0.327; TCGA LUSC -0.713; TCGA PRAD -0.52; TCGA SARC -0.395; TCGA STAD -0.6; TCGA UCEC -0.733
hsa-miR-590-3p
CTTNBP2NL
12 cancers: BLCA; CESC; COAD; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.088; TCGA CESC -0.176; TCGA COAD -0.064; TCGA HNSC -0.115; TCGA LUAD -0.098; TCGA LUSC -0.123; TCGA PAAD -0.196; TCGA PRAD -0.118; TCGA SARC -0.072; TCGA THCA -0.087; TCGA STAD -0.131; TCGA UCEC -0.124
hsa-miR-590-3p
RHBDD1
11 cancers: BLCA; COAD; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.131; TCGA COAD -0.08; TCGA HNSC -0.131; TCGA KIRC -0.08; TCGA KIRP -0.236; TCGA PAAD -0.089; TCGA PRAD -0.19; TCGA SARC -0.219; TCGA THCA -0.07; TCGA STAD -0.053; TCGA UCEC -0.066
hsa-miR-590-3p
CTDSPL
12 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.12; TCGA BRCA -0.168; TCGA ESCA -0.19; TCGA KIRC -0.477; TCGA KIRP -0.214; TCGA LUAD -0.277; TCGA LUSC -0.201; TCGA PAAD -0.208; TCGA SARC -0.15; TCGA THCA -0.077; TCGA STAD -0.141; TCGA UCEC -0.081
hsa-miR-590-3p
ZNF660
14 cancers: BLCA; BRCA; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.341; TCGA BRCA -0.279; TCGA ESCA -0.381; TCGA KIRC -0.288; TCGA KIRP -0.252; TCGA LGG -0.167; TCGA LUAD -0.25; TCGA LUSC -0.381; TCGA PAAD -0.257; TCGA PRAD -0.43; TCGA SARC -0.447; TCGA THCA -0.127; TCGA STAD -0.665; TCGA UCEC -0.296
hsa-miR-590-3p
TBCK
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.106; TCGA BRCA -0.103; TCGA CESC -0.166; TCGA COAD -0.085; TCGA HNSC -0.106; TCGA KIRC -0.161; TCGA LUAD -0.065; TCGA LUSC -0.084; TCGA PAAD -0.095; TCGA PRAD -0.114; TCGA SARC -0.112; TCGA THCA -0.053; TCGA STAD -0.128
hsa-miR-590-3p
RNF217
9 cancers: BLCA; BRCA; COAD; HNSC; KIRP; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.225; TCGA BRCA -0.097; TCGA COAD -0.306; TCGA HNSC -0.152; TCGA KIRP -0.194; TCGA PAAD -0.361; TCGA PRAD -0.217; TCGA SARC -0.249; TCGA STAD -0.546
hsa-miR-590-3p
CXorf36
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.319; TCGA BRCA -0.388; TCGA CESC -0.26; TCGA COAD -0.425; TCGA ESCA -0.189; TCGA HNSC -0.153; TCGA LIHC -0.354; TCGA LUAD -0.231; TCGA LUSC -0.515; TCGA PAAD -0.172; TCGA PRAD -0.108; TCGA THCA -0.182; TCGA STAD -0.313; TCGA UCEC -0.483
hsa-miR-590-3p
TACC1
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.352; TCGA BRCA -0.247; TCGA CESC -0.266; TCGA ESCA -0.206; TCGA HNSC -0.095; TCGA KIRC -0.353; TCGA KIRP -0.136; TCGA LIHC -0.132; TCGA LUAD -0.217; TCGA LUSC -0.261; TCGA PRAD -0.314; TCGA SARC -0.386; TCGA THCA -0.07; TCGA STAD -0.499; TCGA UCEC -0.336
hsa-miR-590-3p
CLEC1A
9 cancers: BLCA; BRCA; COAD; LUAD; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.264; TCGA BRCA -0.223; TCGA COAD -0.366; TCGA LUAD -0.13; TCGA LUSC -0.328; TCGA PRAD -0.094; TCGA SARC -0.181; TCGA STAD -0.249; TCGA UCEC -0.296
hsa-miR-590-3p
ARID5B
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.294; TCGA BRCA -0.213; TCGA CESC -0.115; TCGA COAD -0.071; TCGA ESCA -0.206; TCGA HNSC -0.103; TCGA KIRC -0.185; TCGA KIRP -0.224; TCGA LUAD -0.107; TCGA LUSC -0.105; TCGA PAAD -0.15; TCGA PRAD -0.083; TCGA SARC -0.312; TCGA STAD -0.204; TCGA UCEC -0.245
hsa-miR-590-3p
FAM124A
9 cancers: BLCA; COAD; ESCA; KIRC; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.291; TCGA COAD -0.493; TCGA ESCA -0.48; TCGA KIRC -0.365; TCGA LUSC -0.266; TCGA PRAD -0.301; TCGA SARC -0.432; TCGA STAD -0.662; TCGA UCEC -0.172
hsa-miR-590-3p
ZNF385D
14 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.516; TCGA BRCA -0.418; TCGA COAD -0.769; TCGA ESCA -0.794; TCGA HNSC -0.287; TCGA KIRC -0.367; TCGA KIRP -0.855; TCGA LUAD -0.247; TCGA LUSC -0.621; TCGA PAAD -0.273; TCGA PRAD -0.261; TCGA SARC -0.272; TCGA STAD -0.75; TCGA UCEC -0.297
hsa-miR-590-3p
SETBP1
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.451; TCGA BRCA -0.338; TCGA CESC -0.318; TCGA COAD -0.535; TCGA ESCA -0.377; TCGA HNSC -0.278; TCGA KIRC -0.362; TCGA KIRP -0.253; TCGA LGG -0.202; TCGA LUAD -0.326; TCGA LUSC -0.275; TCGA PRAD -0.25; TCGA SARC -0.528; TCGA STAD -0.755; TCGA UCEC -0.403
hsa-miR-590-3p
TGOLN2
12 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; UCEC
mirMAP
TCGA BLCA -0.067; TCGA BRCA -0.112; TCGA CESC -0.095; TCGA KIRC -0.172; TCGA KIRP -0.309; TCGA LUAD -0.09; TCGA LUSC -0.141; TCGA PAAD -0.113; TCGA PRAD -0.172; TCGA SARC -0.075; TCGA THCA -0.098; TCGA UCEC -0.157
hsa-miR-590-3p
IGSF10
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; STAD; UCEC
mirMAP
TCGA BLCA -0.603; TCGA BRCA -0.574; TCGA CESC -0.566; TCGA COAD -0.48; TCGA HNSC -0.466; TCGA KIRC -0.737; TCGA KIRP -0.373; TCGA LUAD -0.494; TCGA LUSC -0.366; TCGA STAD -0.753; TCGA UCEC -0.262
hsa-miR-590-3p
CACNA2D1
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.726; TCGA BRCA -0.605; TCGA CESC -0.565; TCGA COAD -1.138; TCGA ESCA -0.346; TCGA HNSC -0.351; TCGA KIRP -0.736; TCGA LGG -0.387; TCGA LUAD -0.248; TCGA PAAD -0.563; TCGA PRAD -0.82; TCGA SARC -0.401; TCGA STAD -0.76; TCGA UCEC -0.398
hsa-miR-590-3p
ANKRD29
11 cancers: BLCA; BRCA; COAD; LGG; LIHC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.493; TCGA BRCA -0.513; TCGA COAD -0.338; TCGA LGG -0.126; TCGA LIHC -0.479; TCGA LUAD -0.274; TCGA LUSC -0.443; TCGA PRAD -0.16; TCGA SARC -0.501; TCGA STAD -0.454; TCGA UCEC -0.421
hsa-miR-590-3p
LSM11
11 cancers: BLCA; CESC; ESCA; LGG; LIHC; LUAD; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.227; TCGA CESC -0.129; TCGA ESCA -0.201; TCGA LGG -0.128; TCGA LIHC -0.129; TCGA LUAD -0.051; TCGA PAAD -0.119; TCGA PRAD -0.179; TCGA SARC -0.343; TCGA STAD -0.218; TCGA UCEC -0.172
hsa-miR-590-3p
FBXO32
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; LIHC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.315; TCGA CESC -0.276; TCGA COAD -0.265; TCGA ESCA -0.447; TCGA HNSC -0.251; TCGA LIHC -0.361; TCGA PAAD -0.216; TCGA PRAD -0.167; TCGA SARC -0.519; TCGA STAD -0.818; TCGA UCEC -0.501
hsa-miR-590-3p
PALM2-AKAP2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.253; TCGA BRCA -0.188; TCGA CESC -0.167; TCGA COAD -0.305; TCGA ESCA -0.197; TCGA KIRP -0.113; TCGA LUAD -0.156; TCGA LUSC -0.618; TCGA PAAD -0.151; TCGA PRAD -0.127; TCGA SARC -0.097; TCGA STAD -0.346; TCGA UCEC -0.359
hsa-miR-590-3p
SHROOM4
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.303; TCGA BRCA -0.247; TCGA CESC -0.381; TCGA COAD -0.291; TCGA ESCA -0.28; TCGA HNSC -0.345; TCGA KIRC -0.184; TCGA KIRP -0.262; TCGA LIHC -0.229; TCGA LUAD -0.435; TCGA LUSC -0.581; TCGA PAAD -0.231; TCGA PRAD -0.242; TCGA SARC -0.152; TCGA THCA -0.306; TCGA STAD -0.316; TCGA UCEC -0.317
hsa-miR-590-3p
EDA
13 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.381; TCGA BRCA -0.25; TCGA CESC -0.307; TCGA ESCA -0.362; TCGA HNSC -0.31; TCGA KIRC -0.226; TCGA KIRP -0.193; TCGA LGG -0.12; TCGA LUAD -0.409; TCGA LUSC -0.325; TCGA SARC -0.211; TCGA STAD -0.297; TCGA UCEC -0.182
hsa-miR-590-3p
TAL1
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.229; TCGA BRCA -0.403; TCGA CESC -0.196; TCGA COAD -0.335; TCGA ESCA -0.275; TCGA HNSC -0.19; TCGA LUAD -0.315; TCGA LUSC -0.605; TCGA SARC -0.144; TCGA THCA -0.187; TCGA STAD -0.326; TCGA UCEC -0.506
hsa-miR-590-3p
PRKAA2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD
mirMAP; miRNATAP
TCGA BLCA -0.431; TCGA BRCA -0.253; TCGA CESC -0.476; TCGA COAD -0.666; TCGA ESCA -0.545; TCGA HNSC -0.294; TCGA KIRC -0.302; TCGA KIRP -0.183; TCGA PAAD -0.294; TCGA PRAD -0.098; TCGA SARC -0.901; TCGA THCA -0.097; TCGA STAD -1.153
hsa-miR-590-3p
UBXN10
10 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.358; TCGA BRCA -0.488; TCGA CESC -0.455; TCGA ESCA -0.44; TCGA KIRC -0.137; TCGA LUAD -0.235; TCGA LUSC -0.507; TCGA PAAD -0.27; TCGA PRAD -0.611; TCGA STAD -0.567
hsa-miR-590-3p
NFIA
10 cancers: BLCA; BRCA; CESC; ESCA; LUAD; LUSC; PAAD; PRAD; SARC; STAD
mirMAP; miRNATAP
TCGA BLCA -0.306; TCGA BRCA -0.254; TCGA CESC -0.15; TCGA ESCA -0.194; TCGA LUAD -0.261; TCGA LUSC -0.139; TCGA PAAD -0.135; TCGA PRAD -0.083; TCGA SARC -0.3; TCGA STAD -0.524
hsa-miR-590-3p
FRZB
11 cancers: BLCA; BRCA; CESC; COAD; HNSC; LIHC; LUAD; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.377; TCGA BRCA -0.361; TCGA CESC -0.235; TCGA COAD -0.585; TCGA HNSC -0.224; TCGA LIHC -0.252; TCGA LUAD -0.251; TCGA LUSC -0.413; TCGA SARC -0.419; TCGA STAD -0.659; TCGA UCEC -0.198
hsa-miR-590-3p
NEK10
9 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LUSC; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.182; TCGA BRCA -1.005; TCGA COAD -0.176; TCGA KIRC -0.394; TCGA KIRP -0.301; TCGA LUSC -0.388; TCGA PRAD -0.194; TCGA SARC -0.247; TCGA STAD -0.33
hsa-miR-590-3p
PPM1L
14 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.375; TCGA CESC -0.594; TCGA COAD -0.109; TCGA ESCA -0.415; TCGA HNSC -0.332; TCGA KIRC -0.401; TCGA KIRP -0.55; TCGA LGG -0.263; TCGA PAAD -0.197; TCGA PRAD -0.383; TCGA SARC -0.544; TCGA THCA -0.199; TCGA STAD -0.378; TCGA UCEC -0.149
hsa-miR-590-3p
ARHGEF3
10 cancers: BLCA; BRCA; CESC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; UCEC
mirMAP
TCGA BLCA -0.157; TCGA BRCA -0.079; TCGA CESC -0.131; TCGA KIRC -0.273; TCGA KIRP -0.152; TCGA LIHC -0.167; TCGA LUAD -0.082; TCGA LUSC -0.233; TCGA PRAD -0.119; TCGA UCEC -0.11
hsa-miR-590-3p
C4orf3
10 cancers: BLCA; BRCA; ESCA; HNSC; KIRC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.116; TCGA BRCA -0.081; TCGA ESCA -0.156; TCGA HNSC -0.097; TCGA KIRC -0.06; TCGA PAAD -0.093; TCGA PRAD -0.051; TCGA SARC -0.133; TCGA STAD -0.238; TCGA UCEC -0.155
hsa-miR-590-3p
GPX8
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.174; TCGA BRCA -0.092; TCGA CESC -0.199; TCGA COAD -0.464; TCGA ESCA -0.165; TCGA HNSC -0.126; TCGA LUSC -0.101; TCGA PAAD -0.472; TCGA PRAD -0.145; TCGA STAD -0.177; TCGA UCEC -0.191
hsa-miR-590-3p
MYOZ3
11 cancers: BLCA; BRCA; CESC; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.402; TCGA BRCA -0.4; TCGA CESC -0.311; TCGA HNSC -0.403; TCGA LUAD -0.29; TCGA LUSC -0.49; TCGA PAAD -0.509; TCGA PRAD -0.295; TCGA SARC -0.392; TCGA STAD -0.679; TCGA UCEC -0.507
hsa-miR-590-3p
MARCH8
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.129; TCGA BRCA -0.251; TCGA CESC -0.264; TCGA COAD -0.107; TCGA ESCA -0.184; TCGA HNSC -0.166; TCGA KIRC -0.247; TCGA KIRP -0.467; TCGA LGG -0.176; TCGA LUAD -0.163; TCGA LUSC -0.221; TCGA PRAD -0.272; TCGA SARC -0.195; TCGA STAD -0.154; TCGA UCEC -0.238
hsa-miR-590-3p
SLC18A2
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA
mirMAP
TCGA BLCA -0.528; TCGA BRCA -0.627; TCGA CESC -0.329; TCGA COAD -0.311; TCGA ESCA -0.372; TCGA HNSC -0.2; TCGA KIRP -0.335; TCGA LUAD -0.641; TCGA LUSC -0.86; TCGA PAAD -0.36; TCGA PRAD -0.547; TCGA SARC -0.54; TCGA THCA -0.24
hsa-miR-590-3p
PDZD8
12 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; THCA
mirMAP
TCGA BLCA -0.079; TCGA BRCA -0.074; TCGA CESC -0.246; TCGA HNSC -0.201; TCGA KIRC -0.243; TCGA KIRP -0.425; TCGA LGG -0.228; TCGA LUAD -0.133; TCGA LUSC -0.125; TCGA PAAD -0.307; TCGA PRAD -0.216; TCGA THCA -0.193
hsa-miR-590-3p
HSPA12A
17 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.425; TCGA BRCA -0.365; TCGA CESC -0.275; TCGA COAD -0.27; TCGA ESCA -0.223; TCGA HNSC -0.32; TCGA KIRC -0.254; TCGA KIRP -0.718; TCGA LGG -0.184; TCGA LIHC -0.192; TCGA LUAD -0.239; TCGA LUSC -0.261; TCGA PAAD -0.263; TCGA PRAD -0.262; TCGA THCA -0.195; TCGA STAD -0.613; TCGA UCEC -0.135
hsa-miR-590-3p
CACNB2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.721; TCGA BRCA -0.193; TCGA CESC -0.241; TCGA COAD -0.18; TCGA ESCA -0.607; TCGA KIRC -0.137; TCGA LUSC -0.333; TCGA PRAD -0.125; TCGA SARC -0.917; TCGA THCA -0.274; TCGA STAD -0.922; TCGA UCEC -0.476
hsa-miR-590-3p
AMOTL1
15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.307; TCGA BRCA -0.212; TCGA COAD -0.698; TCGA ESCA -0.261; TCGA HNSC -0.174; TCGA KIRP -0.128; TCGA LGG -0.056; TCGA LUAD -0.275; TCGA LUSC -0.237; TCGA PAAD -0.257; TCGA PRAD -0.201; TCGA SARC -0.331; TCGA THCA -0.142; TCGA STAD -0.672; TCGA UCEC -0.278
hsa-miR-590-3p
BTRC
9 cancers: BLCA; BRCA; HNSC; KIRC; KIRP; LGG; LUAD; THCA; STAD
mirMAP
TCGA BLCA -0.052; TCGA BRCA -0.09; TCGA HNSC -0.062; TCGA KIRC -0.158; TCGA KIRP -0.093; TCGA LGG -0.132; TCGA LUAD -0.092; TCGA THCA -0.065; TCGA STAD -0.115
hsa-miR-590-3p
CRK
11 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; THCA
mirMAP
TCGA BLCA -0.071; TCGA BRCA -0.074; TCGA CESC -0.128; TCGA HNSC -0.124; TCGA KIRC -0.129; TCGA KIRP -0.109; TCGA LUAD -0.068; TCGA LUSC -0.146; TCGA PAAD -0.114; TCGA PRAD -0.089; TCGA THCA -0.133
hsa-miR-590-3p
SNTB2
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.139; TCGA BRCA -0.115; TCGA CESC -0.098; TCGA ESCA -0.14; TCGA KIRC -0.097; TCGA LUAD -0.113; TCGA LUSC -0.079; TCGA PAAD -0.164; TCGA PRAD -0.094; TCGA SARC -0.146; TCGA STAD -0.171; TCGA UCEC -0.166
hsa-miR-590-3p
FEM1B
13 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.136; TCGA BRCA -0.075; TCGA CESC -0.101; TCGA COAD -0.051; TCGA HNSC -0.072; TCGA KIRC -0.063; TCGA KIRP -0.09; TCGA PAAD -0.092; TCGA PRAD -0.16; TCGA SARC -0.291; TCGA THCA -0.059; TCGA STAD -0.246; TCGA UCEC -0.156
hsa-miR-590-3p
AR
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.62; TCGA BRCA -0.846; TCGA CESC -0.589; TCGA COAD -0.861; TCGA ESCA -0.661; TCGA HNSC -0.579; TCGA KIRC -0.361; TCGA LUAD -0.501; TCGA LUSC -0.729; TCGA PAAD -0.743; TCGA PRAD -0.201; TCGA SARC -1.071; TCGA STAD -0.954; TCGA UCEC -0.268
hsa-miR-590-3p
MMGT1
13 cancers: BLCA; CESC; ESCA; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.088; TCGA CESC -0.084; TCGA ESCA -0.099; TCGA KIRC -0.159; TCGA KIRP -0.235; TCGA LGG -0.07; TCGA LUSC -0.07; TCGA PAAD -0.072; TCGA PRAD -0.083; TCGA SARC -0.143; TCGA THCA -0.102; TCGA STAD -0.1; TCGA UCEC -0.216
hsa-miR-590-3p
CSGALNACT2
11 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.164; TCGA CESC -0.094; TCGA COAD -0.266; TCGA ESCA -0.143; TCGA HNSC -0.083; TCGA KIRP -0.127; TCGA LUAD -0.099; TCGA LUSC -0.253; TCGA PAAD -0.297; TCGA STAD -0.236; TCGA UCEC -0.217
hsa-miR-590-3p
RNF150
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.636; TCGA BRCA -0.283; TCGA CESC -0.441; TCGA COAD -1.091; TCGA ESCA -0.79; TCGA HNSC -0.336; TCGA KIRC -1.235; TCGA KIRP -0.7; TCGA LGG -0.244; TCGA LUSC -0.252; TCGA PAAD -0.309; TCGA PRAD -0.247; TCGA SARC -0.689; TCGA STAD -1.038; TCGA UCEC -0.187
hsa-miR-590-3p
PYGO1
13 cancers: BLCA; BRCA; CESC; HNSC; KIRC; KIRP; LGG; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.206; TCGA BRCA -0.251; TCGA CESC -0.461; TCGA HNSC -0.428; TCGA KIRC -0.716; TCGA KIRP -0.703; TCGA LGG -0.182; TCGA PAAD -0.551; TCGA PRAD -0.424; TCGA SARC -0.252; TCGA THCA -0.162; TCGA STAD -0.748; TCGA UCEC -0.345
hsa-miR-590-3p
PRKCE
12 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.084; TCGA BRCA -0.177; TCGA CESC -0.205; TCGA ESCA -0.116; TCGA KIRC -0.293; TCGA KIRP -0.3; TCGA LGG -0.225; TCGA LUAD -0.209; TCGA LUSC -0.331; TCGA PRAD -0.101; TCGA STAD -0.162; TCGA UCEC -0.096
hsa-miR-590-3p
FRMD3
15 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.282; TCGA BRCA -0.147; TCGA CESC -0.233; TCGA ESCA -0.489; TCGA HNSC -0.303; TCGA KIRC -0.409; TCGA KIRP -0.332; TCGA LUAD -0.293; TCGA LUSC -0.707; TCGA PAAD -0.26; TCGA PRAD -0.358; TCGA SARC -0.238; TCGA THCA -0.466; TCGA STAD -0.149; TCGA UCEC -0.189
hsa-miR-590-3p
RCAN2
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.711; TCGA BRCA -0.21; TCGA CESC -0.358; TCGA COAD -0.48; TCGA ESCA -0.621; TCGA HNSC -0.351; TCGA KIRC -0.291; TCGA KIRP -0.396; TCGA LIHC -0.266; TCGA LUAD -0.357; TCGA LUSC -0.622; TCGA PRAD -0.281; TCGA THCA -0.137; TCGA STAD -0.65; TCGA UCEC -0.404
hsa-miR-590-3p
PDE3A
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.575; TCGA BRCA -0.368; TCGA CESC -0.723; TCGA COAD -0.619; TCGA ESCA -0.714; TCGA HNSC -0.617; TCGA KIRC -0.268; TCGA KIRP -0.586; TCGA LUAD -0.239; TCGA LUSC -0.609; TCGA PAAD -0.545; TCGA PRAD -0.511; TCGA SARC -1.013; TCGA THCA -0.338; TCGA STAD -0.844; TCGA UCEC -0.237
hsa-miR-590-3p
ZMAT3
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
mirMAP; miRNATAP
TCGA BLCA -0.268; TCGA BRCA -0.151; TCGA CESC -0.291; TCGA COAD -0.299; TCGA ESCA -0.135; TCGA HNSC -0.273; TCGA KIRC -0.222; TCGA LGG -0.186; TCGA LUAD -0.143; TCGA LUSC -0.163; TCGA PAAD -0.231; TCGA PRAD -0.198; TCGA SARC -0.2; TCGA THCA -0.263; TCGA STAD -0.222
hsa-miR-590-3p
NUDT4
9 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LUAD; PAAD
mirMAP
TCGA BLCA -0.122; TCGA BRCA -0.128; TCGA CESC -0.089; TCGA ESCA -0.115; TCGA HNSC -0.058; TCGA KIRC -0.508; TCGA KIRP -0.284; TCGA LUAD -0.07; TCGA PAAD -0.105
hsa-miR-590-3p
ZNF791
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.098; TCGA BRCA -0.079; TCGA CESC -0.219; TCGA COAD -0.067; TCGA ESCA -0.145; TCGA KIRC -0.178; TCGA KIRP -0.346; TCGA LUAD -0.123; TCGA LUSC -0.069; TCGA PRAD -0.198; TCGA SARC -0.27; TCGA STAD -0.191; TCGA UCEC -0.133
hsa-miR-590-3p
BBS1
14 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.133; TCGA BRCA -0.204; TCGA CESC -0.234; TCGA ESCA -0.198; TCGA KIRC -0.262; TCGA KIRP -0.182; TCGA LUAD -0.183; TCGA LUSC -0.103; TCGA PAAD -0.136; TCGA PRAD -0.077; TCGA SARC -0.365; TCGA THCA -0.097; TCGA STAD -0.062; TCGA UCEC -0.096
hsa-miR-590-3p
YPEL2
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.173; TCGA BRCA -0.183; TCGA CESC -0.29; TCGA COAD -0.132; TCGA ESCA -0.248; TCGA HNSC -0.237; TCGA LUAD -0.118; TCGA LUSC -0.251; TCGA SARC -0.159; TCGA THCA -0.066; TCGA STAD -0.181; TCGA UCEC -0.26
hsa-miR-590-3p
ARL10
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.172; TCGA BRCA -0.212; TCGA CESC -0.274; TCGA COAD -0.544; TCGA ESCA -0.244; TCGA LGG -0.213; TCGA LUAD -0.201; TCGA LUSC -0.189; TCGA PAAD -0.191; TCGA PRAD -0.313; TCGA SARC -0.265; TCGA STAD -0.478; TCGA UCEC -0.217
hsa-miR-590-3p
MCTP1
11 cancers: BLCA; BRCA; COAD; ESCA; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.228; TCGA BRCA -0.262; TCGA COAD -0.45; TCGA ESCA -0.213; TCGA KIRP -0.361; TCGA LUAD -0.17; TCGA LUSC -0.567; TCGA PAAD -0.325; TCGA PRAD -0.215; TCGA STAD -0.165; TCGA UCEC -0.272
hsa-miR-590-3p
RNF152
12 cancers: BLCA; CESC; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.165; TCGA CESC -0.277; TCGA ESCA -0.227; TCGA HNSC -0.206; TCGA KIRC -0.61; TCGA LUAD -0.176; TCGA LUSC -0.215; TCGA PAAD -0.316; TCGA PRAD -0.303; TCGA SARC -0.316; TCGA THCA -0.194; TCGA STAD -0.211
hsa-miR-590-3p
FIBIN
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.631; TCGA BRCA -0.327; TCGA CESC -0.589; TCGA COAD -0.756; TCGA ESCA -0.632; TCGA HNSC -0.625; TCGA KIRC -0.283; TCGA KIRP -0.413; TCGA LUAD -0.312; TCGA LUSC -0.795; TCGA PAAD -0.651; TCGA PRAD -0.183; TCGA STAD -0.49; TCGA UCEC -0.557
hsa-miR-590-3p
ZNF619
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LGG; LUAD; PAAD; PRAD; SARC
mirMAP
TCGA BLCA -0.072; TCGA BRCA -0.157; TCGA CESC -0.202; TCGA ESCA -0.13; TCGA KIRC -0.367; TCGA KIRP -0.321; TCGA LGG -0.095; TCGA LUAD -0.116; TCGA PAAD -0.146; TCGA PRAD -0.153; TCGA SARC -0.281
hsa-miR-590-3p
EGR3
10 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PRAD; STAD
mirMAP
TCGA BLCA -0.478; TCGA BRCA -0.547; TCGA COAD -0.296; TCGA ESCA -0.236; TCGA HNSC -0.186; TCGA KIRC -0.369; TCGA LUAD -0.164; TCGA LUSC -0.503; TCGA PRAD -0.322; TCGA STAD -0.317
hsa-miR-590-3p
C14orf28
10 cancers: BLCA; BRCA; CESC; ESCA; LGG; LIHC; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.185; TCGA BRCA -0.194; TCGA CESC -0.163; TCGA ESCA -0.228; TCGA LGG -0.059; TCGA LIHC -0.162; TCGA LUSC -0.15; TCGA SARC -0.181; TCGA STAD -0.304; TCGA UCEC -0.291
hsa-miR-590-3p
SLITRK4
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LGG; LUSC; PAAD; PRAD; THCA; STAD
mirMAP; miRNATAP
TCGA BLCA -0.446; TCGA BRCA -0.236; TCGA CESC -0.461; TCGA ESCA -0.329; TCGA HNSC -0.598; TCGA LGG -0.258; TCGA LUSC -0.408; TCGA PAAD -0.517; TCGA PRAD -0.407; TCGA THCA -0.185; TCGA STAD -0.738
hsa-miR-590-3p
ZNF154
11 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUSC; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.435; TCGA BRCA -0.302; TCGA COAD -0.426; TCGA ESCA -0.288; TCGA KIRC -0.167; TCGA KIRP -0.361; TCGA LGG -0.088; TCGA LUSC -0.302; TCGA PRAD -0.421; TCGA SARC -0.479; TCGA STAD -0.487
hsa-miR-590-3p
TMEM136
12 cancers: BLCA; BRCA; COAD; ESCA; HNSC; KIRP; LGG; LIHC; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.212; TCGA BRCA -0.103; TCGA COAD -0.223; TCGA ESCA -0.182; TCGA HNSC -0.111; TCGA KIRP -0.231; TCGA LGG -0.145; TCGA LIHC -0.235; TCGA SARC -0.202; TCGA THCA -0.118; TCGA STAD -0.384; TCGA UCEC -0.232
hsa-miR-590-3p
C5orf24
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.072; TCGA BRCA -0.079; TCGA CESC -0.166; TCGA COAD -0.07; TCGA ESCA -0.145; TCGA KIRP -0.102; TCGA LGG -0.077; TCGA LUAD -0.087; TCGA LUSC -0.144; TCGA PAAD -0.128; TCGA PRAD -0.094; TCGA SARC -0.269; TCGA THCA -0.073; TCGA STAD -0.206; TCGA UCEC -0.151
hsa-miR-590-3p
UNC5C
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.624; TCGA BRCA -0.445; TCGA CESC -0.453; TCGA COAD -0.547; TCGA ESCA -0.36; TCGA HNSC -0.534; TCGA KIRC -0.356; TCGA KIRP -0.576; TCGA LUAD -0.371; TCGA LUSC -0.769; TCGA PAAD -0.413; TCGA PRAD -0.362; TCGA SARC -0.638; TCGA THCA -0.281; TCGA STAD -0.143
hsa-miR-590-3p
TSHZ2
11 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRP; LUAD; PAAD; PRAD; STAD
mirMAP
TCGA BLCA -0.48; TCGA BRCA -0.494; TCGA CESC -0.32; TCGA COAD -0.746; TCGA ESCA -0.297; TCGA HNSC -0.215; TCGA KIRP -0.493; TCGA LUAD -0.142; TCGA PAAD -0.551; TCGA PRAD -0.304; TCGA STAD -0.496
hsa-miR-590-3p
ZNF662
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; LUAD; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.541; TCGA BRCA -0.298; TCGA CESC -0.436; TCGA COAD -0.519; TCGA ESCA -0.312; TCGA KIRC -0.425; TCGA LUAD -0.269; TCGA LUSC -0.416; TCGA PRAD -0.287; TCGA SARC -0.376; TCGA STAD -0.696; TCGA UCEC -0.453
hsa-miR-590-3p
ARHGEF37
11 cancers: BLCA; BRCA; CESC; ESCA; HNSC; LIHC; LUAD; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.323; TCGA BRCA -0.201; TCGA CESC -0.21; TCGA ESCA -0.337; TCGA HNSC -0.156; TCGA LIHC -0.247; TCGA LUAD -0.238; TCGA LUSC -0.381; TCGA SARC -0.656; TCGA STAD -0.413; TCGA UCEC -0.125
hsa-miR-590-3p
KIRREL
15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.431; TCGA BRCA -0.385; TCGA CESC -0.446; TCGA COAD -0.59; TCGA HNSC -0.401; TCGA KIRC -0.169; TCGA KIRP -0.558; TCGA LUAD -0.302; TCGA LUSC -0.419; TCGA PAAD -0.624; TCGA PRAD -0.639; TCGA SARC -0.346; TCGA THCA -0.234; TCGA STAD -0.332; TCGA UCEC -0.267
hsa-miR-590-3p
POU6F1
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.272; TCGA BRCA -0.176; TCGA CESC -0.149; TCGA COAD -0.283; TCGA ESCA -0.245; TCGA KIRP -0.104; TCGA LGG -0.2; TCGA LIHC -0.133; TCGA LUAD -0.132; TCGA LUSC -0.157; TCGA SARC -0.209; TCGA STAD -0.498; TCGA UCEC -0.179
hsa-miR-590-3p
MAML2
15 cancers: BLCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
mirMAP
TCGA BLCA -0.254; TCGA CESC -0.329; TCGA COAD -0.24; TCGA ESCA -0.163; TCGA HNSC -0.219; TCGA KIRC -0.196; TCGA KIRP -0.381; TCGA LGG -0.196; TCGA LUAD -0.23; TCGA LUSC -0.273; TCGA PAAD -0.308; TCGA PRAD -0.409; TCGA SARC -0.291; TCGA THCA -0.128; TCGA STAD -0.143
hsa-miR-590-3p
RBM43
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.199; TCGA BRCA -0.183; TCGA CESC -0.13; TCGA COAD -0.168; TCGA ESCA -0.216; TCGA KIRP -0.235; TCGA LUAD -0.139; TCGA LUSC -0.211; TCGA PAAD -0.235; TCGA PRAD -0.243; TCGA SARC -0.36; TCGA THCA -0.127; TCGA STAD -0.332; TCGA UCEC -0.268
hsa-miR-590-3p
F8
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.377; TCGA BRCA -0.217; TCGA CESC -0.243; TCGA COAD -0.325; TCGA ESCA -0.364; TCGA KIRP -0.185; TCGA LUAD -0.169; TCGA LUSC -0.399; TCGA PRAD -0.09; TCGA SARC -0.233; TCGA THCA -0.184; TCGA STAD -0.446; TCGA UCEC -0.411
hsa-miR-590-3p
NR2F2
14 cancers: BLCA; BRCA; CESC; COAD; KIRC; KIRP; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.234; TCGA BRCA -0.138; TCGA CESC -0.413; TCGA COAD -0.145; TCGA KIRC -0.246; TCGA KIRP -0.112; TCGA LIHC -0.086; TCGA LUAD -0.091; TCGA LUSC -0.139; TCGA PAAD -0.188; TCGA PRAD -0.114; TCGA SARC -0.311; TCGA STAD -0.281; TCGA UCEC -0.258
hsa-miR-590-3p
LRCH3
10 cancers: BLCA; CESC; COAD; KIRC; KIRP; LGG; PAAD; PRAD; SARC; STAD
mirMAP
TCGA BLCA -0.062; TCGA CESC -0.169; TCGA COAD -0.112; TCGA KIRC -0.116; TCGA KIRP -0.25; TCGA LGG -0.077; TCGA PAAD -0.099; TCGA PRAD -0.132; TCGA SARC -0.204; TCGA STAD -0.203
hsa-miR-590-3p
ZNF397
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.07; TCGA BRCA -0.095; TCGA CESC -0.14; TCGA ESCA -0.128; TCGA KIRC -0.087; TCGA KIRP -0.127; TCGA LUAD -0.095; TCGA PRAD -0.069; TCGA SARC -0.299; TCGA STAD -0.157; TCGA UCEC -0.103
hsa-miR-590-3p
C3orf70
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; LIHC; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.504; TCGA BRCA -0.107; TCGA CESC -0.349; TCGA COAD -0.188; TCGA ESCA -0.375; TCGA LIHC -0.177; TCGA LUAD -0.223; TCGA LUSC -0.256; TCGA PRAD -0.452; TCGA SARC -0.801; TCGA THCA -0.181; TCGA STAD -0.871; TCGA UCEC -0.699
hsa-miR-590-3p
MITF
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.548; TCGA BRCA -0.273; TCGA CESC -0.444; TCGA COAD -0.63; TCGA ESCA -0.546; TCGA HNSC -0.218; TCGA KIRC -0.231; TCGA KIRP -0.186; TCGA LUAD -0.122; TCGA LUSC -0.488; TCGA PAAD -0.571; TCGA PRAD -0.247; TCGA SARC -0.389; TCGA THCA -0.138; TCGA STAD -0.468; TCGA UCEC -0.354
hsa-miR-590-3p
KPNA5
13 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRC; KIRP; LGG; LUSC; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.2; TCGA BRCA -0.07; TCGA CESC -0.291; TCGA COAD -0.189; TCGA ESCA -0.184; TCGA KIRC -0.34; TCGA KIRP -0.296; TCGA LGG -0.18; TCGA LUSC -0.124; TCGA PRAD -0.274; TCGA SARC -0.196; TCGA STAD -0.289; TCGA UCEC -0.178
hsa-miR-590-3p
KANK2
14 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.558; TCGA BRCA -0.309; TCGA CESC -0.436; TCGA COAD -0.422; TCGA ESCA -0.571; TCGA HNSC -0.128; TCGA LUAD -0.265; TCGA LUSC -0.539; TCGA PAAD -0.344; TCGA PRAD -0.32; TCGA SARC -0.534; TCGA THCA -0.142; TCGA STAD -0.665; TCGA UCEC -0.437
hsa-miR-590-3p
SGTB
9 cancers: BLCA; CESC; COAD; KIRP; LGG; LUSC; PRAD; STAD; UCEC
mirMAP
TCGA BLCA -0.114; TCGA CESC -0.11; TCGA COAD -0.179; TCGA KIRP -0.128; TCGA LGG -0.076; TCGA LUSC -0.121; TCGA PRAD -0.126; TCGA STAD -0.275; TCGA UCEC -0.181
hsa-miR-590-3p
NKIRAS1
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.067; TCGA BRCA -0.058; TCGA COAD -0.064; TCGA ESCA -0.09; TCGA KIRC -0.346; TCGA KIRP -0.196; TCGA LGG -0.104; TCGA LUAD -0.063; TCGA SARC -0.07; TCGA THCA -0.081; TCGA STAD -0.275; TCGA UCEC -0.203
hsa-miR-590-3p
ZNF677
12 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUSC; PAAD; STAD; UCEC
mirMAP
TCGA BLCA -0.28; TCGA BRCA -0.21; TCGA CESC -0.309; TCGA COAD -0.619; TCGA ESCA -0.395; TCGA HNSC -0.347; TCGA KIRC -0.491; TCGA KIRP -0.4; TCGA LUSC -0.35; TCGA PAAD -0.24; TCGA STAD -0.629; TCGA UCEC -0.328
hsa-miR-590-3p
RYR2
11 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LUAD; LUSC; PAAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.857; TCGA BRCA -0.133; TCGA COAD -0.633; TCGA ESCA -1.106; TCGA HNSC -0.317; TCGA LUAD -0.4; TCGA LUSC -0.786; TCGA PAAD -0.298; TCGA SARC -0.807; TCGA STAD -0.902; TCGA UCEC -0.149
hsa-miR-590-3p
SYNJ2BP
11 cancers: BLCA; BRCA; CESC; ESCA; KIRC; KIRP; LUAD; LUSC; PRAD; SARC; UCEC
mirMAP
TCGA BLCA -0.106; TCGA BRCA -0.149; TCGA CESC -0.117; TCGA ESCA -0.238; TCGA KIRC -0.425; TCGA KIRP -0.157; TCGA LUAD -0.084; TCGA LUSC -0.129; TCGA PRAD -0.118; TCGA SARC -0.19; TCGA UCEC -0.056
hsa-miR-590-3p
LEPROT
16 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP; miRNATAP
TCGA BLCA -0.217; TCGA BRCA -0.212; TCGA CESC -0.295; TCGA COAD -0.198; TCGA ESCA -0.167; TCGA HNSC -0.192; TCGA KIRC -0.366; TCGA KIRP -0.528; TCGA LUAD -0.11; TCGA LUSC -0.268; TCGA PAAD -0.324; TCGA PRAD -0.354; TCGA SARC -0.234; TCGA THCA -0.182; TCGA STAD -0.175; TCGA UCEC -0.307
hsa-miR-590-3p
S1PR3
12 cancers: BLCA; BRCA; COAD; ESCA; KIRC; KIRP; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.198; TCGA BRCA -0.086; TCGA COAD -0.49; TCGA ESCA -0.576; TCGA KIRC -0.165; TCGA KIRP -0.229; TCGA LUSC -0.243; TCGA PAAD -0.232; TCGA PRAD -0.199; TCGA SARC -0.444; TCGA STAD -0.645; TCGA UCEC -0.187
hsa-miR-590-3p
ZNF844
15 cancers: BLCA; BRCA; CESC; COAD; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.211; TCGA BRCA -0.273; TCGA CESC -0.371; TCGA COAD -0.172; TCGA HNSC -0.206; TCGA KIRC -0.474; TCGA KIRP -0.356; TCGA LGG -0.118; TCGA LUAD -0.195; TCGA LUSC -0.29; TCGA PRAD -0.101; TCGA SARC -0.312; TCGA THCA -0.122; TCGA STAD -0.409; TCGA UCEC -0.17
hsa-miR-590-3p
C14orf132
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; SARC; STAD; UCEC
mirMAP
TCGA BLCA -0.397; TCGA BRCA -0.508; TCGA CESC -0.425; TCGA COAD -0.761; TCGA ESCA -0.483; TCGA HNSC -0.316; TCGA KIRC -0.803; TCGA LGG -0.267; TCGA LUAD -0.309; TCGA LUSC -0.614; TCGA PAAD -0.212; TCGA PRAD -0.204; TCGA SARC -0.436; TCGA STAD -0.907; TCGA UCEC -0.553
hsa-miR-590-3p
AKAP2
12 cancers: BLCA; CESC; COAD; ESCA; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; UCEC
mirMAP
TCGA BLCA -0.466; TCGA CESC -0.41; TCGA COAD -0.348; TCGA ESCA -0.268; TCGA KIRC -0.165; TCGA KIRP -0.545; TCGA LUAD -0.175; TCGA LUSC -0.748; TCGA PAAD -0.369; TCGA PRAD -0.551; TCGA SARC -0.526; TCGA UCEC -0.584
hsa-miR-590-3p
KCTD7
10 cancers: BLCA; BRCA; CESC; COAD; ESCA; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.133; TCGA BRCA -0.058; TCGA CESC -0.101; TCGA COAD -0.161; TCGA ESCA -0.135; TCGA PRAD -0.063; TCGA SARC -0.117; TCGA THCA -0.095; TCGA STAD -0.339; TCGA UCEC -0.221
hsa-miR-590-3p
USP51
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
mirMAP
TCGA BLCA -0.254; TCGA BRCA -0.096; TCGA CESC -0.326; TCGA COAD -0.553; TCGA ESCA -0.27; TCGA HNSC -0.234; TCGA KIRC -0.377; TCGA KIRP -0.414; TCGA LGG -0.137; TCGA LUAD -0.135; TCGA PRAD -0.212; TCGA SARC -0.493; TCGA THCA -0.15; TCGA STAD -0.503; TCGA UCEC -0.333
hsa-miR-590-3p
NFIC
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD
miRNATAP
TCGA BLCA -0.273; TCGA BRCA -0.197; TCGA CESC -0.189; TCGA COAD -0.168; TCGA ESCA -0.254; TCGA HNSC -0.187; TCGA KIRC -0.177; TCGA KIRP -0.456; TCGA LUAD -0.254; TCGA LUSC -0.199; TCGA PAAD -0.228; TCGA PRAD -0.228; TCGA SARC -0.382; TCGA THCA -0.154; TCGA STAD -0.363
hsa-miR-590-3p
FAM49A
10 cancers: BLCA; COAD; ESCA; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC
miRNATAP
TCGA BLCA -0.145; TCGA COAD -0.497; TCGA ESCA -0.222; TCGA LGG -0.126; TCGA LUAD -0.138; TCGA LUSC -0.261; TCGA PAAD -0.228; TCGA PRAD -0.142; TCGA STAD -0.32; TCGA UCEC -0.22
hsa-miR-590-3p
SCN4B
15 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC
miRNATAP
TCGA BLCA -0.458; TCGA BRCA -0.664; TCGA CESC -0.236; TCGA COAD -0.633; TCGA ESCA -0.373; TCGA HNSC -0.339; TCGA LIHC -0.259; TCGA LUAD -0.596; TCGA LUSC -0.62; TCGA PAAD -0.349; TCGA PRAD -0.238; TCGA SARC -0.386; TCGA THCA -0.317; TCGA STAD -0.666; TCGA UCEC -0.656
hsa-miR-590-3p
HOOK3
12 cancers: BLCA; CESC; COAD; ESCA; HNSC; LGG; LUAD; LUSC; PAAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.128; TCGA CESC -0.174; TCGA COAD -0.142; TCGA ESCA -0.115; TCGA HNSC -0.102; TCGA LGG -0.091; TCGA LUAD -0.074; TCGA LUSC -0.13; TCGA PAAD -0.126; TCGA SARC -0.081; TCGA STAD -0.394; TCGA UCEC -0.094
hsa-miR-590-3p
BTBD9
12 cancers: BLCA; BRCA; CESC; ESCA; HNSC; KIRC; KIRP; LGG; LUAD; LUSC; THCA; STAD
miRNATAP
TCGA BLCA -0.075; TCGA BRCA -0.066; TCGA CESC -0.216; TCGA ESCA -0.121; TCGA HNSC -0.082; TCGA KIRC -0.252; TCGA KIRP -0.101; TCGA LGG -0.094; TCGA LUAD -0.267; TCGA LUSC -0.253; TCGA THCA -0.072; TCGA STAD -0.091
hsa-miR-590-3p
TEAD3
9 cancers: BLCA; CESC; ESCA; KIRC; PAAD; PRAD; SARC; STAD; UCEC
miRNATAP
TCGA BLCA -0.115; TCGA CESC -0.117; TCGA ESCA -0.149; TCGA KIRC -0.099; TCGA PAAD -0.198; TCGA PRAD -0.098; TCGA SARC -0.388; TCGA STAD -0.317; TCGA UCEC -0.134
hsa-miR-590-3p
PGAP1
10 cancers: BRCA; KIRC; KIRP; LGG; LUAD; PRAD; SARC; THCA; STAD; UCEC
miRNAWalker2 validate; PITA; miRanda; mirMAP
TCGA BRCA -0.197; TCGA KIRC -0.256; TCGA KIRP -0.373; TCGA LGG -0.173; TCGA LUAD -0.094; TCGA PRAD -0.258; TCGA SARC -0.362; TCGA THCA -0.143; TCGA STAD -0.25; TCGA UCEC -0.312
hsa-miR-590-3p
B4GALT6
9 cancers: BRCA; CESC; KIRC; KIRP; LGG; PRAD; THCA; STAD; UCEC
MirTarget; miRanda; mirMAP
TCGA BRCA -0.1; TCGA CESC -0.216; TCGA KIRC -0.173; TCGA KIRP -0.219; TCGA LGG -0.152; TCGA PRAD -0.257; TCGA THCA -0.289; TCGA STAD -0.151; TCGA UCEC -0.281
hsa-miR-590-3p
CRISPLD1
10 cancers: BRCA; CESC; COAD; HNSC; KIRC; PAAD; PRAD; THCA; STAD; UCEC