microRNA information: hsa-miR-601
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-601 | miRbase |
| Accession: | MIMAT0003269 | miRbase |
| Precursor name: | hsa-mir-601 | miRbase |
| Precursor accession: | MI0003614 | miRbase |
| Symbol: | MIR601 | HGNC |
| RefSeq ID: | NR_030332 | GenBank |
| Sequence: | UGGUCUAGGAUUGUUGGAGGAG |
Reported expression in cancers: hsa-miR-601
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-601 | breast cancer | downregulation | "Here we investigated the role of miR-601 in breast ......" | 27044835 | |
| hsa-miR-601 | gastric cancer | deregulation | "The results from the miRNA microarray analysis wer ......" | 21475928 | qPCR; Microarray |
Reported cancer pathway affected by hsa-miR-601
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-601
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-601 | breast cancer | metastasis; poor survival; worse prognosis | "miR 601 is a prognostic marker and suppresses cell ......" | 27044835 | |
| hsa-miR-601 | colorectal cancer | staging | "Plasma miR 601 and miR 760 are novel biomarkers fo ......" | 22970209 |
Reported gene related to hsa-miR-601
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-601 | breast cancer | PTP4A1 | "miR 601 is a prognostic marker and suppresses cell ......" | 27044835 |