microRNA information: hsa-miR-618
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-618 | miRbase |
| Accession: | MIMAT0003287 | miRbase |
| Precursor name: | hsa-mir-618 | miRbase |
| Precursor accession: | MI0003632 | miRbase |
| Symbol: | MIR618 | HGNC |
| RefSeq ID: | NR_030349 | GenBank |
| Sequence: | AAACUCUACUUGUCCUUCUGAGU |
Reported expression in cancers: hsa-miR-618
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-618 | thyroid cancer | downregulation | "MicroRNA 618 modulates cell growth via targeting P ......" | 27453421 | qPCR |
Reported cancer pathway affected by hsa-miR-618
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-618 | thyroid cancer | cell cycle pathway; PI3K/Akt signaling pathway | "MicroRNA 618 modulates cell growth via targeting P ......" | 27453421 | Flow cytometry; Western blot |
Reported cancer prognosis affected by hsa-miR-618
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|
Reported gene related to hsa-miR-618
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-618 | thyroid cancer | ATM | "MiR 618 inhibits anaplastic thyroid cancer by repr ......" | 25145559 |
| hsa-miR-618 | lymphoma | FLT3LG | "This is consistent with our finding of a significa ......" | 24503492 |
| hsa-miR-618 | lymphoma | RTEL1 | "In this study we employ a multidisciplinary approa ......" | 24503492 |
| hsa-miR-618 | thyroid cancer | XIAP | "MiR 618 inhibits anaplastic thyroid cancer by repr ......" | 25145559 |