microRNA information: hsa-miR-621
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-621 | miRbase |
| Accession: | MIMAT0003290 | miRbase |
| Precursor name: | hsa-mir-621 | miRbase |
| Precursor accession: | MI0003635 | miRbase |
| Symbol: | MIR621 | HGNC |
| RefSeq ID: | NR_030352 | GenBank |
| Sequence: | GGCUAGCAACAGCGCUUACCU |
Reported expression in cancers: hsa-miR-621
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-621
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-621 | breast cancer | Apoptosis pathway | "Here we show a strong correlation between miR-621 ......" | 25867061 |
Reported cancer prognosis affected by hsa-miR-621
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-621 | breast cancer | drug resistance | "Here we show a strong correlation between miR-621 ......" | 25867061 |
Reported gene related to hsa-miR-621
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-621 | breast cancer | FBXO11 | "We further show that FBXO11 is a direct functional ......" | 25867061 |
| hsa-miR-621 | breast cancer | TP53 | "Taken together our data suggest that miR-621 enhan ......" | 25867061 |