microRNA information: hsa-miR-663b
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-663b | miRbase |
| Accession: | MIMAT0005867 | miRbase |
| Precursor name: | hsa-mir-663b | miRbase |
| Precursor accession: | MI0006336 | miRbase |
| Symbol: | MIR663B | HGNC |
| RefSeq ID: | NR_031608 | GenBank |
| Sequence: | GGUGGCCCGGCCGUGCCUGAGG |
Reported expression in cancers: hsa-miR-663b
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-663b | glioblastoma | downregulation | "Here we aimed to investigate the exact role of miR ......" | 26717894 | Reverse transcription PCR |
| hsa-miR-663b | lung cancer | upregulation | "In this study miR-663 was shown to be highly expre ......" | 22393947 | |
| hsa-miR-663b | lung squamous cell cancer | upregulation | "We also observed upregulation of miR-663 a potenti ......" | 25301444 | |
| hsa-miR-663b | prostate cancer | upregulation | "miR 663 induces castration resistant prostate canc ......" | 24243035 | in situ hybridization |
Reported cancer pathway affected by hsa-miR-663b
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-663b | colorectal cancer | Apoptosis pathway | "By determining the molecular targets biological ro ......" | 22660396 | |
| hsa-miR-663b | lung squamous cell cancer | Apoptosis pathway | "Waltonitone induces apoptosis through mir 663 indu ......" | 25301444 | |
| hsa-miR-663b | pancreatic cancer | Apoptosis pathway | "miR 663 attenuates tumor growth and invasiveness b ......" | 25744894 | Western blot; Luciferase |
Reported cancer prognosis affected by hsa-miR-663b
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-663b | breast cancer | drug resistance | "The overexpression of hypomethylated miR 663 induc ......" | 23436656 | Luciferase |
| hsa-miR-663b | gastric cancer | cell migration | "Here we determined that MIR219.2 MIR663b and MIR12 ......" | 26043902 | |
| hsa-miR-663b | glioblastoma | worse prognosis; progression; poor survival | "Primate specific miR 663 functions as a tumor supp ......" | 24523440 | Western blot; Luciferase |
| hsa-miR-663b | glioblastoma | poor survival | "miR 663 Suppresses Oncogenic Function of CXCR4 in ......" | 26023083 | Western blot; Luciferase |
| hsa-miR-663b | glioblastoma | metastasis | "Here we aimed to investigate the exact role of miR ......" | 26717894 | |
| hsa-miR-663b | ovarian cancer | worse prognosis | "Quantitative reverse transcription-polymerase chai ......" | 24591819 | |
| hsa-miR-663b | pancreatic cancer | tumorigenesis; drug resistance; staging; metastasis; poor survival | "miR 663 attenuates tumor growth and invasiveness b ......" | 25744894 | Western blot; Luciferase |
| hsa-miR-663b | prostate cancer | recurrence; differentiation; staging | "miR 663 induces castration resistant prostate canc ......" | 24243035 |
Reported gene related to hsa-miR-663b
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-663b | lung squamous cell cancer | BCL2 | "Waltonitone induces apoptosis through mir 663 indu ......" | 25301444 |
| hsa-miR-663b | glioblastoma | CDH1 | "In summary miR-663 plays an inhibitory role in the ......" | 26717894 |
| hsa-miR-663b | glioblastoma | CXCR4 | "miR 663 Suppresses Oncogenic Function of CXCR4 in ......" | 26023083 |
| hsa-miR-663b | pancreatic cancer | EEF1A2 | "miR 663 attenuates tumor growth and invasiveness b ......" | 25744894 |
| hsa-miR-663b | breast cancer | HSPG2 | "The overexpression of hypomethylated miR 663 induc ......" | 23436656 |
| hsa-miR-663b | glioblastoma | MMP2 | "In summary miR-663 plays an inhibitory role in the ......" | 26717894 |
| hsa-miR-663b | gastric cancer | PCNA | "Western blot analyses performed after the introduc ......" | 20514450 |
| hsa-miR-663b | glioblastoma | PIK3CD | "Primate specific miR 663 functions as a tumor supp ......" | 24523440 |
| hsa-miR-663b | breast cancer | PRG2 | "The overexpression of hypomethylated miR 663 induc ......" | 23436656 |