microRNA information: hsa-miR-675-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-675-3p | miRbase |
| Accession: | MIMAT0006790 | miRbase |
| Precursor name: | hsa-mir-675 | miRbase |
| Precursor accession: | MI0005416 | miRbase |
| Symbol: | MIR675 | HGNC |
| RefSeq ID: | NR_030533 | GenBank |
| Sequence: | CUGUAUGCCCUCACCGCUCA |
Reported expression in cancers: hsa-miR-675-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|---|---|---|---|---|
| hsa-miR-675-3p | breast cancer | upregulation | "Over expression of miR 675 in formalin fixed paraf ......" | 26379923 | qPCR |
Reported cancer pathway affected by hsa-miR-675-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-675-3p | bladder cancer | cell cycle pathway; Apoptosis pathway | "H19 derived miR 675 contributes to bladder cancer ......" | 26198047 | Western blot; Flow cytometry |
| hsa-miR-675-3p | liver cancer | cell cycle pathway | "miR 675 mediates downregulation of Twist1 and Rb i ......" | 23864307 | Colony formation |
Reported cancer prognosis affected by hsa-miR-675-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-675-3p | breast cancer | metastasis; tumorigenesis | "H19 non coding RNA derived miR 675 enhances tumori ......" | 26353930 | Luciferase |
| hsa-miR-675-3p | breast cancer | staging | "Over expression of miR 675 in formalin fixed paraf ......" | 26379923 | |
| hsa-miR-675-3p | colorectal cancer | tumorigenesis | "Oncofetal H19 derived miR 675 regulates tumor supp ......" | 19926638 | Luciferase; Colony formation |
| hsa-miR-675-3p | gastric cancer | tumorigenesis | "The long non coding RNA H19 derived miR 675 modula ......" | 24388988 | Western blot; Luciferase |
| hsa-miR-675-3p | gastric cancer | progression | "Long Noncoding RNA H19 Derived miR 675 Enhances Pr ......" | 26931432 | |
| hsa-miR-675-3p | liver cancer | motility | "miR 675 mediates downregulation of Twist1 and Rb i ......" | 23864307 | Colony formation |
| hsa-miR-675-3p | liver cancer | tumorigenesis | "MiR 675 Promotes the Growth of Hepatocellular Carc ......" | 27644634 | MTT assay; Western blot |
| hsa-miR-675-3p | lung squamous cell cancer | progression | "Down regulation of miR 675 5p contributes to tumor ......" | 25889562 | Western blot |
| hsa-miR-675-3p | pancreatic cancer | staging; differentiation | "Expressions of miRNAs were determined with the Taq ......" | 22851141 | |
| hsa-miR-675-3p | prostate cancer | cell migration; metastasis | "In this study we found that long non-coding RNA H1 ......" | 24988946 | Luciferase |
Reported gene related to hsa-miR-675-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-675-3p | bladder cancer | H19 | "H19 derived miR 675 contributes to bladder cancer ......" | 26198047 |
| hsa-miR-675-3p | breast cancer | H19 | "H19 is a long non-coding RNA precursor of miR-675 ......" | 26353930 |
| hsa-miR-675-3p | colorectal cancer | H19 | "Oncofetal H19 derived miR 675 regulates tumor supp ......" | 19926638 |
| hsa-miR-675-3p | gastric cancer | H19 | "Long Noncoding RNA H19 Derived miR 675 Enhances Pr ......" | 26931432 |
| hsa-miR-675-3p | gastric cancer | H19 | "The long non coding RNA H19 derived miR 675 modula ......" | 24388988 |
| hsa-miR-675-3p | liver cancer | H19 | "H19 has recently been identified to encode microRN ......" | 23864307 |
| hsa-miR-675-3p | liver cancer | CDC25A | "MiR 675 Promotes the Growth of Hepatocellular Carc ......" | 27644634 |
| hsa-miR-675-3p | liver cancer | CDC25A | "The levels of LncRNAH19 and miR-675 were detected ......" | 24939300 |
| hsa-miR-675-3p | gastric cancer | RUNX1 | "Long Noncoding RNA H19 Derived miR 675 Enhances Pr ......" | 26931432 |
| hsa-miR-675-3p | gastric cancer | RUNX1 | "The long non coding RNA H19 derived miR 675 modula ......" | 24388988 |
| hsa-miR-675-3p | breast cancer | CBL | "Moreover we identified ubiquitin ligase E3 family ......" | 26353930 |
| hsa-miR-675-3p | breast cancer | CBLB | "Moreover we identified ubiquitin ligase E3 family ......" | 26353930 |
| hsa-miR-675-3p | lung squamous cell cancer | GPR55 | "Down regulation of miR 675 5p contributes to tumor ......" | 25889562 |
| hsa-miR-675-3p | prostate cancer | TGFBI | "Dual luciferase reporter assays showed that miR-67 ......" | 24988946 |
| hsa-miR-675-3p | bladder cancer | TP53 | "H19 derived miR 675 contributes to bladder cancer ......" | 26198047 |
Expression profile in cancer corhorts:
