microRNA information: hsa-miR-760
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-760 | miRbase |
Accession: | MIMAT0004957 | miRbase |
Precursor name: | hsa-mir-760 | miRbase |
Precursor accession: | MI0005567 | miRbase |
Symbol: | MIR760 | HGNC |
RefSeq ID: | NR_030621 | GenBank |
Sequence: | CGGCUCUGGGUCUGUGGGGA |
Reported expression in cancers: hsa-miR-760
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-760 | breast cancer | downregulation | "Systematic analysis of gene expression pattern in ......" | 25661353 | |
hsa-miR-760 | gastric cancer | downregulation | "Contrasting expression patterns of histone mRNA an ......" | 24097871 | RNA-Seq; qPCR |
hsa-miR-760 | ovarian cancer | upregulation | "miR-760 expression in ovarian cancer cell lines an ......" | 27726922 | qPCR |
Reported cancer pathway affected by hsa-miR-760
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-760 | breast cancer | NA | "Systematic analysis of gene expression pattern in ......" | 25661353 |
Reported cancer prognosis affected by hsa-miR-760
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-760 | breast cancer | drug resistance | "We created a doxorubicin-resistant MCF-7 MCF-/Adr ......" | 25451164 | MTT assay |
hsa-miR-760 | breast cancer | drug resistance | "Systematic analysis of gene expression pattern in ......" | 25661353 | |
hsa-miR-760 | colorectal cancer | staging | "Plasma miR 601 and miR 760 are novel biomarkers fo ......" | 22970209 | |
hsa-miR-760 | colorectal cancer | progression | "Of these 3 upregulated let-7b miR-1290 and miR-126 ......" | 27698796 | |
hsa-miR-760 | gastric cancer | staging | "Contrasting expression patterns of histone mRNA an ......" | 24097871 | Luciferase |
hsa-miR-760 | ovarian cancer | progression; worse prognosis; tumorigenesis | "MiR 760 overexpression promotes proliferation in o ......" | 27726922 | Colony formation; Western blot; Luciferase |
Reported gene related to hsa-miR-760
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-760 | breast cancer | ABCA1 | "There were 3 predicted target genes RHOB ANGOTL4 ......" | 25661353 |
hsa-miR-760 | breast cancer | GNB2 | "GO analysis result appeared that the predicted tar ......" | 25661353 |
hsa-miR-760 | ovarian cancer | PHLPP2 | "MiR 760 overexpression promotes proliferation in o ......" | 27726922 |
hsa-miR-760 | breast cancer | RHOB | "There were 3 predicted target genes RHOB ANGOTL4 ......" | 25661353 |
Expression profile in cancer corhorts: