microRNA information: hsa-miR-770-5p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-770-5p | miRbase |
| Accession: | MIMAT0003948 | miRbase |
| Precursor name: | hsa-mir-770 | miRbase |
| Precursor accession: | MI0005118 | miRbase |
| Symbol: | MIR770 | HGNC |
| RefSeq ID: | NR_030528 | GenBank |
| Sequence: | UCCAGUACCACGUGUCAGGGCCA |
Reported expression in cancers: hsa-miR-770-5p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-770-5p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-770-5p | ovarian cancer | Apoptosis pathway | "MiR 770 5p inhibits cisplatin chemoresistance in h ......" | 27449101 |
Reported cancer prognosis affected by hsa-miR-770-5p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-770-5p | ovarian cancer | drug resistance; poor survival | "MiR 770 5p inhibits cisplatin chemoresistance in h ......" | 27449101 |
Reported gene related to hsa-miR-770-5p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-770-5p | ovarian cancer | ERCC2 | "MiR 770 5p inhibits cisplatin chemoresistance in h ......" | 27449101 |
| hsa-miR-770-5p | liver cancer | FBXW7 | "Wnt/β catenin signaling inhibits FBXW7 expression ......" | 26602384 |
| hsa-miR-770-5p | ovarian cancer | NR1H2 | "ERCC2 a target gene of miR-770-5p that participate ......" | 27449101 |
| hsa-miR-770-5p | ovarian cancer | ST8 | "In this study we examined the role of the miRNA mi ......" | 27449101 |