microRNA information: hsa-miR-887-3p
| Section | ID | link |
|---|---|---|
| Mature name: | hsa-miR-887-3p | miRbase |
| Accession: | MIMAT0004951 | miRbase |
| Precursor name: | hsa-mir-887 | miRbase |
| Precursor accession: | MI0005562 | miRbase |
| Symbol: | MIR887 | HGNC |
| RefSeq ID: | NR_030616 | GenBank |
| Sequence: | GUGAACGGGCGCCAUCCCGAGG |
Reported expression in cancers: hsa-miR-887-3p
| miRNA | cancer | regulation | reporting | PUBMED | method |
|---|
Reported cancer pathway affected by hsa-miR-887-3p
| miRNA | cancer | pathway | reporting | PUBMED | functional study |
|---|
Reported cancer prognosis affected by hsa-miR-887-3p
| miRNA | cancer | prognosis | reporting | PUBMED | functional study |
|---|---|---|---|---|---|
| hsa-miR-887-3p | endometrial cancer | staging | "Changes in the Expression of Serum MiR 887 5p in P ......" | 27177284 | |
| hsa-miR-887-3p | prostate cancer | metastasis; progression | "Computational predictions revealed that the rs4245 ......" | 25670033 |
Reported gene related to hsa-miR-887-3p
| miRNA | cancer | gene | reporting | PUBMED |
|---|---|---|---|---|
| hsa-miR-887-3p | lung squamous cell cancer | MDM4 | "After co-tranfection of miRNAs and different allel ......" | 26274820 |
| hsa-miR-887-3p | prostate cancer | MDM4 | "Herein we show using reporter gene assays and endo ......" | 25670033 |
| hsa-miR-887-3p | lung squamous cell cancer | SCLC1 | "After co-tranfection of miRNAs and different allel ......" | 26274820 |
Expression profile in cancer corhorts:
Putative target regulations
| miRNA | Gene | Cancer | Interaction | Correlation beta |
|---|---|---|---|---|
hsa-miR-887-3p | HEATR6 | 11 cancers: BLCA; CESC; ESCA; HNSC; KIRP; LGG; LUAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA BLCA -0.053; TCGA CESC -0.103; TCGA ESCA -0.09; TCGA HNSC -0.064; TCGA KIRP -0.058; TCGA LGG -0.065; TCGA LUAD -0.05; TCGA PRAD -0.074; TCGA THCA -0.07; TCGA STAD -0.074; TCGA UCEC -0.065 |
hsa-miR-887-3p | MORC3 | 9 cancers: BLCA; CESC; COAD; HNSC; LGG; LIHC; PRAD; THCA; STAD | MirTarget | TCGA BLCA -0.085; TCGA CESC -0.075; TCGA COAD -0.102; TCGA HNSC -0.085; TCGA LGG -0.08; TCGA LIHC -0.07; TCGA PRAD -0.063; TCGA THCA -0.081; TCGA STAD -0.09 |
hsa-miR-887-3p | NPAT | 9 cancers: COAD; HNSC; KIRP; LGG; LUAD; PRAD; THCA; STAD; UCEC | MirTarget | TCGA COAD -0.12; TCGA HNSC -0.07; TCGA KIRP -0.06; TCGA LGG -0.115; TCGA LUAD -0.069; TCGA PRAD -0.131; TCGA THCA -0.109; TCGA STAD -0.114; TCGA UCEC -0.053 |
Enriched cancer pathways of putative targets