microRNA information: hsa-miR-99a-5p
Section | ID | link |
---|---|---|
Mature name: | hsa-miR-99a-5p | miRbase |
Accession: | MIMAT0000097 | miRbase |
Precursor name: | hsa-mir-99a | miRbase |
Precursor accession: | MI0000101 | miRbase |
Symbol: | MIR99A | HGNC |
RefSeq ID: | NR_029514 | GenBank |
Sequence: | AACCCGUAGAUCCGAUCUUGUG |
Reported expression in cancers: hsa-miR-99a-5p
miRNA | cancer | regulation | reporting | PUBMED | method |
---|---|---|---|---|---|
hsa-miR-99a-5p | bladder cancer | downregulation | "microRNA 99a acts as a tumor suppressor and is dow ......" | 24957100 | qPCR |
hsa-miR-99a-5p | bladder cancer | downregulation | "Cell free urinary microRNA 99a and microRNA 125b a ......" | 25014919 | Microarray; qPCR |
hsa-miR-99a-5p | bladder cancer | downregulation | "In the first - discovery - phase microarray cards ......" | 27468885 | Microarray; qPCR |
hsa-miR-99a-5p | breast cancer | downregulation | "miR-99a has been reported as a tumor suppressor ge ......" | 24637915 | |
hsa-miR-99a-5p | breast cancer | downregulation | "Based on microarray data we identified miR-99a as ......" | 26417931 | Microarray |
hsa-miR-99a-5p | breast cancer | downregulation | "Low levels of serum miR 99a is a predictor of poor ......" | 27706621 | qPCR |
hsa-miR-99a-5p | cervical and endocervical cancer | downregulation | "Here we showed that miR-99a and -99b miR-99a/b wer ......" | 24668416 | |
hsa-miR-99a-5p | colon cancer | downregulation | "Among the miRNAs demonstrating the largest fold up ......" | 21694772 | |
hsa-miR-99a-5p | esophageal cancer | downregulation | "In this study we focused on miR-99a and miR-100 wh ......" | 23292834 | qPCR |
hsa-miR-99a-5p | gastric cancer | deregulation | "miRNA expression signature was first analyzed by r ......" | 21628394 | qPCR |
hsa-miR-99a-5p | head and neck cancer | downregulation | "To explore circulating miRNAs as cancer therapy bi ......" | 25950115 | qPCR; Microarray |
hsa-miR-99a-5p | kidney renal cell cancer | downregulation | "MicroRNA 99a induces G1 phase cell cycle arrest an ......" | 23173671 | Reverse transcription PCR; qPCR |
hsa-miR-99a-5p | kidney renal cell cancer | downregulation | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
hsa-miR-99a-5p | liver cancer | downregulation | "MicroRNA 99a inhibits hepatocellular carcinoma gro ......" | 21878637 | RNA-Seq |
hsa-miR-99a-5p | lung cancer | downregulation | "miR-99a is frequently downregulated in various typ ......" | 26986073 | |
hsa-miR-99a-5p | lung squamous cell cancer | downregulation | "Recently several studies have shown that miR-99a i ......" | 25187230 | |
hsa-miR-99a-5p | lung squamous cell cancer | downregulation | "miRNA-99a miR-99a which is downregulated in severa ......" | 25663868 | qPCR |
hsa-miR-99a-5p | sarcoma | deregulation | "The most significantly downregulated miRNAs were m ......" | 24027049 |
Reported cancer pathway affected by hsa-miR-99a-5p
miRNA | cancer | pathway | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-99a-5p | bladder cancer | cell cycle pathway | "microRNA 99a acts as a tumor suppressor and is dow ......" | 24957100 | |
hsa-miR-99a-5p | breast cancer | Apoptosis pathway | "MiR 99a antitumor activity in human breast cancer ......" | 24637915 | Luciferase |
hsa-miR-99a-5p | cervical and endocervical cancer | mTOR signaling pathway | "miR 99a and 99b inhibit cervical cancer cell proli ......" | 24668416 | Luciferase |
hsa-miR-99a-5p | endometrial cancer | mTOR signaling pathway; Apoptosis pathway | "A dual PI3K/AKT/mTOR signaling inhibitor miR 99a s ......" | 27158364 | |
hsa-miR-99a-5p | esophageal cancer | Apoptosis pathway; mTOR signaling pathway | "In this study we focused on miR-99a and miR-100 wh ......" | 23292834 | Western blot; Luciferase |
hsa-miR-99a-5p | glioblastoma | PI3K/Akt signaling pathway; Apoptosis pathway | "Photofrin based photodynamic therapy and miR 99a t ......" | 23409016 | Western blot |
hsa-miR-99a-5p | head and neck cancer | mTOR signaling pathway | "Selected microRNAs including members of miR-99 fam ......" | 22425712 | |
hsa-miR-99a-5p | kidney renal cell cancer | cell cycle pathway | "MicroRNA 99a induces G1 phase cell cycle arrest an ......" | 23173671 | Colony formation; Western blot; Luciferase |
hsa-miR-99a-5p | liver cancer | cell cycle pathway | "MicroRNA 99a inhibits hepatocellular carcinoma gro ......" | 21878637 | |
hsa-miR-99a-5p | lung cancer | Apoptosis pathway | "Clinic significance of microRNA 99a expression in ......" | 23893385 | Western blot; Flow cytometry; Luciferase |
hsa-miR-99a-5p | lung cancer | cell cycle pathway | "MiR 99a regulates ROS mediated invasion and migrat ......" | 26986073 | |
hsa-miR-99a-5p | lung squamous cell cancer | cell cycle pathway | "Intriguingly D261 modified expressions of some miR ......" | 25046358 | |
hsa-miR-99a-5p | lung squamous cell cancer | cell cycle pathway | "microRNA 99a is downregulated and promotes prolife ......" | 25663868 | Colony formation |
hsa-miR-99a-5p | sarcoma | cell cycle pathway; Apoptosis pathway | "Tumor suppressive miR 99a inhibits cell proliferat ......" | 27158394 | Colony formation |
hsa-miR-99a-5p | thyroid cancer | Apoptosis pathway | "MiR 99a Inhibits Cell Proliferation and Tumorigene ......" | 26163618 | Luciferase |
Reported cancer prognosis affected by hsa-miR-99a-5p
miRNA | cancer | prognosis | reporting | PUBMED | functional study |
---|---|---|---|---|---|
hsa-miR-99a-5p | bladder cancer | cell migration | "microRNA 99a inhibiting cell proliferation migrati ......" | 24944696 | Western blot; Luciferase; Cell migration assay |
hsa-miR-99a-5p | bladder cancer | malignant trasformation | "Cell free urinary microRNA 99a and microRNA 125b a ......" | 25014919 | |
hsa-miR-99a-5p | bladder cancer | progression; poor survival | "Of the eight most important progression-related mi ......" | 25990459 | |
hsa-miR-99a-5p | bladder cancer | poor survival | "We identified an eight-miRNA signature including t ......" | 25991007 | |
hsa-miR-99a-5p | breast cancer | tumorigenesis | "MiR 99a antitumor activity in human breast cancer ......" | 24637915 | Luciferase |
hsa-miR-99a-5p | breast cancer | cell migration; malignant trasformation | "miR 99a directly targets the mTOR signalling pathw ......" | 25348507 | Western blot |
hsa-miR-99a-5p | breast cancer | metastasis; poor survival | "MicroRNA 99a inhibits tumor aggressive phenotypes ......" | 26417931 | Luciferase |
hsa-miR-99a-5p | breast cancer | worse prognosis | "MiR 99a suppress proliferation migration and invas ......" | 27212167 | MTT assay; Transwell assay; Luciferase; Western blot |
hsa-miR-99a-5p | breast cancer | worse prognosis; staging; metastasis; poor survival | "Low levels of serum miR 99a is a predictor of poor ......" | 27706621 | |
hsa-miR-99a-5p | cervical and endocervical cancer | metastasis | "miR 99a and 99b inhibit cervical cancer cell proli ......" | 24668416 | Luciferase |
hsa-miR-99a-5p | colorectal cancer | staging; drug resistance | "MiR 107 and miR 99a 3p predict chemotherapy respon ......" | 25197016 | |
hsa-miR-99a-5p | endometrial cancer | drug resistance | "Expression levels of ERα and PR and their respons ......" | 21472251 | |
hsa-miR-99a-5p | endometrial cancer | progression; differentiation; tumorigenesis | "A dual PI3K/AKT/mTOR signaling inhibitor miR 99a s ......" | 27158364 | |
hsa-miR-99a-5p | glioblastoma | poor survival | "Photofrin based photodynamic therapy and miR 99a t ......" | 23409016 | Western blot |
hsa-miR-99a-5p | head and neck cancer | tumorigenesis | "Selected microRNAs including members of miR-99 fam ......" | 22425712 | |
hsa-miR-99a-5p | kidney renal cell cancer | tumorigenesis; poor survival | "MicroRNA 99a induces G1 phase cell cycle arrest an ......" | 23173671 | Colony formation; Western blot; Luciferase |
hsa-miR-99a-5p | kidney renal cell cancer | worse prognosis | "Conversely decreased expression of miR-106b miR-99 ......" | 26416448 | |
hsa-miR-99a-5p | liver cancer | worse prognosis; poor survival | "MicroRNA 99a inhibits hepatocellular carcinoma gro ......" | 21878637 | |
hsa-miR-99a-5p | lung cancer | worse prognosis; staging; metastasis; poor survival | "Clinic significance of microRNA 99a expression in ......" | 23893385 | Western blot; Flow cytometry; Luciferase |
hsa-miR-99a-5p | lung cancer | progression; staging; metastasis | "MiR 99a regulates ROS mediated invasion and migrat ......" | 26986073 | |
hsa-miR-99a-5p | lung squamous cell cancer | metastasis; staging; tumorigenesis | "miR 99a suppresses the metastasis of human non sma ......" | 25187230 | |
hsa-miR-99a-5p | lung squamous cell cancer | cell migration | "microRNA 99a is downregulated and promotes prolife ......" | 25663868 | Colony formation |
hsa-miR-99a-5p | ovarian cancer | worse prognosis | "miR 99a promotes proliferation targeting FGFR3 in ......" | 24456664 | Luciferase |
hsa-miR-99a-5p | pancreatic cancer | tumorigenesis | "Antagonism of microRNA 99a promotes cell invasion ......" | 24461517 | |
hsa-miR-99a-5p | pancreatic cancer | worse prognosis; poor survival | "The aim of this study was to investigate microRNAs ......" | 25906450 | |
hsa-miR-99a-5p | prostate cancer | staging; worse prognosis | "miR 99 family of MicroRNAs suppresses the expressi ......" | 21212412 | |
hsa-miR-99a-5p | prostate cancer | drug resistance | "The miR-99 family has been shown to play an import ......" | 27340920 | |
hsa-miR-99a-5p | sarcoma | malignant trasformation; progression; worse prognosis | "Aberrant expression of microRNA 99a and its target ......" | 27073323 | |
hsa-miR-99a-5p | sarcoma | progression; metastasis | "Tumor suppressive miR 99a inhibits cell proliferat ......" | 27158394 | Colony formation |
hsa-miR-99a-5p | thyroid cancer | tumorigenesis | "MiR 99a Inhibits Cell Proliferation and Tumorigene ......" | 26163618 | Luciferase |
Reported gene related to hsa-miR-99a-5p
miRNA | cancer | gene | reporting | PUBMED |
---|---|---|---|---|
hsa-miR-99a-5p | breast cancer | MTOR | "miR 99a directly targets the mTOR signalling pathw ......" | 25348507 |
hsa-miR-99a-5p | breast cancer | MTOR | "MiR 99a antitumor activity in human breast cancer ......" | 24637915 |
hsa-miR-99a-5p | cervical and endocervical cancer | MTOR | "miR 99a and 99b inhibit cervical cancer cell proli ......" | 24668416 |
hsa-miR-99a-5p | endometrial cancer | MTOR | "Intriguingly two major members of this pathway AKT ......" | 27158364 |
hsa-miR-99a-5p | esophageal cancer | MTOR | "In conclusion these results indicated that miR-99a ......" | 23292834 |
hsa-miR-99a-5p | head and neck cancer | MTOR | "Furthermore ectopic transfection of miR-99 family ......" | 22425712 |
hsa-miR-99a-5p | kidney renal cell cancer | MTOR | "In addition we also fond that mammalian target of ......" | 23173671 |
hsa-miR-99a-5p | liver cancer | MTOR | "Insulin-like growth factor 1 receptor IGF-1R and m ......" | 21878637 |
hsa-miR-99a-5p | lung cancer | MTOR | "Functional analyses showed that upregulation of mi ......" | 23893385 |
hsa-miR-99a-5p | lung squamous cell cancer | MTOR | "Intriguingly D261 modified expressions of some miR ......" | 25046358 |
hsa-miR-99a-5p | sarcoma | MTOR | "Aberrant expression of microRNA 99a and its target ......" | 27073323 |
hsa-miR-99a-5p | thyroid cancer | MTOR | "MiR 99a Inhibits Cell Proliferation and Tumorigene ......" | 26163618 |
hsa-miR-99a-5p | glioblastoma | FGFR3 | "Photofrin based photodynamic therapy and miR 99a t ......" | 23409016 |
hsa-miR-99a-5p | glioblastoma | FGFR3 | "The tumorigenic FGFR3 TACC3 gene fusion escapes mi ......" | 23298836 |
hsa-miR-99a-5p | ovarian cancer | FGFR3 | "miR 99a promotes proliferation targeting FGFR3 in ......" | 24456664 |
hsa-miR-99a-5p | endometrial cancer | AKT1 | "Intriguingly two major members of this pathway AKT ......" | 27158364 |
hsa-miR-99a-5p | lung squamous cell cancer | AKT1 | "miR 99a suppresses the metastasis of human non sma ......" | 25187230 |
hsa-miR-99a-5p | prostate cancer | SMARCA5 | "The miR-99 family has been shown to play an import ......" | 27340920 |
hsa-miR-99a-5p | prostate cancer | SMARCA5 | "We determined that PSA is posttranscriptionally re ......" | 21212412 |
hsa-miR-99a-5p | sarcoma | ANXA5 | "In addition FACS and Annexin V assays identified t ......" | 27158394 |
hsa-miR-99a-5p | thyroid cancer | ATM | "Recently miR-99a has been reported as a tumor supp ......" | 26163618 |
hsa-miR-99a-5p | thyroid cancer | BP1 | "Up-regulation of miR-99a would markedly reduce the ......" | 26163618 |
hsa-miR-99a-5p | pancreatic cancer | CDH1 | "Antagonism of microRNA 99a promotes cell invasion ......" | 24461517 |
hsa-miR-99a-5p | bladder cancer | FOXA1 | "MicroRNA 99a and 100 mediated upregulation of FOXA ......" | 25071007 |
hsa-miR-99a-5p | breast cancer | HOXA1 | "MicroRNA 99a inhibits tumor aggressive phenotypes ......" | 26417931 |
hsa-miR-99a-5p | head and neck cancer | IGF1R | "Furthermore ectopic transfection of miR-99 family ......" | 22425712 |
hsa-miR-99a-5p | breast cancer | LINC00478 | "We found 78 miRNAs differentially expressed betwee ......" | 25388283 |
hsa-miR-99a-5p | lung cancer | NOX4 | "MiR 99a regulates ROS mediated invasion and migrat ......" | 26986073 |
hsa-miR-99a-5p | prostate cancer | NR3C1 | "Strikingly treatment of prostate cells with the gl ......" | 27340920 |
hsa-miR-99a-5p | lung cancer | ROS1 | "MiR 99a regulates ROS mediated invasion and migrat ......" | 26986073 |
hsa-miR-99a-5p | prostate cancer | SMARCD1 | "The miR-99 family has been shown to play an import ......" | 27340920 |
hsa-miR-99a-5p | glioblastoma | TACC3 | "The tumorigenic FGFR3 TACC3 gene fusion escapes mi ......" | 23298836 |
hsa-miR-99a-5p | sarcoma | TNFAIP8 | "Tumor suppressive miR 99a inhibits cell proliferat ......" | 27158394 |
hsa-miR-99a-5p | glioblastoma | TP53 | "Therefore our results indicated that the anti-tumo ......" | 23409016 |
hsa-miR-99a-5p | cervical and endocervical cancer | TRIB2 | "miR 99 inhibits cervical carcinoma cell proliferat ......" | 24137458 |
hsa-miR-99a-5p | prostate cancer | XRCC5 | "Relation between Ku80 and microRNA 99a expression ......" | 25937401 |
Expression profile in cancer corhorts:
Putative target regulations
miRNA | Gene | Cancer | Interaction | Correlation beta |
---|---|---|---|---|
hsa-miR-99a-5p | APEX1 | 9 cancers: BLCA; BRCA; COAD; LGG; LUAD; LUSC; PRAD; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.069; TCGA BRCA -0.089; TCGA COAD -0.083; TCGA LGG -0.069; TCGA LUAD -0.088; TCGA LUSC -0.101; TCGA PRAD -0.153; TCGA THCA -0.077; TCGA STAD -0.082 |
hsa-miR-99a-5p | DNAJA3 | 9 cancers: BLCA; BRCA; COAD; LUAD; LUSC; PAAD; SARC; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.059; TCGA BRCA -0.196; TCGA COAD -0.071; TCGA LUAD -0.068; TCGA LUSC -0.159; TCGA PAAD -0.071; TCGA SARC -0.062; TCGA STAD -0.114; TCGA UCEC -0.051 |
hsa-miR-99a-5p | EIF5A | 13 cancers: BLCA; BRCA; CESC; COAD; ESCA; HNSC; KIRC; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.078; TCGA BRCA -0.16; TCGA CESC -0.102; TCGA COAD -0.143; TCGA ESCA -0.103; TCGA HNSC -0.171; TCGA KIRC -0.098; TCGA LUAD -0.19; TCGA LUSC -0.183; TCGA PAAD -0.18; TCGA THCA -0.084; TCGA STAD -0.152; TCGA UCEC -0.129 |
hsa-miR-99a-5p | MAPK6 | 10 cancers: BLCA; COAD; HNSC; KIRC; LUAD; LUSC; OV; PRAD; THCA; STAD | miRNAWalker2 validate | TCGA BLCA -0.071; TCGA COAD -0.133; TCGA HNSC -0.128; TCGA KIRC -0.09; TCGA LUAD -0.241; TCGA LUSC -0.131; TCGA OV -0.073; TCGA PRAD -0.174; TCGA THCA -0.088; TCGA STAD -0.155 |
hsa-miR-99a-5p | MRPS33 | 10 cancers: BLCA; BRCA; CESC; COAD; LUAD; LUSC; PAAD; PRAD; SARC; STAD | miRNAWalker2 validate | TCGA BLCA -0.053; TCGA BRCA -0.145; TCGA CESC -0.051; TCGA COAD -0.085; TCGA LUAD -0.127; TCGA LUSC -0.178; TCGA PAAD -0.119; TCGA PRAD -0.068; TCGA SARC -0.055; TCGA STAD -0.089 |
hsa-miR-99a-5p | RPL36A | 9 cancers: BLCA; CESC; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC | miRNAWalker2 validate | TCGA BLCA -0.142; TCGA CESC -0.159; TCGA HNSC -0.213; TCGA KIRC -0.436; TCGA KIRP -0.136; TCGA LGG -0.126; TCGA LIHC -0.33; TCGA LUAD -0.195; TCGA LUSC -0.209 |
hsa-miR-99a-5p | RPS15 | 10 cancers: BLCA; BRCA; COAD; KIRC; KIRP; LGG; LIHC; LUSC; PAAD; STAD | miRNAWalker2 validate | TCGA BLCA -0.08; TCGA BRCA -0.096; TCGA COAD -0.06; TCGA KIRC -0.152; TCGA KIRP -0.149; TCGA LGG -0.113; TCGA LIHC -0.102; TCGA LUSC -0.063; TCGA PAAD -0.265; TCGA STAD -0.085 |
hsa-miR-99a-5p | SRPK1 | 14 cancers: BLCA; BRCA; CESC; COAD; ESCA; KIRP; LGG; LIHC; LUAD; LUSC; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.117; TCGA BRCA -0.144; TCGA CESC -0.091; TCGA COAD -0.114; TCGA ESCA -0.151; TCGA KIRP -0.056; TCGA LGG -0.086; TCGA LIHC -0.158; TCGA LUAD -0.235; TCGA LUSC -0.189; TCGA PRAD -0.161; TCGA THCA -0.144; TCGA STAD -0.191; TCGA UCEC -0.107 |
hsa-miR-99a-5p | TUBG1 | 15 cancers: BLCA; BRCA; COAD; ESCA; HNSC; LGG; LIHC; LUAD; LUSC; OV; PAAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BLCA -0.102; TCGA BRCA -0.266; TCGA COAD -0.117; TCGA ESCA -0.094; TCGA HNSC -0.109; TCGA LGG -0.053; TCGA LIHC -0.149; TCGA LUAD -0.245; TCGA LUSC -0.197; TCGA OV -0.09; TCGA PAAD -0.215; TCGA SARC -0.124; TCGA THCA -0.092; TCGA STAD -0.131; TCGA UCEC -0.12 |
hsa-miR-99a-5p | FZD5 | 9 cancers: BLCA; CESC; COAD; ESCA; OV; PRAD; SARC; STAD; UCEC | MirTarget; miRNATAP | TCGA BLCA -0.088; TCGA CESC -0.126; TCGA COAD -0.139; TCGA ESCA -0.334; TCGA OV -0.139; TCGA PRAD -0.092; TCGA SARC -0.12; TCGA STAD -0.122; TCGA UCEC -0.177 |
hsa-miR-99a-5p | DUSP9 | 9 cancers: BLCA; CESC; HNSC; LGG; LIHC; LUSC; OV; PAAD; UCEC | mirMAP | TCGA BLCA -0.153; TCGA CESC -0.263; TCGA HNSC -0.282; TCGA LGG -0.276; TCGA LIHC -0.717; TCGA LUSC -0.697; TCGA OV -0.306; TCGA PAAD -0.29; TCGA UCEC -0.193 |
hsa-miR-99a-5p | COQ2 | 12 cancers: BRCA; COAD; ESCA; LGG; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.126; TCGA COAD -0.117; TCGA ESCA -0.055; TCGA LGG -0.117; TCGA LUAD -0.092; TCGA LUSC -0.061; TCGA PAAD -0.131; TCGA PRAD -0.072; TCGA SARC -0.064; TCGA THCA -0.099; TCGA STAD -0.156; TCGA UCEC -0.059 |
hsa-miR-99a-5p | LMAN2 | 11 cancers: BRCA; COAD; ESCA; KIRC; KIRP; LGG; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.19; TCGA COAD -0.071; TCGA ESCA -0.068; TCGA KIRC -0.121; TCGA KIRP -0.065; TCGA LGG -0.084; TCGA LUSC -0.072; TCGA PAAD -0.205; TCGA THCA -0.055; TCGA STAD -0.062; TCGA UCEC -0.118 |
hsa-miR-99a-5p | NPM3 | 14 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD | miRNAWalker2 validate | TCGA BRCA -0.079; TCGA CESC -0.109; TCGA COAD -0.074; TCGA ESCA -0.113; TCGA HNSC -0.194; TCGA KIRP -0.122; TCGA LGG -0.153; TCGA LIHC -0.177; TCGA LUAD -0.198; TCGA LUSC -0.266; TCGA PAAD -0.152; TCGA PRAD -0.201; TCGA THCA -0.166; TCGA STAD -0.162 |
hsa-miR-99a-5p | PSMA2 | 14 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; LGG; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.116; TCGA CESC -0.067; TCGA COAD -0.064; TCGA ESCA -0.079; TCGA HNSC -0.117; TCGA KIRC -0.078; TCGA LGG -0.053; TCGA LUAD -0.139; TCGA LUSC -0.136; TCGA PAAD -0.089; TCGA PRAD -0.085; TCGA THCA -0.091; TCGA STAD -0.109; TCGA UCEC -0.082 |
hsa-miR-99a-5p | RARS | 16 cancers: BRCA; CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.088; TCGA CESC -0.103; TCGA COAD -0.087; TCGA ESCA -0.073; TCGA HNSC -0.104; TCGA KIRC -0.055; TCGA KIRP -0.063; TCGA LGG -0.053; TCGA LIHC -0.115; TCGA LUAD -0.133; TCGA LUSC -0.128; TCGA PAAD -0.06; TCGA PRAD -0.114; TCGA THCA -0.06; TCGA STAD -0.135; TCGA UCEC -0.067 |
hsa-miR-99a-5p | SEC13 | 11 cancers: BRCA; CESC; COAD; ESCA; LUAD; LUSC; PAAD; PRAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.155; TCGA CESC -0.068; TCGA COAD -0.081; TCGA ESCA -0.111; TCGA LUAD -0.109; TCGA LUSC -0.077; TCGA PAAD -0.12; TCGA PRAD -0.05; TCGA THCA -0.115; TCGA STAD -0.109; TCGA UCEC -0.075 |
hsa-miR-99a-5p | TMEM209 | 10 cancers: BRCA; COAD; ESCA; KIRC; LIHC; LUAD; LUSC; PAAD; PRAD; STAD | miRNAWalker2 validate | TCGA BRCA -0.095; TCGA COAD -0.065; TCGA ESCA -0.08; TCGA KIRC -0.085; TCGA LIHC -0.067; TCGA LUAD -0.15; TCGA LUSC -0.059; TCGA PAAD -0.076; TCGA PRAD -0.069; TCGA STAD -0.09 |
hsa-miR-99a-5p | TOMM22 | 9 cancers: BRCA; COAD; LGG; LUAD; LUSC; PAAD; PRAD; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.096; TCGA COAD -0.094; TCGA LGG -0.085; TCGA LUAD -0.079; TCGA LUSC -0.117; TCGA PAAD -0.069; TCGA PRAD -0.082; TCGA STAD -0.106; TCGA UCEC -0.074 |
hsa-miR-99a-5p | TYMS | 13 cancers: BRCA; COAD; KIRC; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; SARC; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.401; TCGA COAD -0.197; TCGA KIRC -0.242; TCGA LGG -0.359; TCGA LIHC -0.323; TCGA LUAD -0.416; TCGA LUSC -0.219; TCGA PAAD -0.163; TCGA PRAD -0.226; TCGA SARC -0.091; TCGA THCA -0.591; TCGA STAD -0.321; TCGA UCEC -0.181 |
hsa-miR-99a-5p | ZNF367 | 10 cancers: BRCA; COAD; ESCA; LGG; LUAD; LUSC; PAAD; THCA; STAD; UCEC | miRNAWalker2 validate | TCGA BRCA -0.337; TCGA COAD -0.154; TCGA ESCA -0.135; TCGA LGG -0.135; TCGA LUAD -0.362; TCGA LUSC -0.215; TCGA PAAD -0.107; TCGA THCA -0.233; TCGA STAD -0.275; TCGA UCEC -0.134 |
hsa-miR-99a-5p | EIF4A3 | 13 cancers: BRCA; CESC; COAD; KIRP; LIHC; LUAD; LUSC; OV; PAAD; PRAD; THCA; STAD; UCEC | RAID | TCGA BRCA -0.165; TCGA CESC -0.066; TCGA COAD -0.094; TCGA KIRP -0.066; TCGA LIHC -0.071; TCGA LUAD -0.208; TCGA LUSC -0.157; TCGA OV -0.066; TCGA PAAD -0.089; TCGA PRAD -0.085; TCGA THCA -0.055; TCGA STAD -0.131; TCGA UCEC -0.056 |
hsa-miR-99a-5p | COL4A1 | 12 cancers: CESC; ESCA; HNSC; KIRC; KIRP; LGG; LIHC; LUAD; OV; SARC; THCA; UCEC | miRNAWalker2 validate | TCGA CESC -0.161; TCGA ESCA -0.281; TCGA HNSC -0.304; TCGA KIRC -0.317; TCGA KIRP -0.133; TCGA LGG -0.29; TCGA LIHC -0.195; TCGA LUAD -0.103; TCGA OV -0.116; TCGA SARC -0.116; TCGA THCA -0.258; TCGA UCEC -0.089 |
hsa-miR-99a-5p | DDX18 | 9 cancers: CESC; ESCA; HNSC; KIRP; LUAD; LUSC; PRAD; SARC; STAD | miRNAWalker2 validate | TCGA CESC -0.071; TCGA ESCA -0.074; TCGA HNSC -0.06; TCGA KIRP -0.084; TCGA LUAD -0.155; TCGA LUSC -0.13; TCGA PRAD -0.077; TCGA SARC -0.068; TCGA STAD -0.123 |
hsa-miR-99a-5p | RPL37A | 10 cancers: CESC; KIRC; KIRP; LGG; LIHC; LUAD; LUSC; PAAD; PRAD; STAD | miRNAWalker2 validate | TCGA CESC -0.059; TCGA KIRC -0.101; TCGA KIRP -0.117; TCGA LGG -0.061; TCGA LIHC -0.138; TCGA LUAD -0.107; TCGA LUSC -0.097; TCGA PAAD -0.168; TCGA PRAD -0.11; TCGA STAD -0.06 |
hsa-miR-99a-5p | KBTBD8 | 9 cancers: CESC; COAD; ESCA; HNSC; KIRC; KIRP; LGG; OV; SARC | MirTarget | TCGA CESC -0.091; TCGA COAD -0.097; TCGA ESCA -0.108; TCGA HNSC -0.07; TCGA KIRC -0.161; TCGA KIRP -0.106; TCGA LGG -0.106; TCGA OV -0.102; TCGA SARC -0.11 |
hsa-miR-99a-5p | SLC44A1 | 9 cancers: ESCA; HNSC; KIRP; LUAD; LUSC; OV; PRAD; STAD; UCEC | miRNATAP | TCGA ESCA -0.107; TCGA HNSC -0.086; TCGA KIRP -0.105; TCGA LUAD -0.192; TCGA LUSC -0.174; TCGA OV -0.123; TCGA PRAD -0.193; TCGA STAD -0.157; TCGA UCEC -0.064 |
Enriched cancer pathways of putative targets