CR2Cancer

Summary
Symbol	PBRM1
Name	polybromo 1
Aliases	BAF180; PB1; BRG1-associated factor 180; polybromo-1D; hPB1; Protein polybromo-1
Location	3p21.1
External Links	HGNC, NCBI, Ensembl, Uniprot, GeneCards
Cancer Gene Databases	ONGene (Oncogene) , TSGene (Tumor suppressor gene) , NCG (Network of Cancer Genes)
Content	> Domain, Function and Classification > Gene Ontology > KEGG and Reactome Pathway

> Domain, Function and Classification

[ TOP ]

Domain

PF01426 BAH domain
PF00439 Bromodomain
PF00505 HMG (high mobility group) box

Function

Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Acts as a negative regulator of cell proliferation.

Classification

Class	Modification	Substrate	Product	PubMed
Histone modification read	#	H3	#	22464331

> Gene Ontology [ TOP ]
Biological Process	GO:0006338 chromatin remodeling GO:0007067 mitotic nuclear division
Molecular Function	GO:0003682 chromatin binding
Cellular Component	GO:0070603 SWI/SNF superfamily-type complex GO:0090544 BAF-type complex

> KEGG and Reactome Pathway [ TOP ]
KEGG	-
Reactome	R-HSA-3247509: Chromatin modifying enzymes R-HSA-4839726: Chromatin organization R-HSA-3214858: RMTs methylate histone arginines

Summary
Symbol	PBRM1
Name	polybromo 1
Aliases	BAF180; PB1; BRG1-associated factor 180; polybromo-1D; hPB1; Protein polybromo-1
Location	3p21.1
External Links	HGNC, NCBI, Ensembl, Uniprot, GeneCards
Cancer Gene Databases	ONGene (Oncogene) , TSGene (Tumor suppressor gene) , NCG (Network of Cancer Genes)
Content	> Mutation landscape in primary tumor tissue from TCGA > Mutation landscape in cancer cell line from CCLE > All mutations from COSMIC database V81 > Variations from text mining

> The Cancer Genome Atlas (TCGA) [ TOP ]

> Cancer Cell Line Encyclopedia (CCLE) [ TOP ]
There is no record.

> Catalogue of Somatic Mutations in Cancer (COSMIC)

[ TOP ]

COSMIC ID	CDS change	AA change	Mutation Type	Anatomical Site
COSM52786	c.856G>T	p.E286*	Substitution - Nonsense	Kidney
COSM1169580	c.3859G>A	p.E1287K	Substitution - Missense	Breast
COSM423071	c.1547delA	p.K516fs*3	Deletion - Frameshift	Kidney
COSM3365387	c.2392A>T	p.R798*	Substitution - Nonsense	Kidney
COSM5609772	c.2443C>T	p.P815S	Substitution - Missense	Skin
COSM5031165	c.?	p.D451Y	Substitution - Missense	Thymus
COSM308454	c.3398delA	p.D1133fs*26	Deletion - Frameshift	Kidney
COSM5762909	c.4585C>T	p.R1529C	Substitution - Missense	Haematopoietic_and_lymphoid_tissue
COSM5753361	c.?	p.?fs*?	Frameshift	Kidney
COSM5609769	c.3773_3774ins15	p.S1264_D1265insRYNES	Insertion - In frame	Skin
COSM1670260	c.4354C>T	p.Q1452*	Substitution - Nonsense	Lung
COSM5609763	c.4340G>A	p.G1447E	Substitution - Missense	Skin
COSM308460	c.724T>C	p.Y242H	Substitution - Missense	Kidney
COSM4119174	c.344A>T	p.D115V	Substitution - Missense	Stomach
COSM52835	c.1955C>G	p.S652*	Substitution - Nonsense	Kidney
COSM1732162	c.1983delA	p.K661fs*2	Deletion - Frameshift	Kidney
COSM4411268	c.3920delA	p.K1307fs*6	Deletion - Frameshift	Kidney
COSM1717436	c.?	p.V964D	Substitution - Missense	Biliary_tract
COSM398580	c.2344A>C	p.I782L	Substitution - Missense	Lung
COSM1169634	c.?	p.?	Unknown	Kidney
COSM52842	c.1318C>T	p.Q440*	Substitution - Nonsense	Kidney
COSM1600086	c.4576+2T>A	p.?	Unknown	Central_nervous_system
COSM1169605	c.2899G>T	p.E967*	Substitution - Nonsense	Kidney
COSM1047091	c.2461A>G	p.T821A	Substitution - Missense	Endometrium
COSM3365369	c.3409G>T	p.E1137*	Substitution - Nonsense	Kidney
COSM4186377	c.3040delG	p.E1014fs*19	Deletion - Frameshift	Kidney
COSM1732013	c.1760T>C	p.I587T	Substitution - Missense	Kidney
COSM5753359	c.?	p.E1501fs*?	Frameshift	Kidney
COSM4119147	c.3161A>T	p.E1054V	Substitution - Missense	Stomach
COSM5019205	c.996-4delG	p.?	Unknown	Soft_tissue
COSM52827	c.4694_4695insT	p.L1565fs*>19	Insertion - Frameshift	Kidney
COSM5020034	c.1925-5T>C	p.?	Unknown	Soft_tissue
COSM3358493	c.3762_3763insT	p.L1255fs*4	Insertion - Frameshift	Kidney
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM1727937	c.268C>T	p.Q90*	Substitution - Nonsense	Liver
COSM423107	c.2799delT	p.S934fs*80	Deletion - Frameshift	Kidney
COSM422820	c.3640G>T	p.E1214*	Substitution - Nonsense	Kidney
COSM1660061	c.1279delC	p.I428fs*10	Deletion - Frameshift	Kidney
COSM52929	c.1924_1925ins383	p.S642fs*5	Insertion - Frameshift	Breast
COSM423095	c.2296_2318del23	p.D766fs*22	Deletion - Frameshift	Kidney
COSM423118	c.3419delA	p.N1140fs*19	Deletion - Frameshift	Kidney
COSM1744930	c.3132delT	p.F1044fs*115	Deletion - Frameshift	Biliary_tract
COSM1745147	c.674delA	p.K225fs*4	Deletion - Frameshift	Urinary_tract
COSM52787	c.1162C>T	p.Q388*	Substitution - Nonsense	Kidney
COSM1309358	c.3926T>C	p.I1309T	Substitution - Missense	Urinary_tract
COSM480350	c.2576C>A	p.S859*	Substitution - Nonsense	Kidney
COSM3365398	c.1541+1G>T	p.?	Unknown	Kidney
COSM4119150	c.3151T>G	p.F1051V	Substitution - Missense	Stomach
COSM1753305	c.4530C>T	p.L1510L	Substitution - coding silent	Urinary_tract
COSM1169633	c.?	p.?	Unknown	Kidney
COSM5501071	c.1247_1248insA	p.Y417fs*3	Insertion - Frameshift	Biliary_tract
COSM5642805	c.2240A>G	p.K747R	Substitution - Missense	Oesophagus
COSM5931363	c.197G>A	p.R66K	Substitution - Missense	Skin
COSM5048721	c.1619G>C	p.R540T	Substitution - Missense	Oesophagus
COSM5059868	c.1087G>T	p.A363S	Substitution - Missense	Stomach
COSM480367	c.2128C>T	p.R710*	Substitution - Nonsense	Skin
COSM1169575	c.(1915_1917)delC	p.(L639)fs*?	Deletion - Frameshift	Kidney
COSM52782	c.3220A>T	p.K1074*	Substitution - Nonsense	Kidney
COSM52899	c.3805A>T	p.K1269*	Substitution - Nonsense	Kidney
COSM584218	c.2216A>G	p.N739S	Substitution - Missense	Skin
COSM4002747	c.3597A>T	p.P1199P	Substitution - coding silent	Soft_tissue
COSM422793	c.2761C>T	p.R921*	Substitution - Nonsense	Kidney
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Soft_tissue
COSM480376	c.1998T>A	p.Y666*	Substitution - Nonsense	Kidney
COSM1727770	c.2228C>T	p.S743F	Substitution - Missense	Liver
COSM423266	c.773_774insA	p.N258fs*6	Insertion - Frameshift	Kidney
COSM52830	c.348_352>T	p.Q117fs*56	Complex - frameshift	Kidney
COSM1047082	c.3263G>A	p.R1088Q	Substitution - Missense	Endometrium
COSM4446774	c.4066A>G	p.M1356V	Substitution - Missense	Skin
COSM422745	c.172C>T	p.R58*	Substitution - Nonsense	Large_intestine
COSM1047088	c.2613T>G	p.F871L	Substitution - Missense	Endometrium
COSM5520026	c.714G>A	p.Q238Q	Substitution - coding silent	Biliary_tract
COSM4002744	c.4335A>G	p.P1445P	Substitution - coding silent	Soft_tissue
COSM4119138	c.4128C>A	p.G1376G	Substitution - coding silent	Stomach
COSM3596192	c.1583A>G	p.N528S	Substitution - Missense	Skin
COSM52852	c.307delA	p.M103fs*10	Deletion - Frameshift	Kidney
COSM3974507	c.3120C>G	p.V1040V	Substitution - coding silent	Central_nervous_system
COSM4604716	c.2106G>A	p.K702K	Substitution - coding silent	Upper_aerodigestive_tract
COSM2854069	c.3235C>T	p.P1079S	Substitution - Missense	Large_intestine
COSM1169604	c.1637_1638delTT	p.F546fs*3	Deletion - Frameshift	Kidney
COSM4822762	c.1128C>G	p.I376M	Substitution - Missense	Cervix
COSM4771404	c.974_975insA	p.N325fs*4	Insertion - Frameshift	Kidney
COSM423303	c.2217_2218insC	p.E740fs*19	Insertion - Frameshift	Kidney
COSM5816745	c.2882G>T	p.G961V	Substitution - Missense	Liver
COSM52027	c.1850_1851insT	p.L617fs*	Insertion - Frameshift	Kidney
COSM1169574	c.442A>T	p.R148*	Substitution - Nonsense	Kidney
COSM4771422	c.1953_1954AT>G	p.S652fs*4	Deletion - Frameshift	Kidney
COSM4002747	c.3597A>T	p.P1199P	Substitution - coding silent	Soft_tissue
COSM1663338	c.1994T>C	p.V665A	Substitution - Missense	Kidney
COSM1309370	c.459G>A	p.Q153Q	Substitution - coding silent	Urinary_tract
COSM1169580	c.3859G>A	p.E1287K	Substitution - Missense	Kidney
COSM423132	c.3687delT	p.L1230fs*39	Deletion - Frameshift	Kidney
COSM3974513	c.1666C>T	p.P556S	Substitution - Missense	Central_nervous_system
COSM1665678	c.842delA	p.Y281fs*2	Deletion - Frameshift	Kidney
COSM52872	c.320_321delAT	p.D107fs*3	Deletion - Frameshift	Kidney
COSM5017266	c.2216_2217insA	p.N739fs*2	Insertion - Frameshift	Kidney
COSM480320	c.3605C>A	p.T1202K	Substitution - Missense	Kidney
COSM1169590	c.3767_3771delTTTGT	p.L1256fs*6	Deletion - Frameshift	Kidney
COSM3408799	c.4231C>T	p.R1411C	Substitution - Missense	Central_nervous_system
COSM3775249	c.546G>C	p.L182F	Substitution - Missense	Urinary_tract
COSM446845	c.1182G>C	p.R394S	Substitution - Missense	Breast
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM5736639	c.320A>G	p.D107G	Substitution - Missense	Small_intestine
COSM423047	c.489delT	p.D163fs*11	Deletion - Frameshift	Kidney
COSM1169601	c.4019_4022delCTTC	p.P1340fs*43	Deletion - Frameshift	Kidney
COSM52881	c.2764G>T	p.E922*	Substitution - Nonsense	Kidney
COSM480420	c.1264C>T	p.Q422*	Substitution - Nonsense	Kidney
COSM480306	c.4284T>G	p.Y1428*	Substitution - Nonsense	Kidney
COSM1159261	c.2047delA	p.I683fs*3	Deletion - Frameshift	Pancreas
COSM52784	c.1818+1G>A	p.?	Unknown	Kidney
COSM5742962	c.302T>A	p.L101Q	Substitution - Missense	Small_intestine
COSM1665672	c.1994delT	p.V665fs*5	Deletion - Frameshift	Kidney
COSM52824	c.3816delA	p.G1273fs*2	Deletion - Frameshift	Kidney
COSM3824346	c.2217T>C	p.N739N	Substitution - coding silent	Breast
COSM4333276	c.3083T>A	p.V1028D	Substitution - Missense	Biliary_tract
COSM1732020	c.3249_3253delCAGGT	p.R1084fs*21	Deletion - Frameshift	Kidney
COSM3358484	c.4207_4208delGA	p.D1403fs*18	Deletion - Frameshift	Kidney
COSM52790	c.4288+1G>T	p.?	Unknown	Kidney
COSM5006566	c.?_?del?	p.?fs*?	Deletion - Frameshift	Kidney
COSM1169580	c.3859G>A	p.E1287K	Substitution - Missense	Biliary_tract
COSM1261006	c.3692-1G>T	p.?	Unknown	Stomach
COSM4119159	c.2569A>G	p.T857A	Substitution - Missense	Stomach
COSM52901	c.748A>T	p.K250*	Substitution - Nonsense	Kidney
COSM52795	c.3007_3013delGAAACAT	p.E1003fs*9	Deletion - Frameshift	Kidney
COSM3365401	c.1444-2A>T	p.?	Unknown	Kidney
COSM4648728	c.2955G>A	p.E985E	Substitution - coding silent	Large_intestine
COSM1732151	c.3245delC	p.S1082fs*1	Deletion - Frameshift	Kidney
COSM480432	c.755T>G	p.I252R	Substitution - Missense	Kidney
COSM422762	c.651T>G	p.Y217*	Substitution - Nonsense	Kidney
COSM480403	c.1505C>G	p.S502*	Substitution - Nonsense	Kidney
COSM52853	c.310delG	p.E104fs*9	Deletion - Frameshift	Kidney
COSM4771392	c.97A>G	p.R33G	Substitution - Missense	Kidney
COSM5753366	c.?	p.K1373fs*?	Frameshift	Kidney
COSM52905	c.3199delA	p.T1067fs*92	Deletion - Frameshift	Kidney
COSM3596189	c.2149A>T	p.K717*	Substitution - Nonsense	Skin
COSM5490597	c.2567G>T	p.R856L	Substitution - Missense	Biliary_tract
COSM4949725	c.3327_3348del22	p.D1109fs*43	Deletion - Frameshift	Liver
COSM1485380	c.4296G>A	p.M1432I	Substitution - Missense	Breast
COSM52806	c.646-5T>G	p.?	Unknown	Kidney
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM1169662	c.(3745_3747)delA	p.(P1249)fs*?	Deletion - Frameshift	Kidney
COSM4002750	c.996-4G>A	p.?	Unknown	Haematopoietic_and_lymphoid_tissue
COSM308445	c.3759_3760insA	p.I1254fs*5	Insertion - Frameshift	Kidney
COSM4188840	c.3107_3108delTG	p.V1036fs*9	Deletion - Frameshift	Kidney
COSM1665669	c.2513_2517delATTTA	p.D838fs*7	Deletion - Frameshift	Kidney
COSM1732087	c.2887delT	p.Y963fs*51	Deletion - Frameshift	Kidney
COSM1663350	c.439A>C	p.T147P	Substitution - Missense	Kidney
COSM422759	c.625C>T	p.Q209*	Substitution - Nonsense	Kidney
COSM1732135	c.3292G>T	p.A1098S	Substitution - Missense	Kidney
COSM52890	c.1638_1639insT	p.M547fs*3	Insertion - Frameshift	Kidney
COSM480309	c.4249T>G	p.W1417G	Substitution - Missense	Kidney
COSM4541853	c.3155G>A	p.R1052Q	Substitution - Missense	Skin
COSM422793	c.2761C>T	p.R921*	Substitution - Nonsense	Kidney
COSM5575972	c.4579C>T	p.R1527*	Substitution - Nonsense	Stomach
COSM52781	c.3892C>T	p.Q1298*	Substitution - Nonsense	Kidney
COSM422826	c.3848T>A	p.V1283E	Substitution - Missense	Kidney
COSM52883	c.2887T>C	p.Y963H	Substitution - Missense	Kidney
COSM1047094	c.1279C>T	p.P427S	Substitution - Missense	Endometrium
COSM4187934	c.3123+2delT	p.?	Unknown	Kidney
COSM4002744	c.4335A>G	p.P1445P	Substitution - coding silent	Soft_tissue
COSM1665687	c.412delT	p.C138fs*36	Deletion - Frameshift	Kidney
COSM422759	c.625C>T	p.Q209*	Substitution - Nonsense	Kidney
COSM1169651	c.4370_4371insTT	p.L1457fs*33	Insertion - Frameshift	Kidney
COSM52896	c.3703delG	p.V1235fs*34	Deletion - Frameshift	Kidney
COSM1309367	c.2299G>C	p.E767Q	Substitution - Missense	Urinary_tract
COSM1424552	c.829A>T	p.K277*	Substitution - Nonsense	Large_intestine
COSM52889	c.1253delC	p.P418fs*20	Deletion - Frameshift	Kidney
COSM1732214	c.4376C>T	p.P1459L	Substitution - Missense	Kidney
COSM308457	c.446delA	p.N149fs*25	Deletion - Frameshift	Kidney
COSM5044478	c.1302-3C>G	p.?	Unknown	Kidney
COSM4771413	c.3095_3096TA>AAA	p.L1032fs*14	Complex - frameshift	Kidney
COSM480423	c.1112C>G	p.S371*	Substitution - Nonsense	Kidney
COSM5006566	c.?_?del?	p.?fs*?	Deletion - Frameshift	Kidney
COSM5019205	c.996-4delG	p.?	Unknown	Soft_tissue
COSM4603746	c.1658delA	p.K553fs*16	Deletion - Frameshift	Kidney
COSM52793	c.1373delA	p.N458fs*17	Deletion - Frameshift	Kidney
COSM52826	c.3461_3464delATGA	p.N1154fs*4	Deletion - Frameshift	Kidney
COSM4771407	c.3675_3675delC	p.M1226fs*1	Deletion - Frameshift	Kidney
COSM5928507	c.4042C>T	p.P1348S	Substitution - Missense	Skin
COSM1692825	c.4310C>T	p.A1437V	Substitution - Missense	Skin
COSM52863	c.835delA	p.I279fs*4	Deletion - Frameshift	Kidney
COSM1169632	c.138+2delT	p.?	Unknown	Kidney
COSM1169592	c.4032_4032delG	p.Q1344fs*40	Deletion - Frameshift	Kidney
COSM4771394	c.275_280TTGACT>TGA	p.I92_L94>MM	Complex - deletion inframe	Kidney
COSM422817	c.3601G>T	p.E1201*	Substitution - Nonsense	Kidney
COSM423124	c.3523delC	p.R1175fs*43	Deletion - Frameshift	Kidney
COSM3358550	c.1442delA	p.Q481fs*19	Deletion - Frameshift	Kidney
COSM4411013	c.2354T>G	p.L785R	Substitution - Missense	Kidney
COSM5019205	c.996-4delG	p.?	Unknown	Skin
COSM731077	c.2966-1G>A	p.?	Unknown	Lung
COSM4002747	c.3597A>T	p.P1199P	Substitution - coding silent	Soft_tissue
COSM1291743	c.2540T>C	p.V847A	Substitution - Missense	Haematopoietic_and_lymphoid_tissue
COSM52903	c.2368_2369delAT	p.M790fs*5	Deletion - Frameshift	Kidney
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Soft_tissue
COSM4410707	c.435delT	p.R146fs*28	Deletion - Frameshift	Kidney
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM4771411	c.2785G>T	p.E929*	Substitution - Nonsense	Kidney
COSM52865	c.1186delT	p.C396fs*8	Deletion - Frameshift	Kidney
COSM1663335	c.2627G>A	p.R876H	Substitution - Missense	Kidney
COSM1424552	c.829A>T	p.K277*	Substitution - Nonsense	Thymus
COSM422772	c.1443+1G>T	p.?	Unknown	Kidney
COSM3358541	c.1743_1747delTGGTG	p.G582fs*18	Deletion - Frameshift	Kidney
COSM3427747	c.1381C>T	p.R461C	Substitution - Missense	Large_intestine
COSM422751	c.236G>T	p.R79I	Substitution - Missense	Kidney
COSM480353	c.2548C>T	p.R850*	Substitution - Nonsense	Kidney
COSM4185512	c.4275delA	p.A1426fs*6	Deletion - Frameshift	Kidney
COSM1732074	c.2517_2519delATT	p.L839delL	Deletion - In frame	Kidney
COSM52816	c.1112_1131del20	p.S371fs*14	Deletion - Frameshift	Kidney
COSM52900	c.3854A>G	p.D1285G	Substitution - Missense	Kidney
COSM4452177	c.1635A>T	p.L545L	Substitution - coding silent	Skin
COSM5006581	c.?ins?	p.?fs*?	Insertion - Frameshift	Kidney
COSM5748999	c.2005G>C	p.V669L	Substitution - Missense	Pancreas
COSM1137073	c.1677T>A	p.Y559*	Substitution - Nonsense	Kidney
COSM307750	c.3123+1G>A	p.?	Unknown	Kidney
COSM422793	c.2761C>T	p.R921*	Substitution - Nonsense	Kidney
COSM674208	c.1007_1011CAGTA>T	p.A336fs*25	Complex - frameshift	Kidney
COSM1732165	c.3049G>T	p.V1017F	Substitution - Missense	Kidney
COSM4771424	c.2642_2643insTA	p.K881fs*35	Insertion - Frameshift	Kidney
COSM3993226	c.4404T>A	p.Y1468*	Substitution - Nonsense	Kidney
COSM5019205	c.996-4delG	p.?	Unknown	Soft_tissue
COSM731065	c.2467G>C	p.D823H	Substitution - Missense	Lung
COSM422787	c.2568-1G>A	p.?	Unknown	Kidney
COSM52886	c.442_443insA	p.R148fs*3	Insertion - Frameshift	Kidney
COSM5016011	c.1717_1718insT	p.H573fs*2	Insertion - Frameshift	Kidney
COSM4002744	c.4335A>G	p.P1445P	Substitution - coding silent	Soft_tissue
COSM4119168	c.361A>T	p.N121Y	Substitution - Missense	Stomach
COSM480356	c.2536G>T	p.E846*	Substitution - Nonsense	Kidney
COSM422834	c.4289-1G>C	p.?	Unknown	Kidney
COSM3358529	c.2242delG	p.D748fs*27	Deletion - Frameshift	Kidney
COSM3365384	c.2567+1G>A	p.?	Unknown	Kidney
COSM4002747	c.3597A>T	p.P1199P	Substitution - coding silent	Soft_tissue
COSM4002747	c.3597A>T	p.P1199P	Substitution - coding silent	Soft_tissue
COSM1137070	c.1918A>T	p.K640*	Substitution - Nonsense	Kidney
COSM422745	c.172C>T	p.R58*	Substitution - Nonsense	Kidney
COSM731050	c.552G>C	p.E184D	Substitution - Missense	Lung
COSM52780	c.3611A>C	p.H1204P	Substitution - Missense	Kidney
COSM1717437	c.?	p.A938fs*10	Unknown	Biliary_tract
COSM52822	c.165delT	p.N55fs*40	Deletion - Frameshift	Kidney
COSM52868	c.2126_2127insA	p.R710fs*13	Insertion - Frameshift	Kidney
COSM5750466	c.2380G>T	p.D794Y	Substitution - Missense	Stomach
COSM1665675	c.1281delC	p.I428fs*10	Deletion - Frameshift	Kidney
COSM5753354	c.?	p.P703L	Substitution - Missense	Kidney
COSM731053	c.676G>C	p.E226Q	Substitution - Missense	Lung
COSM480394	c.1757T>C	p.M586T	Substitution - Missense	Kidney
COSM1169593	c.646C>T	p.Q216*	Substitution - Nonsense	Kidney
COSM52801	c.1764delA	p.D589fs*2	Deletion - Frameshift	Kidney
COSM1663335	c.2627G>A	p.R876H	Substitution - Missense	Pancreas
COSM5457063	c.232C>T	p.R78*	Substitution - Nonsense	Large_intestine
COSM5708836	c.2402G>A	p.S801N	Substitution - Missense	Haematopoietic_and_lymphoid_tissue
COSM1047085	c.3100A>T	p.K1034*	Substitution - Nonsense	Endometrium
COSM1663335	c.2627G>A	p.R876H	Substitution - Missense	Biliary_tract
COSM5943951	c.996-5delT	p.?	Unknown	Skin
COSM308479	c.1432C>T	p.Q478*	Substitution - Nonsense	Kidney
COSM3358564	c.580_581delGT	p.V194fs*11	Deletion - Frameshift	Kidney
COSM4185412	c.1364_1371delTGTTTGAA	p.M455fs*6	Deletion - Frameshift	Kidney
COSM52906	c.3033delA	p.K1011fs*3	Deletion - Frameshift	Kidney
COSM3380653	c.2126T>A	p.I709N	Substitution - Missense	Pancreas
COSM5019959	c.1281C>T	p.P427P	Substitution - coding silent	Soft_tissue
COSM480412	c.1369G>T	p.E457*	Substitution - Nonsense	Kidney
COSM4411374	c.619delC	p.L207fs*17	Deletion - Frameshift	Kidney
COSM480356	c.2536G>T	p.E846*	Substitution - Nonsense	Kidney
COSM1732032	c.3830T>A	p.F1277Y	Substitution - Missense	Kidney
COSM4771388	c.2040_2042CAG>TC	p.S681fs*5	Complex - frameshift	Kidney
COSM5994796	c.171C>G	p.I57M	Substitution - Missense	Prostate
COSM4542032	c.3186G>A	p.R1062R	Substitution - coding silent	Skin
COSM4404189	c.2105A>C	p.K702T	Substitution - Missense	Skin
COSM4410598	c.1168_1169insT	p.Y390fs*2	Insertion - Frameshift	Kidney
COSM423068	c.1411delA	p.K471fs*4	Deletion - Frameshift	Kidney
COSM1047100	c.787_789delAAT	p.N263delN	Deletion - In frame	Endometrium
COSM52800	c.851delA	p.K284fs*16	Deletion - Frameshift	Kidney
COSM4771417	c.2756_2761delTAAAAC	p.L919_K920del	Deletion - In frame	Kidney
COSM4002747	c.3597A>T	p.P1199P	Substitution - coding silent	Soft_tissue
COSM52781	c.3892C>T	p.Q1298*	Substitution - Nonsense	Kidney
COSM5648964	c.1028C>G	p.S343*	Substitution - Nonsense	Oesophagus
COSM423300	c.1999_2000insTA	p.E667fs*4	Insertion - Frameshift	Kidney
COSM4771409	c.1819-1G>A	p.?	Unknown	Kidney
COSM52829	c.3221_3222delAA	p.K1074fs*32	Deletion - Frameshift	Kidney
COSM480367	c.2128C>T	p.R710*	Substitution - Nonsense	Biliary_tract
COSM1732144	c.1573delA	p.I525fs*44	Deletion - Frameshift	Kidney
COSM480459	c.139-2A>G	p.?	Unknown	Kidney
COSM5049096	c.1672T>C	p.Y558H	Substitution - Missense	Oesophagus
COSM3358481	c.4242delG	p.T1415fs*17	Deletion - Frameshift	Kidney
COSM5951575	c.3392_3393insA	p.E1132fs*11	Insertion - Frameshift	Oesophagus
COSM2854250	c.39C>T	p.S13S	Substitution - coding silent	Large_intestine
COSM3945597	c.1069G>A	p.E357K	Substitution - Missense	Lung
COSM52818	c.2386delG	p.E796fs*9	Deletion - Frameshift	Kidney
COSM4002747	c.3597A>T	p.P1199P	Substitution - coding silent	Soft_tissue
COSM52852	c.307delA	p.M103fs*10	Deletion - Frameshift	Kidney
COSM1663330	c.3554G>C	p.R1185P	Substitution - Missense	Kidney
COSM52864	c.2873_2879delACCATGT	p.Y958fs*54	Deletion - Frameshift	Kidney
COSM5753356	c.?	p.K553*	Substitution - Nonsense	Kidney
COSM52879	c.1618A>G	p.R540G	Substitution - Missense	Kidney
COSM423263	c.362_363insA	p.N121fs*8	Insertion - Frameshift	Kidney
COSM4513986	c.958C>T	p.L320F	Substitution - Missense	Skin
COSM2854208	c.682A>G	p.I228V	Substitution - Missense	Skin
COSM3781665	c.3875+1G>A	p.?	Unknown	Pancreas
COSM52787	c.1162C>T	p.Q388*	Substitution - Nonsense	Kidney
COSM5049093	c.2129G>C	p.R710P	Substitution - Missense	Oesophagus
COSM1047076	c.3947T>G	p.F1316C	Substitution - Missense	Endometrium
COSM52805	c.1983A>T	p.K661N	Substitution - Missense	Kidney
COSM52889	c.1253delC	p.P418fs*20	Deletion - Frameshift	Kidney
COSM480353	c.2548C>T	p.R850*	Substitution - Nonsense	Kidney
COSM3358505	c.3058_3059delAG	p.S1020fs*1	Deletion - Frameshift	Kidney
COSM1660000	c.3698_3704delGTGCTGT	p.A1234fs*33	Deletion - Frameshift	Kidney
COSM4410598	c.1168_1169insT	p.Y390fs*2	Insertion - Frameshift	Kidney
COSM422745	c.172C>T	p.R58*	Substitution - Nonsense	Large_intestine
COSM480456	c.286A>T	p.K96*	Substitution - Nonsense	Kidney
COSM4152504	c.1819-3T>G	p.?	Unknown	Kidney
COSM3774111	c.4511T>C	p.L1504P	Substitution - Missense	Kidney
COSM4002744	c.4335A>G	p.P1445P	Substitution - coding silent	Haematopoietic_and_lymphoid_tissue
COSM52871	c.166_167insA	p.T56fs*6	Insertion - Frameshift	Kidney
COSM5006566	c.?_?del?	p.?fs*?	Deletion - Frameshift	Kidney
COSM1169589	c.4693_4705del13	p.L1565fs*11	Deletion - Frameshift	Kidney
COSM5556977	c.555C>A	p.I185I	Substitution - coding silent	Prostate
COSM1169587	c.2822C>G	p.S941*	Substitution - Nonsense	Liver
COSM1744042	c.235A>T	p.R79*	Substitution - Nonsense	Biliary_tract
COSM4584544	c.3837C>G	p.L1279L	Substitution - coding silent	Bone
COSM52839	c.3633C>A	p.Y1211*	Substitution - Nonsense	Kidney
COSM1169587	c.2822C>G	p.S941*	Substitution - Nonsense	Kidney
COSM1665961	c.3534-2A>T	p.?	Unknown	Kidney
COSM3596201	c.255T>G	p.Y85*	Substitution - Nonsense	Skin
COSM3940596	c.1855A>T	p.K619*	Substitution - Nonsense	Oesophagus
COSM52848	c.1937_1955del19	p.G646fs*4	Deletion - Frameshift	Kidney
COSM4604674	c.2036G>T	p.R679L	Substitution - Missense	Upper_aerodigestive_tract
COSM52861	c.644delT	p.V215fs*9	Deletion - Frameshift	Kidney
COSM422778	c.1814C>T	p.S605F	Substitution - Missense	Kidney
COSM480409	c.1441C>T	p.Q481*	Substitution - Nonsense	Kidney
COSM1732110	c.1060G>T	p.E354*	Substitution - Nonsense	Kidney
COSM5399767	c.436C>T	p.R146*	Substitution - Nonsense	Skin
COSM5519969	c.2168_2169insT	p.M724fs*3	Insertion - Frameshift	Biliary_tract
COSM1732029	c.608_609insC	p.I204fs*2	Insertion - Frameshift	Kidney
COSM328834	c.2140A>T	p.M714L	Substitution - Missense	Liver
COSM52908	c.2783delC	p.A928fs*86	Deletion - Frameshift	Kidney
COSM52857	c.3534-21delTTATATATTTTCCTCCCCAAG	p.?	Unknown	Kidney
COSM1169572	c.3030_3030delA	p.K1011fs*3	Deletion - Frameshift	Kidney
COSM4002744	c.4335A>G	p.P1445P	Substitution - coding silent	Soft_tissue
COSM3358535	c.1914delA	p.K638fs*4	Deletion - Frameshift	Kidney
COSM1495644	c.125C>T	p.P42L	Substitution - Missense	Kidney
COSM52887	c.1823_1826delATAA	p.Y608fs*33	Deletion - Frameshift	Kidney
COSM4119135	c.4135C>T	p.R1379W	Substitution - Missense	Stomach
COSM480373	c.2068A>T	p.R690*	Substitution - Nonsense	Kidney
COSM4188891	c.3303delT	p.F1101fs*58	Deletion - Frameshift	Kidney
COSM422823	c.3732C>A	p.C1244*	Substitution - Nonsense	Kidney
COSM1219404	c.899+1G>A	p.?	Unknown	Large_intestine
COSM1159261	c.2047delA	p.I683fs*3	Deletion - Frameshift	Pancreas
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Soft_tissue
COSM4186748	c.3103T>C	p.C1035R	Substitution - Missense	Kidney
COSM1732103	c.1528G>T	p.A510S	Substitution - Missense	Kidney
COSM1047109	c.59A>G	p.D20G	Substitution - Missense	Endometrium
COSM6006365	c.3862A>G	p.I1288V	Substitution - Missense	Skin
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Soft_tissue
COSM5753368	c.?	p.Q238*	Substitution - Nonsense	Kidney
COSM1732049	c.2890G>C	p.V964L	Substitution - Missense	Kidney
COSM1663353	c.169A>G	p.I57V	Substitution - Missense	Kidney
COSM52819	c.3639delA	p.E1214fs*4	Deletion - Frameshift	Kidney
COSM731056	c.733A>T	p.I245F	Substitution - Missense	Lung
COSM480412	c.1369G>T	p.E457*	Substitution - Nonsense	Kidney
COSM3365390	c.1804G>T	p.E602*	Substitution - Nonsense	Kidney
COSM4410707	c.435delT	p.R146fs*28	Deletion - Frameshift	Kidney
COSM52828	c.1984_1985delCT	p.L662fs*2	Deletion - Frameshift	Kidney
COSM1169587	c.2822C>G	p.S941*	Substitution - Nonsense	Oesophagus
COSM423266	c.773_774insA	p.N258fs*6	Insertion - Frameshift	Small_intestine
COSM3365258	c.1854C>T	p.L618L	Substitution - coding silent	Kidney
COSM480382	c.1877G>T	p.G626V	Substitution - Missense	Kidney
COSM2854004	c.3901C>T	p.P1301S	Substitution - Missense	Large_intestine
COSM1600086	c.4576+2T>A	p.?	Unknown	Pancreas
COSM480450	c.508C>T	p.Q170*	Substitution - Nonsense	Kidney
COSM1137076	c.384G>A	p.K128K	Substitution - coding silent	Kidney
COSM423053	c.530_534delCTTCT	p.P179fs*11	Deletion - Frameshift	Kidney
COSM399954	c.3347C>G	p.S1116*	Substitution - Nonsense	Kidney
COSM480356	c.2536G>T	p.E846*	Substitution - Nonsense	Kidney
COSM1169631	c.528+1G>C	p.?	Unknown	Kidney
COSM5019959	c.1281C>T	p.P427P	Substitution - coding silent	Soft_tissue
COSM52847	c.1819-1G>C	p.?	Unknown	Kidney
COSM4444071	c.2885A>T	p.D962V	Substitution - Missense	Large_intestine
COSM1169634	c.?	p.?	Unknown	Salivary_gland
COSM1194744	c.145G>C	p.V49L	Substitution - Missense	Lung
COSM423169	c.4747delT	p.*1583fs?	Deletion - Frameshift	Kidney
COSM5490579	c.3164A>G	p.D1055G	Substitution - Missense	Biliary_tract
COSM422745	c.172C>T	p.R58*	Substitution - Nonsense	Kidney
COSM480338	c.2941G>T	p.E981*	Substitution - Nonsense	Kidney
COSM3365378	c.2934C>G	p.V978V	Substitution - coding silent	Kidney
COSM52863	c.835delA	p.I279fs*4	Deletion - Frameshift	Haematopoietic_and_lymphoid_tissue
COSM52910	c.3386delA	p.K1129fs*30	Deletion - Frameshift	Kidney
COSM4771421	c.529-1G>T	p.?	Unknown	Kidney
COSM1309355	c.3973G>A	p.D1325N	Substitution - Missense	Upper_aerodigestive_tract
COSM731071	c.2965+1G>C	p.?	Unknown	Lung
COSM52810	c.1850T>A	p.L617*	Substitution - Nonsense	Kidney
COSM5720045	c.3588C>T	p.F1196F	Substitution - coding silent	Skin
COSM422764	c.892C>T	p.R298*	Substitution - Nonsense	Kidney
COSM52833	c.715-2A>G	p.?	Unknown	Kidney
COSM1732116	c.3387+1G>A	p.?	Unknown	Kidney
COSM480412	c.1369G>T	p.E457*	Substitution - Nonsense	Kidney
COSM3365404	c.1243A>T	p.K415*	Substitution - Nonsense	Kidney
COSM2854033	c.3691G>T	p.G1231*	Substitution - Nonsense	Large_intestine
COSM4826705	c.1724T>A	p.I575N	Substitution - Missense	Cervix
COSM4771416	c.2837_2837delC	p.T946fs*68	Deletion - Frameshift	Kidney
COSM5829737	c.996-5_996-3delTGT	p.?	Unknown	Large_intestine
COSM4188675	c.4211delA	p.Y1404fs*28	Deletion - Frameshift	Kidney
COSM5554640	c.4305A>T	p.G1435G	Substitution - coding silent	Prostate
COSM1169633	c.?	p.?	Unknown	Kidney
COSM4630885	c.4162C>T	p.L1388L	Substitution - coding silent	Large_intestine
COSM3596183	c.3185G>A	p.R1062Q	Substitution - Missense	Skin
COSM4002747	c.3597A>T	p.P1199P	Substitution - coding silent	Soft_tissue
COSM52809	c.1657A>T	p.K553*	Substitution - Nonsense	Kidney
COSM4002744	c.4335A>G	p.P1445P	Substitution - coding silent	Soft_tissue
COSM5576282	c.3327_3329delTGA	p.D1109delD	Deletion - In frame	Stomach
COSM52825	c.3393delA	p.E1132fs*27	Deletion - Frameshift	Kidney
COSM3775246	c.1747G>A	p.E583K	Substitution - Missense	Urinary_tract
COSM731059	c.1367T>C	p.F456S	Substitution - Missense	Lung
COSM1047103	c.477C>T	p.D159D	Substitution - coding silent	Stomach
COSM4410598	c.1168_1169insT	p.Y390fs*2	Insertion - Frameshift	Kidney
COSM52811	c.1861A>G	p.K621E	Substitution - Missense	Kidney
COSM3358496	c.3761_3762insT	p.L1255fs*4	Insertion - Frameshift	Kidney
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM2854196	c.773delA	p.N258fs*25	Deletion - Frameshift	Large_intestine
COSM5829731	c.3124-3delC	p.?	Unknown	Large_intestine
COSM1732063	c.2638_2639insA	p.C880fs*1	Insertion - Frameshift	Kidney
COSM4186280	c.4222G>T	p.E1408*	Substitution - Nonsense	Kidney
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM1732190	c.210delG	p.E70fs*25	Deletion - Frameshift	Kidney
COSM423278	c.3008_3009insA	p.T1004fs*16	Insertion - Frameshift	Kidney
COSM3427750	c.1242G>T	p.K414N	Substitution - Missense	Large_intestine
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM52928	c.645_646ins409	p.Q216fs*7	Insertion - Frameshift	Breast
COSM52815	c.2915delA	p.N972fs*42	Deletion - Frameshift	Kidney
COSM52779	c.2335C>T	p.Q779*	Substitution - Nonsense	Kidney
COSM52792	c.1303delA	p.T435fs*3	Deletion - Frameshift	Kidney
COSM308475	c.753_756delTATA	p.D251fs*31	Deletion - Frameshift	Kidney
COSM4152512	c.640A>T	p.K214*	Substitution - Nonsense	Kidney
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM3358490	c.3839_3840delCT	p.S1280fs*2	Deletion - Frameshift	Kidney
COSM4152515	c.190C>T	p.Q64*	Substitution - Nonsense	Kidney
COSM423281	c.3279_3280insT	p.V1094fs*13	Insertion - Frameshift	Kidney
COSM5347624	c.237-1_237delGA	p.?	Unknown	Liver
COSM4152501	c.1819-2A>T	p.?	Unknown	Kidney
COSM3380653	c.2126T>A	p.I709N	Substitution - Missense	Pancreas
COSM52862	c.3471_3472delGC	p.W1157fs*23	Deletion - Frameshift	Kidney
COSM1137064	c.4387C>T	p.Q1463*	Substitution - Nonsense	Kidney
COSM1286984	c.1088-8_1089delCTTTCCAGCT	p.?	Unknown	Autonomic_ganglia
COSM423138	c.3810delA	p.K1270fs*5	Deletion - Frameshift	Kidney
COSM3696197	c.1700A>T	p.D567V	Substitution - Missense	Large_intestine
COSM1744933	c.125delC	p.P42fs*3	Deletion - Frameshift	Biliary_tract
COSM2854087	c.2945G>A	p.R982K	Substitution - Missense	Large_intestine
COSM4604941	c.2719A>T	p.K907*	Substitution - Nonsense	Upper_aerodigestive_tract
COSM5757627	c.?	p.?	Unknown	Kidney
COSM1732037	c.4289-1G>T	p.?	Unknown	Kidney
COSM52825	c.3393delA	p.E1132fs*27	Deletion - Frameshift	Kidney
COSM4584550	c.765C>T	p.L255L	Substitution - coding silent	Bone
COSM1047073	c.4196C>A	p.A1399D	Substitution - Missense	Endometrium
COSM358003	c.3818G>C	p.G1273A	Substitution - Missense	Lung
COSM480356	c.2536G>T	p.E846*	Substitution - Nonsense	Kidney
COSM4325778	c.996-7T>A	p.?	Unknown	Large_intestine
COSM5753362	c.?	p.?fs*?	Frameshift	Kidney
COSM1732077	c.3883delA	p.I1295fs*18	Deletion - Frameshift	Kidney
COSM4002747	c.3597A>T	p.P1199P	Substitution - coding silent	Soft_tissue
COSM1169603	c.4642_4642delA	p.S1548fs*18	Deletion - Frameshift	Kidney
COSM731080	c.2998C>G	p.R1000G	Substitution - Missense	Lung
COSM52838	c.3553C>T	p.R1185*	Substitution - Nonsense	Skin
COSM4397968	c.937C>T	p.P313S	Substitution - Missense	Skin
COSM5463283	c.4688G>A	p.R1563Q	Substitution - Missense	Large_intestine
COSM52876	c.2520T>A	p.F840L	Substitution - Missense	Kidney
COSM4991942	c.595C>T	p.P199S	Substitution - Missense	Skin
COSM423101	c.2419delA	p.I807fs*18	Deletion - Frameshift	Kidney
COSM1309358	c.3926T>C	p.I1309T	Substitution - Missense	Urinary_tract
COSM52851	c.2141delT	p.M714fs*17	Deletion - Frameshift	Kidney
COSM422802	c.3028C>T	p.R1010*	Substitution - Nonsense	Kidney
COSM480344	c.2605C>T	p.Q869*	Substitution - Nonsense	Kidney
COSM480356	c.2536G>T	p.E846*	Substitution - Nonsense	Kidney
COSM4410707	c.435delT	p.R146fs*28	Deletion - Frameshift	Kidney
COSM52836	c.1981A>T	p.K661*	Substitution - Nonsense	Kidney
COSM52902	c.761T>C	p.L254P	Substitution - Missense	Kidney
COSM1744930	c.3132delT	p.F1044fs*115	Deletion - Frameshift	Kidney
COSM5646384	c.4695_4696insT	p.M1566fs*>18	Insertion - Frameshift	Oesophagus
COSM5764815	c.2504G>A	p.R835H	Substitution - Missense	Large_intestine
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Soft_tissue
COSM423150	c.3996delA	p.D1333fs*51	Deletion - Frameshift	Kidney
COSM480325	c.3534-1G>C	p.?	Unknown	Kidney
COSM5829737	c.996-5_996-3delTGT	p.?	Unknown	Large_intestine
COSM52906	c.3033delA	p.K1011fs*3	Deletion - Frameshift	Kidney
COSM4771419	c.996-11_996-1>AA	p.?	Unknown	Kidney
COSM5895413	c.2775_2776delAA	p.E927fs*2	Deletion - Frameshift	Skin
COSM52784	c.1818+1G>A	p.?	Unknown	Kidney
COSM4771415	c.2587_2597del11	p.E863fs*8	Deletion - Frameshift	Kidney
COSM3358508	c.2977_2980delTTGT	p.L993fs*20	Deletion - Frameshift	Kidney
COSM3358500	c.3480delT	p.G1161fs*57	Deletion - Frameshift	Kidney
COSM480303	c.4688G>C	p.R1563P	Substitution - Missense	Kidney
COSM423056	c.682delA	p.I228fs*1	Deletion - Frameshift	Kidney
COSM480335	c.3046G>T	p.E1016*	Substitution - Nonsense	Kidney
COSM1665655	c.4430delC	p.P1477fs*12	Deletion - Frameshift	Kidney
COSM3775240	c.3145G>A	p.E1049K	Substitution - Missense	Urinary_tract
COSM52867	c.2124_2125delAA	p.K708fs*14	Deletion - Frameshift	Kidney
COSM1286987	c.1797delC	p.Y600fs*42	Deletion - Frameshift	Autonomic_ganglia
COSM1169602	c.842_854del13	p.Y281fs*15	Deletion - Frameshift	Kidney
COSM4002750	c.996-4G>A	p.?	Unknown	Kidney
COSM1663333	c.3188A>G	p.Y1063C	Substitution - Missense	Kidney
COSM5995134	c.4586G>A	p.R1529H	Substitution - Missense	Prostate
COSM1732060	c.3977_3978insT	p.E1327fs*1	Insertion - Frameshift	Kidney
COSM3775243	c.2966-1G>C	p.?	Unknown	Urinary_tract
COSM4535728	c.2226G>A	p.E742E	Substitution - coding silent	Skin
COSM52810	c.1850T>A	p.L617*	Substitution - Nonsense	Kidney
COSM52863	c.835delA	p.I279fs*4	Deletion - Frameshift	Lung
COSM52796	c.3127_3134delTACTTTAA	p.Y1043fs*9	Deletion - Frameshift	Kidney
COSM5752456	c.680delC	p.P227fs*2	Deletion - Frameshift	Breast
COSM52884	c.815delA	p.D272fs*11	Deletion - Frameshift	Kidney
COSM480332	c.3143C>G	p.P1048R	Substitution - Missense	Kidney
COSM1169649	c.3625_3626insA	p.M1209fs*11	Insertion - Frameshift	Kidney
COSM1617879	c.2568-2A>C	p.?	Unknown	Liver
COSM3358567	c.423_424insG	p.D142fs*9	Insertion - Frameshift	Kidney
COSM5006566	c.?_?del?	p.?fs*?	Deletion - Frameshift	Kidney
COSM3365261	c.562C>T	p.Q188*	Substitution - Nonsense	Kidney
COSM52808	c.2022T>G	p.D674E	Substitution - Missense	Kidney
COSM3775246	c.1747G>A	p.E583K	Substitution - Missense	Oesophagus
COSM480391	c.1803T>G	p.N601K	Substitution - Missense	Kidney
COSM5355602	c.3263G>T	p.R1088L	Substitution - Missense	Large_intestine
COSM4921748	c.4507T>C	p.Y1503H	Substitution - Missense	Liver
COSM5813977	c.1541+1G>C	p.?	Unknown	Liver
COSM1328123	c.2889C>G	p.Y963*	Substitution - Nonsense	Ovary
COSM4950029	c.2185delG	p.V729fs*2	Deletion - Frameshift	Liver
COSM422829	c.3956T>A	p.L1319*	Substitution - Nonsense	Kidney
COSM1261003	c.2609_2610insCA	p.Q870fs*46	Insertion - Frameshift	Stomach
COSM1485377	c.4339G>C	p.G1447R	Substitution - Missense	Breast
COSM1663341	c.1300C>T	p.R434*	Substitution - Nonsense	Kidney
COSM4765777	c.774_775insA	p.A259fs*5	Insertion - Frameshift	Stomach
COSM52888	c.3671delG	p.C1224fs*3	Deletion - Frameshift	Kidney
COSM1633254	c.3271C>G	p.P1091A	Substitution - Missense	Liver
COSM52866	c.2625delT	p.R876fs*39	Deletion - Frameshift	Kidney
COSM1659585	c.3630_3644del15	p.F1210_V1215>L	Complex - deletion inframe	Kidney
COSM52858	c.236+-6delAGCGAAGGT	p.?	Unknown	Kidney
COSM1137067	c.3699T>G	p.C1233W	Substitution - Missense	Kidney
COSM4411013	c.2354T>G	p.L785R	Substitution - Missense	Kidney
COSM52791	c.2154_2156delCCA	p.Y718_Q719>*	Complex - deletion inframe	Kidney
COSM1659919	c.3968_3977del10	p.D1323fs*58	Deletion - Frameshift	Kidney
COSM1732055	c.1747G>T	p.E583*	Substitution - Nonsense	Kidney
COSM1732083	c.2779+1G>T	p.?	Unknown	Kidney
COSM480367	c.2128C>T	p.R710*	Substitution - Nonsense	Biliary_tract
COSM52787	c.1162C>T	p.Q388*	Substitution - Nonsense	Cervix
COSM52860	c.2240_2246delAAGATGC	p.K747fs*26	Deletion - Frameshift	Kidney
COSM52863	c.835delA	p.I279fs*4	Deletion - Frameshift	Large_intestine
COSM322493	c.995G>C	p.R332P	Substitution - Missense	Lung
COSM422745	c.172C>T	p.R58*	Substitution - Nonsense	Kidney
COSM1047079	c.3691G>A	p.G1231R	Substitution - Missense	Endometrium
COSM3596171	c.3897G>A	p.K1299K	Substitution - coding silent	Skin
COSM4119141	c.3869A>T	p.Y1290F	Substitution - Missense	Stomach
COSM5994796	c.171C>G	p.I57M	Substitution - Missense	Prostate
COSM1169579	c.1316_1316delA	p.N439fs*7	Deletion - Frameshift	Kidney
COSM480332	c.3143C>G	p.P1048R	Substitution - Missense	Kidney
COSM5011116	c.1717C>A	p.H573N	Substitution - Missense	Kidney
COSM423144	c.3876-18_3876-2del17	p.?	Unknown	Kidney
COSM423135	c.3745delA	p.I1249fs*20	Deletion - Frameshift	Kidney
COSM51949	c.3445G>T	p.E1149*	Substitution - Nonsense	Kidney
COSM5020034	c.1925-5T>C	p.?	Unknown	Soft_tissue
COSM52898	c.4472_4474>AA	p.P1491fs*14	Complex - frameshift	Kidney
COSM52790	c.4288+1G>T	p.?	Unknown	Kidney
COSM52790	c.4288+1G>T	p.?	Unknown	Kidney
COSM480330	c.3154C>T	p.R1052*	Substitution - Nonsense	Kidney
COSM4002744	c.4335A>G	p.P1445P	Substitution - coding silent	Soft_tissue
COSM422778	c.1814C>T	p.S605F	Substitution - Missense	Skin
COSM308448	c.1942delT	p.S648fs*8	Deletion - Frameshift	Kidney
COSM480397	c.1757T>A	p.M586K	Substitution - Missense	Kidney
COSM52838	c.3553C>T	p.R1185*	Substitution - Nonsense	Endometrium
COSM1663347	c.755T>C	p.I252T	Substitution - Missense	Kidney
COSM52873	c.602G>T	p.G201V	Substitution - Missense	Kidney
COSM52896	c.3703delG	p.V1235fs*34	Deletion - Frameshift	Kidney
COSM423044	c.329delA	p.N110fs*3	Deletion - Frameshift	Kidney
COSM4711398	c.1069_1070insCA	p.E357fs*6	Insertion - Frameshift	Large_intestine
COSM4411013	c.2354T>G	p.L785R	Substitution - Missense	Kidney
COSM3365413	c.238A>T	p.N80Y	Substitution - Missense	Kidney
COSM1495589	c.3394G>T	p.E1132*	Substitution - Nonsense	Kidney
COSM4414035	c.1861A>T	p.K621*	Substitution - Nonsense	Kidney
COSM422767	c.1102G>T	p.E368*	Substitution - Nonsense	Kidney
COSM1169576	c.3505_3505delC	p.H1169fs*49	Deletion - Frameshift	Kidney
COSM1744924	c.3638_3639insA	p.E1214fs*6	Insertion - Frameshift	Biliary_tract
COSM3596186	c.2411T>A	p.L804*	Substitution - Nonsense	Skin
COSM52825	c.3393delA	p.E1132fs*27	Deletion - Frameshift	Kidney
COSM4152495	c.1955C>A	p.S652*	Substitution - Nonsense	Kidney
COSM5011119	c.1443G>T	p.Q481H	Substitution - Missense	Kidney
COSM422764	c.892C>T	p.R298*	Substitution - Nonsense	Kidney
COSM6006365	c.3862A>G	p.I1288V	Substitution - Missense	Skin
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Soft_tissue
COSM5572890	c.2980T>C	p.Y994H	Substitution - Missense	Prostate
COSM423092	c.2238_2253del16	p.K747fs*23	Deletion - Frameshift	Kidney
COSM4152507	c.712C>T	p.Q238*	Substitution - Nonsense	Kidney
COSM4411268	c.3920delA	p.K1307fs*6	Deletion - Frameshift	Kidney
COSM52895	c.3208_3210delTTT	p.F1070del	Deletion - In frame	Kidney
COSM3596177	c.3258C>T	p.V1086V	Substitution - coding silent	Skin
COSM1137064	c.4387C>T	p.Q1463*	Substitution - Nonsense	Kidney
COSM52850	c.1930_1939del10	p.K644fs*9	Deletion - Frameshift	Kidney
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Soft_tissue
COSM52779	c.2335C>T	p.Q779*	Substitution - Nonsense	Kidney
COSM5757627	c.?	p.?	Unknown	Kidney
COSM4002744	c.4335A>G	p.P1445P	Substitution - coding silent	Soft_tissue
COSM1169599	c.4177_4181delATGAG	p.M1393fs*4	Deletion - Frameshift	Kidney
COSM1495589	c.3394G>T	p.E1132*	Substitution - Nonsense	Liver
COSM52819	c.3639delA	p.E1214fs*4	Deletion - Frameshift	Kidney
COSM4185742	c.4357C>T	p.Q1453*	Substitution - Nonsense	Kidney
COSM5887824	c.2314C>T	p.P772S	Substitution - Missense	Upper_aerodigestive_tract
COSM3358573	c.114_120delTTCCAAT	p.S39fs*4	Deletion - Frameshift	Kidney
COSM3993231	c.2669C>A	p.A890E	Substitution - Missense	Kidney
COSM2854066	c.3236C>A	p.P1079H	Substitution - Missense	Large_intestine
COSM52802	c.2634delA	p.E878fs*37	Deletion - Frameshift	Kidney
COSM1169591	c.3039_3039delA	p.E1014fs*19	Deletion - Frameshift	Kidney
COSM1137079	c.237-1G>A	p.?	Unknown	Kidney
COSM52812	c.388_401del14	p.D130fs*1	Deletion - Frameshift	Kidney
COSM1663335	c.2627G>A	p.R876H	Substitution - Missense	Pancreas
COSM5006566	c.?_?del?	p.?fs*?	Deletion - Frameshift	Kidney
COSM423275	c.1953_1954insA	p.S652fs*13	Insertion - Frameshift	Kidney
COSM4410598	c.1168_1169insT	p.Y390fs*2	Insertion - Frameshift	Kidney
COSM4188945	c.2041_2043delAGT	p.S681delS	Deletion - In frame	Kidney
COSM480367	c.2128C>T	p.R710*	Substitution - Nonsense	Large_intestine
COSM308485	c.1583delA	p.N528fs*41	Deletion - Frameshift	Kidney
COSM4002744	c.4335A>G	p.P1445P	Substitution - coding silent	Soft_tissue
COSM52882	c.1999G>T	p.E667*	Substitution - Nonsense	Kidney
COSM423166	c.4529_4536delTCAGTGCG	p.L1510fs*6	Deletion - Frameshift	Kidney
COSM5006566	c.?_?del?	p.?fs*?	Deletion - Frameshift	Kidney
COSM5720045	c.3588C>T	p.F1196F	Substitution - coding silent	Skin
COSM1692828	c.2200A>G	p.N734D	Substitution - Missense	Skin
COSM52832	c.4045delC	p.L1349fs*35	Deletion - Frameshift	Kidney
COSM5049000	c.2114A>G	p.D705G	Substitution - Missense	Oesophagus
COSM1169652	c.2210_2211insG	p.Y738fs*3	Insertion - Frameshift	Kidney
COSM1309355	c.3973G>A	p.D1325N	Substitution - Missense	Urinary_tract
COSM2854093	c.2773A>C	p.K925Q	Substitution - Missense	Large_intestine
COSM3358520	c.2622_2624delAAT	p.K874_I875>N	Complex - deletion inframe	Kidney
COSM1732041	c.1612T>C	p.S538P	Substitution - Missense	Kidney
COSM4325772	c.996-6T>A	p.?	Unknown	Large_intestine
COSM5748999	c.2005G>C	p.V669L	Substitution - Missense	Pancreas
COSM52797	c.162_163delTA	p.Y54fs*1	Deletion - Frameshift	Kidney
COSM4002747	c.3597A>T	p.P1199P	Substitution - coding silent	Soft_tissue
COSM1495589	c.3394G>T	p.E1132*	Substitution - Nonsense	Liver
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Soft_tissue
COSM1047103	c.477C>T	p.D159D	Substitution - coding silent	Endometrium
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Haematopoietic_and_lymphoid_tissue
COSM3365395	c.1568T>G	p.M523R	Substitution - Missense	Kidney
COSM5059865	c.1631A>G	p.D544G	Substitution - Missense	Stomach
COSM52849	c.2965+1delGTAA	p.?	Unknown	Kidney
COSM422748	c.207T>A	p.C69*	Substitution - Nonsense	Kidney
COSM4186192	c.2884G>T	p.D962Y	Substitution - Missense	Kidney
COSM5748999	c.2005G>C	p.V669L	Substitution - Missense	Pancreas
COSM52838	c.3553C>T	p.R1185*	Substitution - Nonsense	Kidney
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Haematopoietic_and_lymphoid_tissue
COSM4584547	c.3335A>G	p.N1112S	Substitution - Missense	Bone
COSM5499481	c.772_773insA	p.N258fs*6	Insertion - Frameshift	Biliary_tract
COSM5642805	c.2240A>G	p.K747R	Substitution - Missense	Autonomic_ganglia
COSM5075572	c.2551G>A	p.A851T	Substitution - Missense	Kidney
COSM4119171	c.348C>T	p.F116F	Substitution - coding silent	Stomach
COSM1169580	c.3859G>A	p.E1287K	Substitution - Missense	Kidney
COSM52806	c.646-5T>G	p.?	Unknown	Kidney
COSM5572890	c.2980T>C	p.Y994H	Substitution - Missense	Prostate
COSM4002744	c.4335A>G	p.P1445P	Substitution - coding silent	Soft_tissue
COSM480429	c.814-1G>A	p.?	Unknown	Kidney
COSM52877	c.1114G>T	p.E372*	Substitution - Nonsense	Kidney
COSM1169653	c.3639_3640insA	p.E1214fs*6	Insertion - Frameshift	Kidney
COSM4929817	c.3740C>T	p.T1247I	Substitution - Missense	Liver
COSM4325778	c.996-7T>A	p.?	Unknown	Large_intestine
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM1732026	c.610A>C	p.I204L	Substitution - Missense	Kidney
COSM4437997	c.527G>C	p.G176A	Substitution - Missense	Oesophagus
COSM4410707	c.435delT	p.R146fs*28	Deletion - Frameshift	Kidney
COSM5032219	c.?	p.R1010*	Substitution - Nonsense	Lung
COSM1753305	c.4530C>T	p.L1510L	Substitution - coding silent	Urinary_tract
COSM4771391	c.4045_4046insC	p.L1349fs*4	Insertion - Frameshift	Kidney
COSM3408802	c.3743A>G	p.E1248G	Substitution - Missense	Central_nervous_system
COSM422796	c.2770G>T	p.E924*	Substitution - Nonsense	Kidney
COSM3365375	c.3143C>T	p.P1048L	Substitution - Missense	Kidney
COSM5692857	c.3789G>C	p.E1263D	Substitution - Missense	Soft_tissue
COSM4119153	c.2999G>A	p.R1000Q	Substitution - Missense	Stomach
COSM1732080	c.2327delT	p.L776fs*2	Deletion - Frameshift	Kidney
COSM1659441	c.438delA	p.T147fs*27	Deletion - Frameshift	Kidney
COSM4766063	c.397G>A	p.E133K	Substitution - Missense	Soft_tissue
COSM5995137	c.4176G>A	p.E1392E	Substitution - coding silent	Prostate
COSM52779	c.2335C>T	p.Q779*	Substitution - Nonsense	Biliary_tract
COSM52807	c.694A>C	p.T232P	Substitution - Missense	Kidney
COSM423083	c.2091_2101del11	p.Y697fs*1	Deletion - Frameshift	Kidney
COSM4169396	c.?	p.P1174fs*?	Unknown	Skin
COSM423101	c.2419delA	p.I807fs*18	Deletion - Frameshift	Kidney
COSM422767	c.1102G>T	p.E368*	Substitution - Nonsense	Kidney
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Soft_tissue
COSM1617876	c.3948_3949insT	p.A1317fs*8	Insertion - Frameshift	Liver
COSM363944	c.1393C>T	p.P465S	Substitution - Missense	Lung
COSM480400	c.1739A>G	p.Y580C	Substitution - Missense	Kidney
COSM4410598	c.1168_1169insT	p.Y390fs*2	Insertion - Frameshift	Kidney
COSM1169583	c.766G>C	p.A256P	Substitution - Missense	Kidney
COSM4410707	c.435delT	p.R146fs*28	Deletion - Frameshift	Kidney
COSM4603746	c.1658delA	p.K553fs*16	Deletion - Frameshift	Upper_aerodigestive_tract
COSM5566660	c.2128C>G	p.R710G	Substitution - Missense	Prostate
COSM4119156	c.2890G>A	p.V964I	Substitution - Missense	Stomach
COSM4991933	c.3002C>A	p.P1001Q	Substitution - Missense	Skin
COSM1261009	c.313G>T	p.E105*	Substitution - Nonsense	Oesophagus
COSM1663335	c.2627G>A	p.R876H	Substitution - Missense	Large_intestine
COSM52869	c.4187_4199del13	p.V1396fs*32	Deletion - Frameshift	Kidney
COSM4002750	c.996-4G>A	p.?	Unknown	Large_intestine
COSM4410598	c.1168_1169insT	p.Y390fs*2	Insertion - Frameshift	Kidney
COSM1659673	c.2088C>G	p.Y696*	Substitution - Nonsense	Kidney
COSM52885	c.2212_2217delTACAAT	p.Y738_N739delYN	Deletion - In frame	Kidney
COSM5609778	c.3649C>T	p.L1217L	Substitution - coding silent	Skin
COSM480356	c.2536G>T	p.E846*	Substitution - Nonsense	Kidney
COSM1732069	c.2646_2647delTG	p.N882fs*18	Deletion - Frameshift	Kidney
COSM1424543	c.2506C>T	p.R836W	Substitution - Missense	Kidney
COSM1732128	c.360delT	p.F120fs*54	Deletion - Frameshift	Kidney
COSM52838	c.3553C>T	p.R1185*	Substitution - Nonsense	Stomach
COSM4149625	c.2874C>G	p.Y958*	Substitution - Nonsense	Kidney
COSM1169596	c.2716A>T	p.R906*	Substitution - Nonsense	Kidney
COSM3358487	c.3839_3844delCTGCTA	p.S1280_K1282>*	Complex - deletion inframe	Kidney
COSM5609766	c.2999G>T	p.R1000L	Substitution - Missense	Skin
COSM5753358	c.?	p.K1282fs*?	Frameshift	Kidney
COSM5753352	c.?	p.H24fs*?	Frameshift	Kidney
COSM2854039	c.3548G>A	p.W1183*	Substitution - Nonsense	Skin
COSM1717435	c.?	p.E367*	Substitution - Nonsense	Biliary_tract
COSM4950029	c.2185delG	p.V729fs*2	Deletion - Frameshift	Liver
COSM3365416	c.28T>A	p.S10T	Substitution - Missense	Kidney
COSM4002744	c.4335A>G	p.P1445P	Substitution - coding silent	Soft_tissue
COSM4169395	c.?	p.R1173C	Substitution - Missense	Skin
COSM480367	c.2128C>T	p.R710*	Substitution - Nonsense	Biliary_tract
COSM422793	c.2761C>T	p.R921*	Substitution - Nonsense	Kidney
COSM480370	c.2126T>C	p.I709T	Substitution - Missense	Kidney
COSM480453	c.478G>T	p.E160*	Substitution - Nonsense	Kidney
COSM4771389	c.3068_3069insA	p.Y1023fs*1	Insertion - Frameshift	Kidney
COSM480438	c.715-1G>A	p.?	Unknown	Kidney
COSM52823	c.3217delA	p.I1073fs*86	Deletion - Frameshift	Kidney
COSM4152489	c.3875+1G>T	p.?	Unknown	Kidney
COSM5834718	c.4575_4576insA	p.A1526fs*>58	Insertion - Frameshift	Breast
COSM308472	c.2684_2685insT	p.H897fs*4	Insertion - Frameshift	Kidney
COSM423121	c.3454delC	p.H1152fs*7	Deletion - Frameshift	Kidney
COSM423074	c.1577delT	p.L526fs*43	Deletion - Frameshift	Kidney
COSM3824340	c.3040G>C	p.E1014Q	Substitution - Missense	Breast
COSM423065	c.1305delA	p.K436fs*2	Deletion - Frameshift	Kidney
COSM1169567	c.235_235delA	p.R79fs*16	Deletion - Frameshift	Kidney
COSM5433727	c.180T>G	p.Y60*	Substitution - Nonsense	Oesophagus
COSM308463	c.3124-1G>A	p.?	Unknown	Kidney
COSM422775	c.1727G>C	p.R576P	Substitution - Missense	Kidney
COSM1169584	c.4352_4352delG	p.G1451fs*38	Deletion - Frameshift	Kidney
COSM5968376	c.2388G>T	p.E796D	Substitution - Missense	Genital_tract
COSM308451	c.1586_1587insT	p.V530fs*3	Insertion - Frameshift	Kidney
COSM422805	c.3110T>G	p.V1037G	Substitution - Missense	Kidney
COSM422811	c.3388G>T	p.E1130*	Substitution - Nonsense	Kidney
COSM52779	c.2335C>T	p.Q779*	Substitution - Nonsense	Breast
COSM1665684	c.439delA	p.T147fs*27	Deletion - Frameshift	Kidney
COSM422772	c.1443+1G>T	p.?	Unknown	Kidney
COSM423086	c.2203_2212del10	p.A735fs*7	Deletion - Frameshift	Kidney
COSM4152515	c.190C>T	p.Q64*	Substitution - Nonsense	Pancreas
COSM423157	c.4349_4350delAT	p.Y1450fs*58	Deletion - Frameshift	Kidney
COSM1309364	c.2335C>G	p.Q779E	Substitution - Missense	Urinary_tract
COSM5024579	c.2324C>T	p.T775I	Substitution - Missense	Large_intestine
COSM5720045	c.3588C>T	p.F1196F	Substitution - coding silent	Skin
COSM480330	c.3154C>T	p.R1052*	Substitution - Nonsense	Kidney
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Soft_tissue
COSM4881838	c.3841G>T	p.A1281S	Substitution - Missense	Upper_aerodigestive_tract
COSM5757628	c.?	p.?	Unknown	Kidney
COSM3357731	c.364A>T	p.N122Y	Substitution - Missense	Haematopoietic_and_lymphoid_tissue
COSM3358511	c.2929_2930delAT	p.I977fs*4	Deletion - Frameshift	Kidney
COSM480367	c.2128C>T	p.R710*	Substitution - Nonsense	Kidney
COSM422745	c.172C>T	p.R58*	Substitution - Nonsense	Kidney
COSM1169586	c.1248_1248delA	p.K416fs*22	Deletion - Frameshift	Kidney
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM52844	c.1569G>T	p.M523I	Substitution - Missense	Breast
COSM1169566	c.4661_4680del20	p.M1555fs*23	Deletion - Frameshift	Kidney
COSM1665663	c.3188_3189delAT	p.Y1063fs*8	Deletion - Frameshift	Kidney
COSM5753364	c.?	p.E532*	Substitution - Nonsense	Kidney
COSM1665967	c.2965+1G>T	p.?	Unknown	Kidney
COSM4777524	c.1535_1535delG	p.R512fs*7	Deletion - Frameshift	Breast
COSM4002744	c.4335A>G	p.P1445P	Substitution - coding silent	Soft_tissue
COSM3358544	c.1642delG	p.V548fs*21	Deletion - Frameshift	Kidney
COSM480330	c.3154C>T	p.R1052*	Substitution - Nonsense	Kidney
COSM1732139	c.3222delA	p.K1074fs*85	Deletion - Frameshift	Kidney
COSM4394724	c.1514C>T	p.S505F	Substitution - Missense	Skin
COSM4119177	c.182A>C	p.K61T	Substitution - Missense	Stomach
COSM52863	c.835delA	p.I279fs*4	Deletion - Frameshift	Kidney
COSM423127	c.3544delG	p.V1182fs*36	Deletion - Frameshift	Kidney
COSM5753355	c.?	p.F684Y	Substitution - Missense	Kidney
COSM422790	c.2632G>T	p.E878*	Substitution - Nonsense	Kidney
COSM1665964	c.3533+1G>A	p.?	Unknown	Kidney
COSM5572890	c.2980T>C	p.Y994H	Substitution - Missense	Prostate
COSM6006365	c.3862A>G	p.I1288V	Substitution - Missense	Skin
COSM423065	c.1305delA	p.K436fs*2	Deletion - Frameshift	Kidney
COSM1186317	c.1816C>T	p.Q606*	Substitution - Nonsense	Lung
COSM3358561	c.810delC	p.F270fs*13	Deletion - Frameshift	Kidney
COSM52814	c.1822delT	p.Y608fs*34	Deletion - Frameshift	Kidney
COSM52817	c.405_418del14	p.K135fs*11	Deletion - Frameshift	Kidney
COSM423287	c.4448_4449insC	p.T1484fs*25	Insertion - Frameshift	Kidney
COSM480385	c.1853T>A	p.L618H	Substitution - Missense	Kidney
COSM480447	c.528+1G>T	p.?	Unknown	Kidney
COSM1169597	c.599C>A	p.S200*	Substitution - Nonsense	Kidney
COSM52840	c.4520T>A	p.I1507N	Substitution - Missense	Kidney
COSM4747249	c.3149delA	p.N1050fs*109	Deletion - Frameshift	Stomach
COSM4002747	c.3597A>T	p.P1199P	Substitution - coding silent	Soft_tissue
COSM4943285	c.3427C>G	p.P1143A	Substitution - Missense	Breast
COSM4410598	c.1168_1169insT	p.Y390fs*2	Insertion - Frameshift	Kidney
COSM423163	c.4379delC	p.P1460fs*29	Deletion - Frameshift	Kidney
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM446842	c.1758G>A	p.M586I	Substitution - Missense	Breast
COSM5047989	c.1738T>C	p.Y580H	Substitution - Missense	Oesophagus
COSM480459	c.139-2A>G	p.?	Unknown	Kidney
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Biliary_tract
COSM52831	c.1802_1805>TA	p.N601fs*8	Complex - frameshift	Kidney
COSM5490620	c.3785A>G	p.N1262S	Substitution - Missense	Biliary_tract
COSM480317	c.3783C>A	p.Y1261*	Substitution - Nonsense	Kidney
COSM480406	c.1453A>T	p.K485*	Substitution - Nonsense	Kidney
COSM3358547	c.1444-1_1454delGGCAAAGAAGAA	p.?	Unknown	Kidney
COSM5572890	c.2980T>C	p.Y994H	Substitution - Missense	Prostate
COSM3945600	c.824C>T	p.S275L	Substitution - Missense	Lung
COSM5006581	c.?ins?	p.?fs*?	Insertion - Frameshift	Kidney
COSM52799	c.204_205delCT	p.C69fs*1	Deletion - Frameshift	Kidney
COSM423083	c.2091_2101del11	p.Y697fs*1	Deletion - Frameshift	Kidney
COSM5006566	c.?_?del?	p.?fs*?	Deletion - Frameshift	Kidney
COSM480367	c.2128C>T	p.R710*	Substitution - Nonsense	Large_intestine
COSM3358538	c.1824_1825delTA	p.Y608fs*1	Deletion - Frameshift	Kidney
COSM480314	c.3861A>C	p.E1287D	Substitution - Missense	Kidney
COSM1169649	c.3625_3626insA	p.M1209fs*11	Insertion - Frameshift	Kidney
COSM3596180	c.3189T>A	p.Y1063*	Substitution - Nonsense	Skin
COSM4771420	c.290_290delT	p.I97fs*5	Deletion - Frameshift	Kidney
COSM4002747	c.3597A>T	p.P1199P	Substitution - coding silent	Soft_tissue
COSM3824343	c.2656C>G	p.L886V	Substitution - Missense	Breast
COSM4411013	c.2354T>G	p.L785R	Substitution - Missense	Kidney
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM52863	c.835delA	p.I279fs*4	Deletion - Frameshift	Stomach
COSM4119162	c.2156A>G	p.Q719R	Substitution - Missense	Stomach
COSM4002747	c.3597A>T	p.P1199P	Substitution - coding silent	Soft_tissue
COSM1047097	c.824C>A	p.S275*	Substitution - Nonsense	Endometrium
COSM3358472	c.4355_4356insAA	p.Q1453fs*37	Insertion - Frameshift	Kidney
COSM5782382	c.3692-7C>G	p.?	Unknown	Breast
COSM3365372	c.3182C>A	p.S1061*	Substitution - Nonsense	Kidney
COSM4152492	c.2254C>G	p.L752V	Substitution - Missense	Kidney
COSM4002744	c.4335A>G	p.P1445P	Substitution - coding silent	Soft_tissue
COSM3358526	c.2495delA	p.N832fs*23	Deletion - Frameshift	Kidney
COSM1663347	c.755T>C	p.I252T	Substitution - Missense	Kidney
COSM1169634	c.?	p.?	Unknown	Kidney
COSM422802	c.3028C>T	p.R1010*	Substitution - Nonsense	Kidney
COSM3427744	c.2497C>T	p.R833C	Substitution - Missense	Large_intestine
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM52779	c.2335C>T	p.Q779*	Substitution - Nonsense	Kidney
COSM5951575	c.3392_3393insA	p.E1132fs*11	Insertion - Frameshift	Oesophagus
COSM52855	c.483delT	p.D161fs*13	Deletion - Frameshift	Kidney
COSM1162015	c.1167_1168insT	p.Y390fs*2	Insertion - Frameshift	Kidney
COSM4410707	c.435delT	p.R146fs*28	Deletion - Frameshift	Kidney
COSM4002744	c.4335A>G	p.P1445P	Substitution - coding silent	Soft_tissue
COSM3365407	c.884C>A	p.S295*	Substitution - Nonsense	Kidney
COSM422784	c.2354T>C	p.L785P	Substitution - Missense	Kidney
COSM5030939	c.?	p.E742*	Substitution - Nonsense	Kidney
COSM1732154	c.1170T>G	p.Y390*	Substitution - Nonsense	Kidney
COSM4771423	c.4015_4015delC	p.P1339fs*45	Deletion - Frameshift	Kidney
COSM3427747	c.1381C>T	p.R461C	Substitution - Missense	Soft_tissue
COSM4711392	c.1550A>G	p.N517S	Substitution - Missense	Large_intestine
COSM423062	c.1119_1122delAGAA	p.E374fs*29	Deletion - Frameshift	Kidney
COSM1732097	c.3470G>A	p.W1157*	Substitution - Nonsense	Kidney
COSM4002747	c.3597A>T	p.P1199P	Substitution - coding silent	Haematopoietic_and_lymphoid_tissue
COSM52929	c.1924_1925ins383	p.S642fs*5	Insertion - Frameshift	Breast
COSM4488165	c.3358C>T	p.R1120*	Substitution - Nonsense	Skin
COSM1617879	c.2568-2A>C	p.?	Unknown	Liver
COSM3358514	c.2927delA	p.H976fs*38	Deletion - Frameshift	Kidney
COSM52838	c.3553C>T	p.R1185*	Substitution - Nonsense	Kidney
COSM422764	c.892C>T	p.R298*	Substitution - Nonsense	Kidney
COSM3974510	c.2364A>T	p.S788S	Substitution - coding silent	Central_nervous_system
COSM480450	c.508C>T	p.Q170*	Substitution - Nonsense	Kidney
COSM5720045	c.3588C>T	p.F1196F	Substitution - coding silent	Skin
COSM1169634	c.?	p.?	Unknown	Kidney
COSM3358553	c.1009delG	p.V337fs*25	Deletion - Frameshift	Kidney
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Soft_tissue
COSM5753362	c.?	p.?fs*?	Frameshift	Kidney
COSM1309361	c.3394G>A	p.E1132K	Substitution - Missense	Urinary_tract
COSM52803	c.384+3A>T	p.?	Unknown	Kidney
COSM4771387	c.3710C>G	p.S1237*	Substitution - Nonsense	Kidney
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Soft_tissue
COSM1665658	c.3751_3753delGAA	p.E1251delE	Deletion - In frame	Kidney
COSM4766064	c.469G>A	p.A157T	Substitution - Missense	Soft_tissue
COSM1219401	c.3179A>G	p.E1060G	Substitution - Missense	Large_intestine
COSM52785	c.1790C>A	p.A597D	Substitution - Missense	Kidney
COSM423098	c.2376_2391del16	p.H792fs*8	Deletion - Frameshift	Kidney
COSM52781	c.3892C>T	p.Q1298*	Substitution - Nonsense	Kidney
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Soft_tissue
COSM4188466	c.3491T>G	p.V1164G	Substitution - Missense	Kidney
COSM52894	c.253delT	p.Y85fs*10	Deletion - Frameshift	Kidney
COSM4002747	c.3597A>T	p.P1199P	Substitution - coding silent	Soft_tissue
COSM1137064	c.4387C>T	p.Q1463*	Substitution - Nonsense	Kidney
COSM1725124	c.3530G>T	p.G1177V	Substitution - Missense	Liver
COSM52870	c.3625_3642del18	p.M1209_E1214delMFYKKE	Deletion - In frame	Kidney
COSM1732119	c.184G>T	p.D62Y	Substitution - Missense	Kidney
COSM1169571	c.4566_4576del11	p.Q1522fs*59	Deletion - Frameshift	Kidney
COSM307747	c.4123G>T	p.E1375*	Substitution - Nonsense	Kidney
COSM4119144	c.3388-2A>C	p.?	Unknown	Stomach
COSM3392504	c.403A>G	p.K135E	Substitution - Missense	Pancreas
COSM1663344	c.842A>T	p.Y281F	Substitution - Missense	Kidney
COSM1665666	c.3054_3056delTAA	p.F1018_K1019>L	Complex - deletion inframe	Kidney
COSM2854238	c.196A>G	p.R66G	Substitution - Missense	Large_intestine
COSM4002747	c.3597A>T	p.P1199P	Substitution - coding silent	Soft_tissue
COSM52834	c.941C>A	p.S314*	Substitution - Nonsense	Kidney
COSM4612157	c.4472delC	p.P1491fs*14	Deletion - Frameshift	Large_intestine
COSM423039	c.215_219delTCATT	p.F72fs*1	Deletion - Frameshift	Kidney
COSM4711395	c.1248_1249insA	p.Y417fs*3	Insertion - Frameshift	Large_intestine
COSM3974504	c.4080C>T	p.P1360P	Substitution - coding silent	Central_nervous_system
COSM3596168	c.4570C>T	p.L1524L	Substitution - coding silent	Skin
COSM3824337	c.3111C>T	p.V1037V	Substitution - coding silent	Breast
COSM480379	c.1906T>C	p.S636P	Substitution - Missense	Kidney
COSM328125	c.1479C>T	p.I493I	Substitution - coding silent	Pancreas
COSM4411268	c.3920delA	p.K1307fs*6	Deletion - Frameshift	Kidney
COSM480426	c.898A>G	p.R300G	Substitution - Missense	Kidney
COSM4771425	c.2155C>T	p.Q719*	Substitution - Nonsense	Kidney
COSM52854	c.363_364delCA	p.N121fs*7	Deletion - Frameshift	Kidney
COSM52820	c.4589delA	p.D1530fs*17	Deletion - Frameshift	Kidney
COSM52789	c.4087-3C>G	p.?	Unknown	Kidney
COSM423080	c.2068delA	p.R690fs*9	Deletion - Frameshift	Kidney
COSM4002747	c.3597A>T	p.P1199P	Substitution - coding silent	Soft_tissue
COSM422802	c.3028C>T	p.R1010*	Substitution - Nonsense	Kidney
COSM4646096	c.1577T>A	p.L526*	Substitution - Nonsense	Large_intestine
COSM5047700	c.3328G>T	p.E1110*	Substitution - Nonsense	Oesophagus
COSM5609775	c.3957A>G	p.L1319L	Substitution - coding silent	Skin
COSM4605535	c.519G>A	p.V173V	Substitution - coding silent	Upper_aerodigestive_tract
COSM5748999	c.2005G>C	p.V669L	Substitution - Missense	Pancreas
COSM480347	c.2578G>A	p.E860K	Substitution - Missense	Kidney
COSM480367	c.2128C>T	p.R710*	Substitution - Nonsense	Large_intestine
COSM423089	c.2214_2222delCAATGAGCC	p.Y738_P741>*	Complex - deletion inframe	Kidney
COSM1186320	c.1744G>A	p.G582S	Substitution - Missense	Lung
COSM4711401	c.835_836insAA	p.I279fs*5	Insertion - Frameshift	Large_intestine
COSM52788	c.1273A>T	p.K425*	Substitution - Nonsense	Kidney
COSM3596165	c.4693T>A	p.L1565M	Substitution - Missense	Skin
COSM480438	c.715-1G>A	p.?	Unknown	Oesophagus
COSM1424529	c.4590C>T	p.D1530D	Substitution - coding silent	Large_intestine
COSM5782382	c.3692-7C>G	p.?	Unknown	Breast
COSM423272	c.1713_1714insTT	p.E572fs*16	Insertion - Frameshift	Kidney
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM5355608	c.3645A>G	p.V1215V	Substitution - coding silent	Large_intestine
COSM5006581	c.?ins?	p.?fs*?	Insertion - Frameshift	Kidney
COSM52893	c.2616_2617insT	p.I873fs*2	Insertion - Frameshift	Kidney
COSM4188505	c.102_103delAA	p.R35fs*17	Deletion - Frameshift	Kidney
COSM52845	c.1620A>C	p.R540S	Substitution - Missense	Kidney
COSM480367	c.2128C>T	p.R710*	Substitution - Nonsense	Large_intestine
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM4766065	c.4066_4067ins?	p.M1356fs	Insertion - Frameshift	Soft_tissue
COSM423284	c.3881_3882insC	p.I1295fs*21	Insertion - Frameshift	Kidney
COSM480359	c.2363C>A	p.S788*	Substitution - Nonsense	Kidney
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Soft_tissue
COSM52784	c.1818+1G>A	p.?	Unknown	Kidney
COSM423147	c.3898_3900delGAG	p.E1300delE	Deletion - In frame	Kidney
COSM423110	c.2864delA	p.N955fs*59	Deletion - Frameshift	Large_intestine
COSM1169595	c.3052_3054delTTT	p.F1018del	Deletion - In frame	Kidney
COSM3993234	c.1542-1G>A	p.?	Unknown	Kidney
COSM4002744	c.4335A>G	p.P1445P	Substitution - coding silent	Soft_tissue
COSM4991939	c.1653C>T	p.S551S	Substitution - coding silent	Skin
COSM383345	c.1376C>G	p.A459G	Substitution - Missense	Lung
COSM4169396	c.?	p.P1174fs*?	Unknown	Skin
COSM1732172	c.3091delA	p.I1031fs*2	Deletion - Frameshift	Kidney
COSM3596198	c.1082T>A	p.L361*	Substitution - Nonsense	Skin
COSM4152486	c.4120A>T	p.K1374*	Substitution - Nonsense	Kidney
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Bone
COSM5631941	c.4289-1G>A	p.?	Unknown	Oesophagus
COSM3358570	c.324delT	p.D108fs*5	Deletion - Frameshift	Kidney
COSM4381519	c.3838T>C	p.S1280P	Substitution - Missense	Large_intestine
COSM4189111	c.377_384+1delATTATAAGG	p.?	Unknown	Kidney
COSM52905	c.3199delA	p.T1067fs*92	Deletion - Frameshift	Kidney
COSM52891	c.2662_2663insA	p.S888fs*13	Insertion - Frameshift	Kidney
COSM422781	c.1962C>G	p.Y654*	Substitution - Nonsense	Kidney
COSM1424540	c.2973delA	p.K991fs*23	Deletion - Frameshift	Kidney
COSM4771393	c.?	p.K414*	Substitution - Nonsense	Kidney
COSM4404941	c.2886T>C	p.D962D	Substitution - coding silent	Skin
COSM4002744	c.4335A>G	p.P1445P	Substitution - coding silent	Soft_tissue
COSM423160	c.4377_4378delTC	p.P1460fs*48	Deletion - Frameshift	Kidney
COSM52803	c.384+3A>T	p.?	Unknown	Kidney
COSM3596183	c.3185G>A	p.R1062Q	Substitution - Missense	Central_nervous_system
COSM1732016	c.2466delT	p.F822fs*3	Deletion - Frameshift	Kidney
COSM1169634	c.?	p.?	Unknown	Kidney
COSM399954	c.3347C>G	p.S1116*	Substitution - Nonsense	Lung
COSM52794	c.1455delA	p.E486fs*14	Deletion - Frameshift	Kidney
COSM52868	c.2126_2127insA	p.R710fs*13	Insertion - Frameshift	Stomach
COSM422799	c.2779+1G>A	p.?	Unknown	Kidney
COSM423113	c.2944_2951delAGACTGTG	p.R982fs*6	Deletion - Frameshift	Kidney
COSM480353	c.2548C>T	p.R850*	Substitution - Nonsense	Oesophagus
COSM1169570	c.3335_3335delA	p.N1112fs*47	Deletion - Frameshift	Kidney
COSM4771400	c.3640_3641delGA	p.E1214fs*5	Deletion - Frameshift	Kidney
COSM5003431	c.1891G>A	p.D631N	Substitution - Missense	Pancreas
COSM6006959	c.2066C>T	p.S689F	Substitution - Missense	Prostate
COSM4169395	c.?	p.R1173C	Substitution - Missense	Skin
COSM1732159	c.773A>T	p.N258I	Substitution - Missense	Kidney
COSM4002744	c.4335A>G	p.P1445P	Substitution - coding silent	Soft_tissue
COSM1732193	c.715-1G>C	p.?	Unknown	Kidney
COSM731062	c.1782C>T	p.F594F	Substitution - coding silent	Lung
COSM5346290	c.3387+1G>T	p.?	Unknown	Urinary_tract
COSM52813	c.1925-3delTAGGTAGGAAGAGTGGCATTTCTCCTAAAAAATCAAAA	p.?	Unknown	Kidney
COSM480341	c.2627G>T	p.R876L	Substitution - Missense	Kidney
COSM423110	c.2864delA	p.N955fs*59	Deletion - Frameshift	Kidney
COSM1732066	c.2639G>A	p.C880Y	Substitution - Missense	Kidney
COSM52833	c.715-2A>G	p.?	Unknown	Kidney
COSM3358523	c.2507_2528del22	p.R836fs*12	Deletion - Frameshift	Kidney
COSM1732182	c.1843G>T	p.E615*	Substitution - Nonsense	Kidney
COSM52840	c.4520T>A	p.I1507N	Substitution - Missense	Kidney
COSM4411130	c.4232G>TT	p.R1411fs*11	Complex - frameshift	Kidney
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM480388	c.1840C>G	p.L614V	Substitution - Missense	Kidney
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM52856	c.484delG	p.D162fs*12	Deletion - Frameshift	Kidney
COSM52859	c.232_236delCGAAG	p.R78fs*7	Deletion - Frameshift	Kidney
COSM4119165	c.1727G>A	p.R576H	Substitution - Missense	Stomach
COSM1633260	c.1302A>G	p.R434R	Substitution - coding silent	Liver
COSM480435	c.727A>T	p.K243*	Substitution - Nonsense	Kidney
COSM52838	c.3553C>T	p.R1185*	Substitution - Nonsense	Large_intestine
COSM5708833	c.3194C>T	p.A1065V	Substitution - Missense	Haematopoietic_and_lymphoid_tissue
COSM52892	c.1709_1710insT	p.I571fs*2	Insertion - Frameshift	Kidney
COSM52838	c.3553C>T	p.R1185*	Substitution - Nonsense	Large_intestine
COSM480356	c.2536G>T	p.E846*	Substitution - Nonsense	Kidney
COSM52842	c.1318C>T	p.Q440*	Substitution - Nonsense	Kidney
COSM1169585	c.3415_3421delTCCAATG	p.S1139fs*18	Deletion - Frameshift	Kidney
COSM1753308	c.4488G>A	p.R1496R	Substitution - coding silent	Urinary_tract
COSM4920091	c.1414C>T	p.R472*	Substitution - Nonsense	Liver
COSM5016014	c.295delC	p.Q99fs*3	Deletion - Frameshift	Kidney
COSM5095293	c.4702C>T	p.R1568W	Substitution - Missense	Thymus
COSM4771402	c.3698G>T	p.C1233F	Substitution - Missense	Kidney
COSM3358558	c.811_813delAAG	p.K271delK	Deletion - In frame	Kidney
COSM5006566	c.?_?del?	p.?fs*?	Deletion - Frameshift	Kidney
COSM1169594	c.3255_3255delT	p.F1085fs*74	Deletion - Frameshift	Kidney
COSM5985615	c.?	p.D762H	Substitution - Missense	Salivary_gland
COSM3358502	c.3309_3310insG	p.A1104fs*3	Insertion - Frameshift	Kidney
COSM52897	c.836_838>AA	p.I279fs*4	Complex - frameshift	Kidney
COSM4991936	c.2521C>T	p.Q841*	Substitution - Nonsense	Skin
COSM480356	c.2536G>T	p.E846*	Substitution - Nonsense	Kidney
COSM4766066	c.1922_1922delT	p.L641fs*15	Deletion - Frameshift	Soft_tissue
COSM422814	c.3534-1G>T	p.?	Unknown	Kidney
COSM52798	c.169_171delATC	p.I57del	Deletion - In frame	Kidney
COSM422756	c.237-3C>A	p.?	Unknown	Kidney
COSM423141	c.3869_3875+9del16	p.?	Unknown	Kidney
COSM1047106	c.224C>T	p.A75V	Substitution - Missense	Endometrium
COSM52823	c.3217delA	p.I1073fs*86	Deletion - Frameshift	Kidney
COSM4778489	c.3823A>T	p.K1275*	Substitution - Nonsense	Liver
COSM1169650	c.3620_3621insA	p.M1209fs*11	Insertion - Frameshift	Kidney
COSM480417	c.1302-1G>T	p.?	Unknown	Kidney
COSM52863	c.835delA	p.I279fs*4	Deletion - Frameshift	Kidney
COSM423077	c.2031_2036delTCGCCG	p.R678_R679delRR	Deletion - In frame	Kidney
COSM1753308	c.4488G>A	p.R1496R	Substitution - coding silent	Urinary_tract
COSM5019205	c.996-4delG	p.?	Unknown	Soft_tissue
COSM3596195	c.1134C>T	p.S378S	Substitution - coding silent	Skin
COSM52907	c.3712_3733del22	p.F1238fs*24	Deletion - Frameshift	Kidney
COSM52778	c.4499C>G	p.S1500*	Substitution - Nonsense	Kidney
COSM480330	c.3154C>T	p.R1052*	Substitution - Nonsense	Central_nervous_system
COSM3596174	c.3808A>C	p.K1270Q	Substitution - Missense	Skin
COSM3775237	c.3784A>G	p.N1262D	Substitution - Missense	Urinary_tract
COSM5611347	c.4703_4704GG>AA	p.R1568Q	Substitution - Missense	Skin
COSM52781	c.3892C>T	p.Q1298*	Substitution - Nonsense	Kidney
COSM1169598	c.1587_1587delT	p.V530fs*39	Deletion - Frameshift	Kidney
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM5887821	c.2315C>T	p.P772L	Substitution - Missense	Upper_aerodigestive_tract
COSM480364	c.2153A>G	p.Y718C	Substitution - Missense	Kidney
COSM1665681	c.625delC	p.Q209fs*15	Deletion - Frameshift	Kidney
COSM4119156	c.2890G>A	p.V964I	Substitution - Missense	Skin
COSM423050	c.529-16_532del20	p.?	Unknown	Kidney
COSM423104	c.2618_2625delTTAAAATT	p.I873fs*2	Deletion - Frameshift	Kidney
COSM5753360	c.?	p.H573fs*?	Frameshift	Kidney
COSM52844	c.1569G>T	p.M523I	Substitution - Missense	Kidney
COSM5020550	c.2932G>A	p.V978I	Substitution - Missense	Soft_tissue
COSM1291746	c.1337A>G	p.D446G	Substitution - Missense	Haematopoietic_and_lymphoid_tissue
COSM2854153	c.1600C>T	p.R534*	Substitution - Nonsense	Pancreas
COSM4186420	c.1998T>G	p.Y666*	Substitution - Nonsense	Kidney
COSM5753353	c.?	p.S987*	Substitution - Nonsense	Kidney
COSM4949725	c.3327_3348del22	p.D1109fs*43	Deletion - Frameshift	Liver
COSM5899948	c.4487G>A	p.R1496Q	Substitution - Missense	Skin
COSM387332	c.1858G>C	p.E620Q	Substitution - Missense	Lung
COSM52842	c.1318C>T	p.Q440*	Substitution - Nonsense	Kidney
COSM3358532	c.2090delA	p.Y697fs*2	Deletion - Frameshift	Kidney
COSM3775234	c.4638G>A	p.L1546L	Substitution - coding silent	Urinary_tract
COSM4410707	c.435delT	p.R146fs*28	Deletion - Frameshift	Kidney
COSM3365393	c.1583A>T	p.N528I	Substitution - Missense	Kidney
COSM5048924	c.1148C>G	p.S383*	Substitution - Nonsense	Oesophagus
COSM5753351	c.?	p.I571V	Substitution - Missense	Kidney
COSM52784	c.1818+1G>A	p.?	Unknown	Kidney
COSM1660128	c.813+1G>A	p.?	Unknown	Kidney
COSM52803	c.384+3A>T	p.?	Unknown	Kidney
COSM52838	c.3553C>T	p.R1185*	Substitution - Nonsense	Kidney
COSM307750	c.3123+1G>A	p.?	Unknown	Skin
COSM480356	c.2536G>T	p.E846*	Substitution - Nonsense	Kidney
COSM4152498	c.1863A>T	p.K621N	Substitution - Missense	Kidney
COSM1732023	c.613A>T	p.S205C	Substitution - Missense	Kidney
COSM423059	c.1034delT	p.T346fs*16	Deletion - Frameshift	Kidney
COSM1169588	c.2224_2235del12	p.E742_I745del	Deletion - In frame	Kidney
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Soft_tissue
COSM1633257	c.1727G>T	p.R576L	Substitution - Missense	Liver
COSM52875	c.1203delG	p.Q402fs*2	Deletion - Frameshift	Kidney
COSM3358517	c.2789delA	p.K930fs*84	Deletion - Frameshift	Kidney
COSM1047085	c.3100A>T	p.K1034*	Substitution - Nonsense	Kidney
COSM3358555	c.994delC	p.R332fs*30	Deletion - Frameshift	Kidney
COSM1732110	c.1060G>T	p.E354*	Substitution - Nonsense	Kidney
COSM5490532	c.1069G>T	p.E357*	Substitution - Nonsense	Biliary_tract
COSM4770177	c.4576+5_4576+6insGAG	p.?	Unknown	Soft_tissue
COSM423153	c.4110delC	p.S1371fs*13	Deletion - Frameshift	Kidney
COSM1169582	c.1750_1752delG	p.(E584)fs*?	Deletion - Frameshift	Kidney
COSM307750	c.3123+1G>A	p.?	Unknown	Kidney
COSM422793	c.2761C>T	p.R921*	Substitution - Nonsense	Endometrium
COSM1744927	c.2111_2114delTGGA	p.M704fs*9	Deletion - Frameshift	Biliary_tract
COSM5753357	c.?	p.H712P	Substitution - Missense	Kidney
COSM1169573	c.4431_4437delTGTCATA	p.V1478fs*9	Deletion - Frameshift	Kidney
COSM422751	c.236G>T	p.R79I	Substitution - Missense	Kidney
COSM1566684	c.2211A>G	p.T737T	Substitution - coding silent	Soft_tissue
COSM1666105	c.4157_4158insAC	p.Y1386fs*1	Insertion - Frameshift	Kidney
COSM3365381	c.2784T>C	p.A928A	Substitution - coding silent	Kidney
COSM4602528	c.3032A>G	p.K1011R	Substitution - Missense	Upper_aerodigestive_tract
COSM480444	c.529-2A>T	p.?	Unknown	Kidney
COSM5753367	c.?	p.V964del	Deletion - In frame	Kidney
COSM1169578	c.2125_2125delA	p.I709fs*5	Deletion - Frameshift	Kidney
COSM1665652	c.4510_4512delCTG	p.L1504delL	Deletion - In frame	Kidney
COSM3940593	c.1864A>G	p.R622G	Substitution - Missense	Oesophagus
COSM422802	c.3028C>T	p.R1010*	Substitution - Nonsense	Kidney
COSM3365410	c.726C>G	p.Y242*	Substitution - Nonsense	Kidney
COSM1732187	c.2351_2354delATCT	p.N784fs*6	Deletion - Frameshift	Kidney
COSM4991945	c.374C>T	p.S125F	Substitution - Missense	Skin
COSM1169633	c.?	p.?	Unknown	Kidney
COSM423269	c.998_999insA	p.N333fs*2	Insertion - Frameshift	Kidney
COSM5829734	c.996-4_996-3delGT	p.?	Unknown	Large_intestine
COSM1745029	c.845_846delTG	p.M282fs*4	Deletion - Frameshift	Urinary_tract

> Text Mining based Variations

[ TOP ]

PMID	Variation	Cancer	Evidence
22233809	mutation	Pancreatic Carcinoma	Notable among the alterations newly identified, genomic deletions, mutations, and rearrangements recurrently targeted genes encoding components of the SWItch/Sucrose NonFermentable (SWI/SNF) chromatin remodeling complex, including all three putative DNA binding subunits (ARID1A, ARID1B, and PBRM1) and both enzymatic subunits (SMARCA2 and SMARCA4).
23222069	mutation	Kidney Carcinoma	The recent sequencings of whole exomes have described frequent mutations in other genes of the SWI/SNF complex: mutations in ARID1A in liver, gastric or bladder carcinomas, and PBRM1 mutations in renal cancers.
24185509	mutation (loss of function)	Cholangiocarcinoma	Through exomic sequencing of 32 intrahepatic cholangiocarcinomas, we discovered frequent inactivating mutations in multiple chromatin-remodeling genes (including BAP1, ARID1A and PBRM1), and mutation in one of these genes occurred in almost half of the carcinomas sequenced.
27556922	mutation	Clear Cell Renal Cell Carcinoma	Recent large-scale next-generation sequencing analyses reveal that PBRM1 is the second most frequently mutated gene harboring many truncated mutations and has a suspected tumor suppressor role in ccRCC.
27407122	mutation	Renal Cell Carcinoma	Considering the genes known to be mutated in RCC at significant frequency, PBRM1 mutations were identified in 7 ERs (54%) versus 1 PRP (7%) (P=.01).
26864202	mutation	Clear Cell Renal Cell Carcinoma	The most frequent SSNVs shared by carcinomatous and sarcomatoid elements were in known ccRCC genes including von Hippel-Lindau tumor suppressor (VHL), polybromo 1 (PBRM1), SET domain containing 2 (SETD2), phosphatase and tensin homolog (PTEN).
26484545	mutation	Clear Cell Renal Cell Carcinoma	Combined analysis of three recent large-scale clear cell renal cell carcinoma (CCRCC) mutation sequencing projects identified a significantly increased mutation frequency of PBRM1 and the X chromosome encoded KDM5C in tumors from male patients and BAP1 in tumors from female patients.
26300218	mutation	Clear Cell Renal Cell Carcinoma	In clear cell renal cell carcinoma BAP1 and PBRM1 are 2 of the most commonly mutated genes (10% to 15% and 40% to 50%, respectively).
26166446	mutation (loss of function)	Clear Cell Renal Cell Carcinoma	These mutations cause loss of function of several genes located in close proximity to VHL and include PBRM1, BAP1 and SETD2.
26003625	mutation	Clear Cell Renal Cell Carcinoma	A mutation in PBRM1 was recently identified in clear cell renal cell carcinoma (ccRCC).
25966424	mutation	Cholangiocarcinoma	A series of highly recurrent mutations in genes such as TP53, KRAS, SMAD4, BRAF, MLL3, ARID1A, PBRM1 and BAP1, which are known to be involved in cell cycle control, cell signalling pathways and chromatin dynamics, have led to investigations of their roles, through molecular to mouse modelling studies, in cholangiocarcinogenesis.
25911086	mutation (loss of function)	Renal Cell Carcinoma	We show for the first time that an inherited mutation in PBRM1 predisposes to RCC.
25873528	mutation	Clear Cell Renal Cell Carcinoma	PBRM1 was found to be mutated in about 40% of ccRCC tumors, whereas BAP1 and SETD2 were each mutated in about 10-15% of ccRCC tumors.
25583177	copy number change; aberrant methylation; mutation	Clear Cell Renal Cell Carcinoma	We also determined chromosome copy-number aberrations, methylation status, and gene mutations in von Hippel-Lindau and PBRM1.
25465300	loss of expression (mutation)	Renal Cell Carcinoma	Consistent with the mutation rate, loss of PBRM1 and BAP1 staining occurred in 43% (80/187) and 10% (18/187) of ccRCC cases, respectively. However, loss of PBRM1 staining occurred in only 3% (2/59), 6% (1/17), and 0% (0/34) of pRCC, chRCC, and RO tumors, respectively (P<0.0001).
25365943	mutation	Clear Cell Renal Cell Carcinoma	In the past decade, our understanding of the genetic mutations associated with sporadic forms of RCC has increased considerably, with the most common mutations in clear cell RCC seen in the VHL, PBRM1, BAP1, and SETD2 genes.
24974848	mutation	Thymic Carcinoma	Notably, we identified recurrent mutations of known cancer genes, including TP53, CYLD, CDKN2A, BAP1 and PBRM1, in thymic carcinomas.
24166983	mutation	Clear Cell Renal Cell Carcinoma	BAP1 (11%), PBRM1 (33%), SETD2 (16%), JARID1c (4%), and KDM6A (3%) mutations were identified.
23832661	mutation	Clear Cell Renal Cell Carcinoma	The four most commonly mutated genes in RCC of clear-cell type (the most common type) are two-hit tumor suppressor genes, and they cluster in a 43-Mb region on chromosome 3p that is deleted in approximately 90% of tumors: VHL (mutated in 80%), PBRM1 (50%), BAP1 (15%), and SETD2 (15%).
23644518	mutation (loss of function)	Clear Cell Renal Cell Carcinoma	Recent sequencing studies of clear cell (conventional) renal cell carcinoma (ccRCC) have identified inactivating point mutations in the chromatin-modifying genes PBRM1, KDM6A/UTX, KDM5C/JARID1C, SETD2, MLL2 and BAP1.
23636849	mutation	Castration-Resistant Prostate Carcinoma	Sixty-two somatic variants altered proteins in tumors, including cancer-associated genes, TMPRSS2-ERG, PBRM1, and TET2.
23620406	mutation	Clear Cell Renal Cell Carcinoma	3p21 tumor suppressors are frequently mutated in both the MSKCC (PBRM1, 30.3%; SETD2, 7.4%; BAP1, 6.4%) and the TCGA (PBRM1, 33.5%; SETD2, 11.6%; BAP1, 9.7%) cohorts.
23416164	mutation	Clear Cell Renal Cell Carcinoma	Recently, exome sequencing studies have revealed that the SWI/SNF (switch/sucrose nonfermentable) members PBRM1 and ARID1A are mutated in ccRCC, and it has also been suggested that aberrant chromatin regulation is a key step in kidney cancer pathogenesis.
23036577	mutation	Clear Cell Renal Cell Carcinoma	Recent sequencing efforts have identified several novel frequent mutations of histone modifying and chromatin remodeling genes in ccRCC including PBRM1, SETD2, BAP1, and KDM5C.
22461374	mutation (loss of function)	Clear Cell Renal Cell Carcinoma	We identified inactivating mutations in VHL, PBRM1, and BAP1. Sequencing of PBRM1 in ccRCC-derived cell lines confirmed its frequent inactivation in ccRCC.
22156295	mutation	Pancreatic Carcinoma	We observed a much higher rate of indel mutations in the affected cases and identified recurrent truncating indels in several cancer genes such as VHL, PBRM1, and JARID1C.
15735765	mutation	Breast Carcinoma	BAF180 can be mutated and has tumor suppressing properties in breast cancer.
25496315	loss of expression (mutation)	Rhabdoid Tumor of the Kidney	Complete loss of SMARCB1, SMARCA2 and PBRM1 expression and corresponding mutations in the same genes were observed in all cases.
25636086	mutation	Liver and Intrahepatic Bile Duct Carcinoma	The subsequent validation study on 68 LCBs identified recurrent mutations in TERT promoter, chromatin regulators (BAP1, PBRM1 and ARID2), a synapse organization gene (PCLO), IDH genes and KRAS.
26812616	mutation	Esophageal Squamous Cell Carcinoma	Deep sequencing of components of the SWI/SNF complex using a bench-top next generation sequencer revealed that eight of 92 ESCCs (8.7%) had 11 somatic mutations of 7 genes, ARID1A, ARID2, ATRX, PBRM1, SMARCA4, SMARCAL1, and SMARCC1.
27664394	mutation	Renal Cell Carcinoma	In the future, prognosis and treatment of patients with mRCC might be based on genomic classification, especially of the 4 most commonly mutated genes in RCC (VHL, PBRM1, BAP1, and SETD2).
27751729	mutation	Metastatic Renal Cell Cancer	Prevalent mutations (≥ 10%) were VHL (75%), PBRM1 (46%), SETD2 (30%), BAP1 (19%), KDM5C (15%), and PTEN (12%).
28618948	Mutation	Clear Cell Renal Cell Carcinoma	While in clear cell renal cell carcinoma, BAP1 mutation was mutually exclusive with PBRM1 mutations, and BAP1-mutant clear cell renal cell carcinomas also showed significantly worse prognosis than PBRM1-mutant clear cell renal cell carcinomas ( p=0.001).
28419186	Mutation	Blastic Plasmacytoid Dendritic Cell Neoplasm	We report a rare case of CD4- cutaneous blastic plasmacytoid dendritic cell neoplasm (BPDCN) with a novel PBRM1 mutation. PBRM1 mutation seems to be a driver event in this case.
28394406	Mutation; Loss of Expression	Cholangiocarcinoma	The aim of this study was to determine the timing of PBRM1 mutations in biliary carcinogenesis. We found that PBRM1 loss occurred in approximately 26% of invasive cancers, but PBRM1 expression was retained in all biliary intra-epithelial neoplasia (BilIN) specimens, including 25 intrahepatic BilINs and 19 gallbladder BilINs.
28092369	Mutation	Clear Cell Renal Cell Carcinoma	We report here that BAF180 is mutated in H1H2 ccRCC cell lines and tumors, and BAF180 re-expression in H1H2 ccRCC cell lines reduced cell proliferation/survival, indicating that BAF180 has tumor-suppressive role in these cells.
27890923	Mutation	Renal Cell Carcinoma	In addition, the advent of next-generation sequencing has led to the identification of several novel genes that are mutated in renal cancer, such as PBRM1, BAP1 and SETD2, which are all involved in histone modification and nucleosome and chromatin remodelling.
27751729	Mutation	Clear Cell Renal Cell Carcinoma	PBRM1, BAP1, and KDM5C mutations impact outcomes of targeted therapies in metastatic ccRCC patients.

Summary
Symbol	PBRM1
Name	polybromo 1
Aliases	BAF180; PB1; BRG1-associated factor 180; polybromo-1D; hPB1; Protein polybromo-1
Location	3p21.1
External Links	HGNC, NCBI, Ensembl, Uniprot, GeneCards
Cancer Gene Databases	ONGene (Oncogene) , TSGene (Tumor suppressor gene) , NCG (Network of Cancer Genes)
Content	> Post-translational modification (PTM)

> Post-translational modification (PTM)

[ TOP ]

Filter By:

Uniprot ID	Position	Amino Acid	Description	Upstream Enzyme	Affected By Mutation	Amino Acid Sequence Variant
Q86U86	39	S	Phosphoserine	-	No	None detected
Q86U86	131	S	Phosphoserine	-	No	None detected
Q86U86	134	Y	Phosphotyrosine	-	Yes	p.Y134fs (cancer: KIRC)
Q86U86	178	S	Phosphoserine	-	No	None detected
Q86U86	316	S	Phosphoserine	-	No	None detected
Q86U86	319	S	Phosphoserine	-	No	None detected
Q86U86	353	S	Phosphoserine	-	No	None detected
Q86U86	355	S	Phosphoserine	-	No	None detected
Q86U86	371	S	Phosphoserine	-	Yes	p.S371* (cancer: KIRC)
Q86U86	375	S	Phosphoserine	-	No	None detected
Q86U86	414	K	N6-acetyllysine	-	No	None detected
Q86U86	498	S	Phosphoserine	-	Yes	p.S498fs (cancer: KIRP)
Q86U86	509	S	Phosphoserine	-	No	None detected
Q86U86	636	S	Phosphoserine	-	No	None detected
Q86U86	648	S	Phosphoserine	-	No	None detected
Q86U86	689	S	Phosphoserine	-	No	None detected
Q86U86	948	S	Phosphoserine	-	No	None detected
Q86U86	987	S	Phosphoserine	-	No	None detected
Q86U86	1119	S	Phosphoserine	-	No	None detected
Q86U86	1289	Y	Phosphotyrosine	-	No	None detected
Q86U86	1405	S	Phosphoserine	-	No	None detected
Q86U86	1453	S	Phosphoserine	-	No	None detected

Summary
Symbol	PBRM1
Name	polybromo 1
Aliases	BAF180; PB1; BRG1-associated factor 180; polybromo-1D; hPB1; Protein polybromo-1
Location	3p21.1
External Links	HGNC, NCBI, Ensembl, Uniprot, GeneCards
Cancer Gene Databases	ONGene (Oncogene) , TSGene (Tumor suppressor gene) , NCG (Network of Cancer Genes)
Content	> Expression analysis in primary tumor tissue from TCGA > Expression level in cancer cell line from CCLE > Expression level in human normal tissue from HPA > Text mining based expression change

> The Cancer Genome Atlas (TCGA)

[ TOP ]

Differential expression analysis for cancers with more than 10 normal samples

Cancer	Full Name	# N	# T	Median (N)	Median (T)	LogFC	Adj. P	Status
BLCA	Bladder urothelial carcinoma	19	408	6.254	5.895	-0.402	0.0174	NS
BRCA	Breast invasive carcinoma	112	1100	6.663	6.305	-0.374	5.64e-09	NS
CESC	Cervical and endocervical cancers	3	306	6.061	5.767	NA	NA	NA
COAD	Colon adenocarcinoma	41	459	5.953	5.75	-0.318	0.00104	NS
ESCA	Esophageal carcinoma	11	185	6.651	6.186	-0.387	0.0668	NS
GBM	Glioblastoma multiforme	5	166	5.467	5.521	NA	NA	NA
HNSC	Head and Neck squamous cell carcinoma	44	522	6.123	5.408	-0.64	5.49e-10	Under
KIRC	Kidney renal clear cell carcinoma	72	534	5.703	5.213	-0.527	5.09e-12	NS
KIRP	Kidney renal papillary cell carcinoma	32	291	5.416	4.999	-0.369	0.00288	NS
LAML	Acute Myeloid Leukemia	0	173	NA	7.628	NA	NA	NA
LGG	Brain Lower Grade Glioma	0	530	NA	5.877	NA	NA	NA
LIHC	Liver hepatocellular carcinoma	50	373	4.951	4.676	-0.294	0.000863	NS
LUAD	Lung adenocarcinoma	59	517	6.102	5.809	-0.322	1.34e-05	NS
LUSC	Lung squamous cell carcinoma	51	501	6.052	5.546	-0.47	5.97e-11	NS
OV	Ovarian serous cystadenocarcinoma	0	307	NA	5.824	NA	NA	NA
PAAD	Pancreatic adenocarcinoma	4	179	5.894	5.508	NA	NA	NA
PCPG	Pheochromocytoma and Paraganglioma	3	184	5.488	5.137	NA	NA	NA
PRAD	Prostate adenocarcinoma	52	498	6.142	5.995	-0.164	0.0333	NS
READ	Rectum adenocarcinoma	10	167	6.26	5.769	-0.531	0.0175	NS
SARC	Sarcoma	2	263	5.254	5.793	NA	NA	NA
SKCM	Skin Cutaneous Melanoma	1	472	5.905	6.177	NA	NA	NA
STAD	Stomach adenocarcinoma	35	415	6.243	6.328	-0.092	0.434	NS
TGCT	Testicular Germ Cell Tumors	0	156	NA	5.9	NA	NA	NA
THCA	Thyroid carcinoma	59	509	6.279	6.036	-0.224	0.000336	NS
THYM	Thymoma	2	120	6.712	6.117	NA	NA	NA
UCEC	Uterine Corpus Endometrial Carcinoma	35	546	6.12	5.638	-0.539	4.05e-06	NS

> Cancer Cell Line Encyclopedia (CCLE)

[ TOP ]

Tissue	Cell Line	Expression Level (Microarray)
Autonomic ganglia	CHP126	9.2
Autonomic ganglia	CHP212	7.8
Autonomic ganglia	IMR32	8.7
Autonomic ganglia	KELLY	8.8
Autonomic ganglia	KPNRTBM1	9.1
Autonomic ganglia	KPNSI9S	7.3
Autonomic ganglia	KPNYN	8.7
Autonomic ganglia	MHHNB11	7
Autonomic ganglia	NB1	8.7
Autonomic ganglia	NH6	8.1
Autonomic ganglia	SHSY5Y	8.4
Autonomic ganglia	SIMA	8.9
Autonomic ganglia	SKNAS	6.7
Autonomic ganglia	SKNBE2	7.6
Autonomic ganglia	SKNDZ	8.1
Autonomic ganglia	SKNFI	8.4
Autonomic ganglia	SKNSH	7.6
Biliary tract	HUCCT1	7.4
Biliary tract	HUH28	7.5
Biliary tract	SNU1079	5.6
Biliary tract	SNU1196	8
Biliary tract	SNU245	7.1
Biliary tract	SNU308	7.3
Biliary tract	SNU478	7.4
Bone	143B	7.5
Bone	A673	7.7
Bone	CADOES1	8.3
Bone	CAL78	7.7
Bone	G292CLONEA141B1	7.7
Bone	HOS	7.6
Bone	HS706T	7.5
Bone	HS737T	7.4
Bone	HS819T	7.4
Bone	HS821T	8.1
Bone	HS822T	7.3
Bone	HS863T	8.2
Bone	HS870T	7.5
Bone	HS888T	8.4
Bone	MG63	7
Bone	MHHES1	7.1
Bone	OUMS27	7.2
Bone	RDES	7.9
Bone	SJSA1	7.5
Bone	SKES1	8.6
Bone	SKNMC	8.2
Bone	SW1353	7.4
Bone	T173	7.3
Bone	TC71	7
Bone	U2OS	8
Breast	AU565	6.3
Breast	BT20	7.4
Breast	BT474	7.7
Breast	BT483	8
Breast	BT549	7.8
Breast	CAL120	7.5
Breast	CAL148	9
Breast	CAL51	8.7
Breast	CAL851	7
Breast	CAMA1	7.2
Breast	DU4475	7.9
Breast	EFM192A	7.1
Breast	EFM19	7.3
Breast	EVSAT	7.7
Breast	HCC1143	5.8
Breast	HCC1187	8
Breast	HCC1395	7.5
Breast	HCC1419	8.1
Breast	HCC1428	7.3
Breast	HCC1500	7.2
Breast	HCC1569	7.2
Breast	HCC1599	8.2
Breast	HCC1806	6.5
Breast	HCC1937	7.4
Breast	HCC1954	7.5
Breast	HCC202	7
Breast	HCC2157	7
Breast	HCC2218	6.8
Breast	HCC38	7.1
Breast	HCC70	7.4
Breast	HDQP1	7.1
Breast	HMC18	7.2
Breast	HS274T	8.2
Breast	HS281T	8.2
Breast	HS343T	7.9
Breast	HS578T	7.6
Breast	HS606T	7.6
Breast	HS739T	7.4
Breast	HS742T	7.3
Breast	JIMT1	7.5
Breast	KPL1	6.7
Breast	MCF7	6.6
Breast	MDAMB134VI	7.4
Breast	MDAMB157	7.1
Breast	MDAMB175VII	7.2
Breast	MDAMB231	8
Breast	MDAMB361	7.4
Breast	MDAMB415	6.5
Breast	MDAMB436	6.9
Breast	MDAMB453	8
Breast	MDAMB468	7
Breast	SKBR3	6.1
Breast	T47D	6.9
Breast	UACC812	7.6
Breast	UACC893	7.1
Breast	YMB1	7.1
Breast	ZR751	7.1
Breast	ZR7530	7.8
Central nervous system	1321N1	7.6
Central nervous system	42MGBA	8.2
Central nervous system	8MGBA	7.6
Central nervous system	A172	7.5
Central nervous system	AM38	7.3
Central nervous system	BECKER	7.4
Central nervous system	CAS1	7.6
Central nervous system	CCFSTTG1	7
Central nervous system	D283MED	8.8
Central nervous system	D341MED	7.8
Central nervous system	DAOY	7.8
Central nervous system	DBTRG05MG	7.1
Central nervous system	DKMG	8.1
Central nervous system	GAMG	7.9
Central nervous system	GB1	9.1
Central nervous system	GI1	7.7
Central nervous system	GMS10	8.1
Central nervous system	GOS3	7.6
Central nervous system	H4	6.8
Central nervous system	HS683	7.5
Central nervous system	KALS1	7.6
Central nervous system	KG1C	6.2
Central nervous system	KNS42	7.1
Central nervous system	KNS60	7.3
Central nervous system	KNS81	7.1
Central nervous system	KS1	7.6
Central nervous system	LN18	8
Central nervous system	LN229	7.4
Central nervous system	M059K	7.4
Central nervous system	MOGGCCM	7.4
Central nervous system	MOGGUVW	7.1
Central nervous system	NMCG1	8.1
Central nervous system	ONS76	7
Central nervous system	SF126	7.4
Central nervous system	SF295	7
Central nervous system	SNB19	7.7
Central nervous system	SNU1105	8.1
Central nervous system	SNU201	7.4
Central nervous system	SNU466	7.7
Central nervous system	SNU489	7.6
Central nervous system	SNU626	7.2
Central nervous system	SNU738	7.4
Central nervous system	SW1088	7.2
Central nervous system	SW1783	7.4
Central nervous system	T98G	7.5
Central nervous system	TM31	8.4
Central nervous system	U118MG	8.4
Central nervous system	U138MG	8
Central nervous system	U251MG	7.1
Central nervous system	U87MG	7.2
Central nervous system	YH13	7.9
Central nervous system	YKG1	8.1
Endometrium	AN3CA	7.7
Endometrium	COLO684	8.1
Endometrium	EFE184	6.6
Endometrium	EN	6.5
Endometrium	ESS1	6.8
Endometrium	HEC108	7.3
Endometrium	HEC151	7.1
Endometrium	HEC1A	7.7
Endometrium	HEC1B	7
Endometrium	HEC251	7
Endometrium	HEC265	7.4
Endometrium	HEC50B	6.9
Endometrium	HEC59	7.6
Endometrium	HEC6	7.2
Endometrium	ISHIKAWAHERAKLIO02ER	8.3
Endometrium	JHUEM1	7.9
Endometrium	JHUEM2	8.1
Endometrium	JHUEM3	7.6
Endometrium	KLE	6.2
Endometrium	MFE280	7.1
Endometrium	MFE296	7.3
Endometrium	MFE319	6.6
Endometrium	RL952	7
Endometrium	SNGM	7.1
Endometrium	SNU1077	6.7
Endometrium	SNU685	7.1
Endometrium	TEN	7.7
Haematopoietic and lymphoid	697	9.2
Haematopoietic and lymphoid	A3KAW	7.8
Haematopoietic and lymphoid	A4FUK	7.8
Haematopoietic and lymphoid	ALLSIL	9.4
Haematopoietic and lymphoid	AML193	7.3
Haematopoietic and lymphoid	AMO1	8.5
Haematopoietic and lymphoid	BCP1	8.1
Haematopoietic and lymphoid	BDCM	7.6
Haematopoietic and lymphoid	BL41	8.5
Haematopoietic and lymphoid	BL70	8.5
Haematopoietic and lymphoid	BV173	8
Haematopoietic and lymphoid	CA46	7.7
Haematopoietic and lymphoid	CI1	8
Haematopoietic and lymphoid	CMK115	8.4
Haematopoietic and lymphoid	CMK86	8.8
Haematopoietic and lymphoid	CMK	8.2
Haematopoietic and lymphoid	CMLT1	9.1
Haematopoietic and lymphoid	COLO775	7.9
Haematopoietic and lymphoid	DAUDI	8.2
Haematopoietic and lymphoid	DB	7.7
Haematopoietic and lymphoid	DEL	7.8
Haematopoietic and lymphoid	DND41	8.8
Haematopoietic and lymphoid	DOHH2	8.7
Haematopoietic and lymphoid	EB1	7.7
Haematopoietic and lymphoid	EB2	8
Haematopoietic and lymphoid	EHEB	7.8
Haematopoietic and lymphoid	EJM	8.4
Haematopoietic and lymphoid	EM2	8.7
Haematopoietic and lymphoid	EOL1	8.8
Haematopoietic and lymphoid	F36P	7.8
Haematopoietic and lymphoid	GA10	8.4
Haematopoietic and lymphoid	GDM1	8.4
Haematopoietic and lymphoid	GRANTA519	7.7
Haematopoietic and lymphoid	HDLM2	8.8
Haematopoietic and lymphoid	HDMYZ	7.7
Haematopoietic and lymphoid	HEL9217	7.9
Haematopoietic and lymphoid	HEL	8.2
Haematopoietic and lymphoid	HH	8.6
Haematopoietic and lymphoid	HL60	7.9
Haematopoietic and lymphoid	HPBALL	7.8
Haematopoietic and lymphoid	HS604T	7.6
Haematopoietic and lymphoid	HS611T	7.7
Haematopoietic and lymphoid	HS616T	7.3
Haematopoietic and lymphoid	HS751T	8.1
Haematopoietic and lymphoid	HT	8.3
Haematopoietic and lymphoid	HTK	7.4
Haematopoietic and lymphoid	HUNS1	7.9
Haematopoietic and lymphoid	HUT102	7.8
Haematopoietic and lymphoid	HUT78	8.2
Haematopoietic and lymphoid	JEKO1	8.4
Haematopoietic and lymphoid	JK1	8
Haematopoietic and lymphoid	JM1	8.7
Haematopoietic and lymphoid	JURKAT	9.1
Haematopoietic and lymphoid	JURLMK1	8.4
Haematopoietic and lymphoid	JVM2	7.7
Haematopoietic and lymphoid	JVM3	8.4
Haematopoietic and lymphoid	K562	6.9
Haematopoietic and lymphoid	KARPAS299	7.6
Haematopoietic and lymphoid	KARPAS422	8.1
Haematopoietic and lymphoid	KARPAS620	8.5
Haematopoietic and lymphoid	KASUMI1	8.4
Haematopoietic and lymphoid	KASUMI2	9
Haematopoietic and lymphoid	KASUMI6	8.2
Haematopoietic and lymphoid	KCL22	8.4
Haematopoietic and lymphoid	KE37	9.3
Haematopoietic and lymphoid	KE97	7.6
Haematopoietic and lymphoid	KG1	8
Haematopoietic and lymphoid	KHM1B	7.9
Haematopoietic and lymphoid	KIJK	7.8
Haematopoietic and lymphoid	KMH2	8.4
Haematopoietic and lymphoid	KMM1	7.9
Haematopoietic and lymphoid	KMS11	7.2
Haematopoietic and lymphoid	KMS12BM	8.3
Haematopoietic and lymphoid	KMS18	8.1
Haematopoietic and lymphoid	KMS20	8.2
Haematopoietic and lymphoid	KMS21BM	8
Haematopoietic and lymphoid	KMS26	7.6
Haematopoietic and lymphoid	KMS27	7.7
Haematopoietic and lymphoid	KMS28BM	7.2
Haematopoietic and lymphoid	KMS34	8
Haematopoietic and lymphoid	KO52	8.1
Haematopoietic and lymphoid	KOPN8	8.4
Haematopoietic and lymphoid	KU812	8.3
Haematopoietic and lymphoid	KYO1	7.8
Haematopoietic and lymphoid	L1236	7.5
Haematopoietic and lymphoid	L363	9.1
Haematopoietic and lymphoid	L428	8.3
Haematopoietic and lymphoid	L540	8.2
Haematopoietic and lymphoid	LAMA84	8.6
Haematopoietic and lymphoid	LOUCY	8.4
Haematopoietic and lymphoid	LP1	8
Haematopoietic and lymphoid	M07E	8.8
Haematopoietic and lymphoid	MC116	8.3
Haematopoietic and lymphoid	ME1	7.7
Haematopoietic and lymphoid	MEC1	8.6
Haematopoietic and lymphoid	MEC2	8.5
Haematopoietic and lymphoid	MEG01	7.5
Haematopoietic and lymphoid	MHHCALL2	9.4
Haematopoietic and lymphoid	MHHCALL3	9.1
Haematopoietic and lymphoid	MHHCALL4	9.2
Haematopoietic and lymphoid	MINO	8.6
Haematopoietic and lymphoid	MJ	8.3
Haematopoietic and lymphoid	MM1S	8.2
Haematopoietic and lymphoid	MOLM13	8
Haematopoietic and lymphoid	MOLM16	8.3
Haematopoietic and lymphoid	MOLM6	7.9
Haematopoietic and lymphoid	MOLP2	7.5
Haematopoietic and lymphoid	MOLP8	8.6
Haematopoietic and lymphoid	MOLT13	9.4
Haematopoietic and lymphoid	MOLT16	9
Haematopoietic and lymphoid	MOLT4	8.8
Haematopoietic and lymphoid	MONOMAC1	8.1
Haematopoietic and lymphoid	MONOMAC6	8.6
Haematopoietic and lymphoid	MOTN1	8.2
Haematopoietic and lymphoid	MUTZ5	8.8
Haematopoietic and lymphoid	MV411	8.1
Haematopoietic and lymphoid	NALM19	8.8
Haematopoietic and lymphoid	NALM1	9.1
Haematopoietic and lymphoid	NALM6	9
Haematopoietic and lymphoid	NAMALWA	7.3
Haematopoietic and lymphoid	NB4	8.2
Haematopoietic and lymphoid	NCIH929	7.4
Haematopoietic and lymphoid	NCO2	7.9
Haematopoietic and lymphoid	NOMO1	7.9
Haematopoietic and lymphoid	NUDHL1	7
Haematopoietic and lymphoid	NUDUL1	8.9
Haematopoietic and lymphoid	OCIAML2	8.6
Haematopoietic and lymphoid	OCIAML3	8.1
Haematopoietic and lymphoid	OCIAML5	8.4
Haematopoietic and lymphoid	OCILY10	7.8
Haematopoietic and lymphoid	OCILY19	8.6
Haematopoietic and lymphoid	OCILY3	8.3
Haematopoietic and lymphoid	OCIM1	9
Haematopoietic and lymphoid	OPM2	8.5
Haematopoietic and lymphoid	P12ICHIKAWA	9.3
Haematopoietic and lymphoid	P31FUJ	7.5
Haematopoietic and lymphoid	P3HR1	7.9
Haematopoietic and lymphoid	PCM6	7.8
Haematopoietic and lymphoid	PEER	8.3
Haematopoietic and lymphoid	PF382	9.5
Haematopoietic and lymphoid	PFEIFFER	8.1
Haematopoietic and lymphoid	PL21	9
Haematopoietic and lymphoid	RAJI	7.7
Haematopoietic and lymphoid	RCHACV	9.2
Haematopoietic and lymphoid	REC1	8.2
Haematopoietic and lymphoid	REH	7.7
Haematopoietic and lymphoid	RI1	8
Haematopoietic and lymphoid	RL	6.9
Haematopoietic and lymphoid	RPMI8226	7.8
Haematopoietic and lymphoid	RPMI8402	9.4
Haematopoietic and lymphoid	RS411	8.4
Haematopoietic and lymphoid	SEM	8.9
Haematopoietic and lymphoid	SET2	8.2
Haematopoietic and lymphoid	SIGM5	8.9
Haematopoietic and lymphoid	SKM1	7.5
Haematopoietic and lymphoid	SKMM2	8.2
Haematopoietic and lymphoid	SR786	7.9
Haematopoietic and lymphoid	ST486	7.3
Haematopoietic and lymphoid	SUDHL10	7.6
Haematopoietic and lymphoid	SUDHL1	7.7
Haematopoietic and lymphoid	SUDHL4	8
Haematopoietic and lymphoid	SUDHL5	8.9
Haematopoietic and lymphoid	SUDHL6	8.6
Haematopoietic and lymphoid	SUDHL8	8.5
Haematopoietic and lymphoid	SUPB15	8.4
Haematopoietic and lymphoid	SUPHD1	7.9
Haematopoietic and lymphoid	SUPM2	8.2
Haematopoietic and lymphoid	SUPT11	8.9
Haematopoietic and lymphoid	SUPT1	8.3
Haematopoietic and lymphoid	TALL1	9
Haematopoietic and lymphoid	TF1	8
Haematopoietic and lymphoid	THP1	7.4
Haematopoietic and lymphoid	TO175T	7.6
Haematopoietic and lymphoid	TOLEDO	8.2
Haematopoietic and lymphoid	U266B1	7.9
Haematopoietic and lymphoid	U937	7.4
Haematopoietic and lymphoid	UT7	7.6
Haematopoietic and lymphoid	WSUDLCL2	8.1
Kidney	769P	6.5
Kidney	786O	6.8
Kidney	A498	6
Kidney	A704	5.7
Kidney	ACHN	6.4
Kidney	BFTC909	7.5
Kidney	CAKI1	6.4
Kidney	CAKI2	5.7
Kidney	CAL54	7.5
Kidney	KMRC1	5.5
Kidney	KMRC20	6.4
Kidney	KMRC2	5.3
Kidney	KMRC3	5.5
Kidney	OSRC2	6.9
Kidney	RCC10RGB	6.1
Kidney	SNU1272	5.4
Kidney	SNU349	5.6
Kidney	TUHR10TKB	6.6
Kidney	TUHR14TKB	6.3
Kidney	TUHR4TKB	5.6
Kidney	VMRCRCW	6.5
Kidney	VMRCRCZ	6.5
Large intestine	C2BBE1	7.2
Large intestine	CCK81	7.2
Large intestine	CL11	8
Large intestine	CL14	7.5
Large intestine	CL34	7.8
Large intestine	CL40	7.8
Large intestine	COLO205	7.1
Large intestine	COLO320	7.8
Large intestine	COLO678	8.1
Large intestine	CW2	7.1
Large intestine	DLD1	7.9
Large intestine	GP2D	7.7
Large intestine	HCC56	7.2
Large intestine	HCT116	7.5
Large intestine	HCT15	8
Large intestine	HS675T	7.1
Large intestine	HS698T	8
Large intestine	HT115	5.7
Large intestine	HT29	7.3
Large intestine	HT55	7.8
Large intestine	KM12	7.1
Large intestine	LOVO	7.7
Large intestine	LS1034	7.6
Large intestine	LS123	7.5
Large intestine	LS180	7.5
Large intestine	LS411N	8.1
Large intestine	LS513	8
Large intestine	MDST8	7.8
Large intestine	NCIH508	6.8
Large intestine	NCIH716	7.4
Large intestine	NCIH747	6.6
Large intestine	OUMS23	6
Large intestine	RCM1	6.9
Large intestine	RKO	6.8
Large intestine	SKCO1	8.1
Large intestine	SNU1040	7.6
Large intestine	SNU1197	6.5
Large intestine	SNU175	7.4
Large intestine	SNU283	7.6
Large intestine	SNU407	7.1
Large intestine	SNU503	6.9
Large intestine	SNU61	7.3
Large intestine	SNU81	8.8
Large intestine	SNUC1	7.2
Large intestine	SNUC2A	6.6
Large intestine	SNUC4	7.9
Large intestine	SNUC5	7.8
Large intestine	SW1116	6.5
Large intestine	SW1417	6.9
Large intestine	SW1463	7.4
Large intestine	SW403	7.2
Large intestine	SW480	7.3
Large intestine	SW48	7.2
Large intestine	SW620	7.9
Large intestine	SW837	7.2
Large intestine	SW948	7.4
Large intestine	T84	7.4
Liver	ALEXANDERCELLS	7.4
Liver	C3A	6.7
Liver	HEP3B217	7.8
Liver	HEPG2	7
Liver	HLE	8.1
Liver	HLF	7.6
Liver	HUH1	7.4
Liver	HUH6	8.1
Liver	HUH7	7.4
Liver	JHH1	6.6
Liver	JHH2	6.7
Liver	JHH4	7.1
Liver	JHH5	7.3
Liver	JHH6	8
Liver	JHH7	7
Liver	LI7	7.5
Liver	PLCPRF5	7.1
Liver	SKHEP1	7.7
Liver	SNU182	7.1
Liver	SNU387	7.1
Liver	SNU398	7.8
Liver	SNU423	7.6
Liver	SNU449	7
Liver	SNU475	7.3
Liver	SNU761	7
Liver	SNU878	8.1
Liver	SNU886	8.4
Lung	A549	6.7
Lung	ABC1	5.5
Lung	BEN	6.8
Lung	CAL12T	6.9
Lung	CALU1	7.1
Lung	CALU3	7.8
Lung	CALU6	7.4
Lung	CHAGOK1	7.1
Lung	COLO668	8.6
Lung	COLO699	8.1
Lung	CORL105	6.6
Lung	CORL23	6.7
Lung	CORL24	8.2
Lung	CORL279	7.9
Lung	CORL311	8.1
Lung	CORL47	7.7
Lung	CORL51	7.9
Lung	CORL88	8.3
Lung	CORL95	7.7
Lung	CPCN	7.4
Lung	DMS114	7.6
Lung	DMS153	7.4
Lung	DMS273	7.2
Lung	DMS454	6.7
Lung	DMS53	6.2
Lung	DMS79	8.6
Lung	DV90	6.8
Lung	EBC1	7.5
Lung	EPLC272H	6.2
Lung	HARA	7
Lung	HCC1171	7.3
Lung	HCC1195	6.6
Lung	HCC15	6.8
Lung	HCC2279	6.8
Lung	HCC2935	6.8
Lung	HCC33	8.5
Lung	HCC366	7.7
Lung	HCC4006	7.2
Lung	HCC44	7.2
Lung	HCC78	7.1
Lung	HCC827	7.4
Lung	HCC95	6.8
Lung	HLC1	7.6
Lung	HLFA	7.5
Lung	HS229T	8.1
Lung	HS618T	7.4
Lung	IALM	7.4
Lung	KNS62	7
Lung	LC1F	6.9
Lung	LC1SQSF	6.8
Lung	LCLC103H	7.5
Lung	LCLC97TM1	7.9
Lung	LK2	7.5
Lung	LOUNH91	6.6
Lung	LU65	7.3
Lung	LU99	7.4
Lung	LUDLU1	6.9
Lung	LXF289	7.5
Lung	MORCPR	5.7
Lung	NCIH1048	8.8
Lung	NCIH1092	8.9
Lung	NCIH1105	9.3
Lung	NCIH1155	9
Lung	NCIH1184	8.6
Lung	NCIH1299	7.4
Lung	NCIH1339	7.7
Lung	NCIH1341	7.6
Lung	NCIH1355	7.3
Lung	NCIH1373	6.7
Lung	NCIH1385	7
Lung	NCIH1395	6.3
Lung	NCIH1435	7.3
Lung	NCIH1436	8.2
Lung	NCIH1437	6.8
Lung	NCIH146	8.1
Lung	NCIH1563	7.4
Lung	NCIH1568	7.3
Lung	NCIH1573	6.4
Lung	NCIH1581	7.6
Lung	NCIH1618	8.5
Lung	NCIH1623	7.7
Lung	NCIH1648	6.6
Lung	NCIH1650	7.6
Lung	NCIH1651	6.7
Lung	NCIH1666	6.6
Lung	NCIH1693	6.9
Lung	NCIH1694	7.4
Lung	NCIH1703	7.5
Lung	NCIH1734	7.3
Lung	NCIH1755	6.8
Lung	NCIH1781	7.6
Lung	NCIH1792	6.9
Lung	NCIH1793	7
Lung	NCIH1836	8.1
Lung	NCIH1838	7.2
Lung	NCIH1869	8.4
Lung	NCIH1876	8.9
Lung	NCIH1915	7.3
Lung	NCIH1930	7.8
Lung	NCIH1944	7.4
Lung	NCIH1963	8
Lung	NCIH196	7.9
Lung	NCIH1975	7.1
Lung	NCIH2009	7.6
Lung	NCIH2023	7
Lung	NCIH2029	7.6
Lung	NCIH2030	7.4
Lung	NCIH2066	6.6
Lung	NCIH2081	8.3
Lung	NCIH2085	7.2
Lung	NCIH2087	6.7
Lung	NCIH209	7.8
Lung	NCIH2106	8.1
Lung	NCIH2110	7.4
Lung	NCIH211	7.7
Lung	NCIH2122	7.2
Lung	NCIH2126	6.9
Lung	NCIH2141	9
Lung	NCIH2170	7.7
Lung	NCIH2171	7.8
Lung	NCIH2172	7.1
Lung	NCIH2196	5.6
Lung	NCIH2227	7.6
Lung	NCIH2228	6.6
Lung	NCIH226	5.5
Lung	NCIH2286	7.1
Lung	NCIH2291	6.8
Lung	NCIH2342	7
Lung	NCIH2347	7.4
Lung	NCIH23	7.3
Lung	NCIH2405	7
Lung	NCIH2444	5.6
Lung	NCIH292	7.8
Lung	NCIH322	7.4
Lung	NCIH3255	7.3
Lung	NCIH358	7.6
Lung	NCIH441	7.1
Lung	NCIH446	7.4
Lung	NCIH460	7.1
Lung	NCIH510	7.8
Lung	NCIH520	7.1
Lung	NCIH522	7.9
Lung	NCIH524	8.1
Lung	NCIH526	8.7
Lung	NCIH596	7.2
Lung	NCIH647	6.7
Lung	NCIH650	7.8
Lung	NCIH661	7.2
Lung	NCIH69	7.5
Lung	NCIH727	8
Lung	NCIH810	7
Lung	NCIH82	8.2
Lung	NCIH838	7.7
Lung	NCIH841	7.6
Lung	NCIH854	7.3
Lung	NCIH889	8.1
Lung	PC14	7.1
Lung	RERFLCAD1	7
Lung	RERFLCAD2	6.8
Lung	RERFLCAI	8
Lung	RERFLCKJ	6.9
Lung	RERFLCMS	7.2
Lung	RERFLCSQ1	7.1
Lung	SBC5	7.1
Lung	SCLC21H	7.8
Lung	SHP77	8.3
Lung	SKLU1	7.2
Lung	SKMES1	6.4
Lung	SQ1	7.3
Lung	SW1271	7.4
Lung	SW1573	7.8
Lung	SW900	6.9
Lung	VMRCLCD	7
Lung	VMRCLCP	7.2
Oesophagus	COLO680N	6.9
Oesophagus	ECGI10	6.6
Oesophagus	KYSE140	7.6
Oesophagus	KYSE150	7.5
Oesophagus	KYSE180	7.1
Oesophagus	KYSE270	6.7
Oesophagus	KYSE30	6.7
Oesophagus	KYSE410	7.6
Oesophagus	KYSE450	6.9
Oesophagus	KYSE510	7.4
Oesophagus	KYSE520	6.5
Oesophagus	KYSE70	7.7
Oesophagus	OE19	7.1
Oesophagus	OE33	7.3
Oesophagus	TE10	7.1
Oesophagus	TE11	6.9
Oesophagus	TE14	7.4
Oesophagus	TE15	7.1
Oesophagus	TE1	7.1
Oesophagus	TE4	7.9
Oesophagus	TE5	6.8
Oesophagus	TE6	7.1
Oesophagus	TE8	7.4
Oesophagus	TE9	7
Oesophagus	TT	6.7
Ovary	59M	7.2
Ovary	A2780	7.9
Ovary	CAOV3	6.5
Ovary	CAOV4	7
Ovary	COLO704	8.4
Ovary	COV318	6.4
Ovary	COV362	6.7
Ovary	COV434	7.5
Ovary	COV504	6.7
Ovary	COV644	7.5
Ovary	EFO21	5.8
Ovary	EFO27	7
Ovary	ES2	7.4
Ovary	FUOV1	8.5
Ovary	HEYA8	7.4
Ovary	HS571T	7.3
Ovary	IGROV1	7.3
Ovary	JHOC5	7.2
Ovary	JHOM1	7.7
Ovary	JHOM2B	8.6
Ovary	JHOS2	7
Ovary	JHOS4	6.4
Ovary	KURAMOCHI	7.3
Ovary	MCAS	7.4
Ovary	NIHOVCAR3	7.6
Ovary	OAW28	7.3
Ovary	OAW42	6.5
Ovary	OC314	5.9
Ovary	OC316	6
Ovary	ONCODG1	7.7
Ovary	OV56	6.1
Ovary	OV7	7.7
Ovary	OV90	6.9
Ovary	OVCAR4	7.1
Ovary	OVCAR8	7.8
Ovary	OVISE	6.5
Ovary	OVK18	7.6
Ovary	OVKATE	6.3
Ovary	OVMANA	7.1
Ovary	OVSAHO	6.8
Ovary	OVTOKO	6.6
Ovary	RMGI	6.5
Ovary	RMUGS	6.2
Ovary	SKOV3	7.1
Ovary	SNU119	7.8
Ovary	SNU840	7.8
Ovary	SNU8	7.5
Ovary	TOV112D	7.4
Ovary	TOV21G	7
Ovary	TYKNU	7.1
Pancreas	ASPC1	7
Pancreas	BXPC3	6.9
Pancreas	CAPAN1	8
Pancreas	CAPAN2	7.2
Pancreas	CFPAC1	6.7
Pancreas	DANG	6.8
Pancreas	HPAC	7.9
Pancreas	HPAFII	7.3
Pancreas	HS766T	7.1
Pancreas	HUPT3	6.7
Pancreas	HUPT4	7.2
Pancreas	KCIMOH1	7.8
Pancreas	KLM1	7.6
Pancreas	KP2	7.4
Pancreas	KP3	5.7
Pancreas	KP4	7.8
Pancreas	L33	6.9
Pancreas	MIAPACA2	7.2
Pancreas	PANC0203	6.5
Pancreas	PANC0213	7.9
Pancreas	PANC0327	7.5
Pancreas	PANC0403	6.7
Pancreas	PANC0504	7.2
Pancreas	PANC0813	7.3
Pancreas	PANC1005	5.3
Pancreas	PANC1	7.1
Pancreas	PATU8902	5.7
Pancreas	PATU8988S	7.4
Pancreas	PATU8988T	8.1
Pancreas	PK1	6.8
Pancreas	PK45H	7.5
Pancreas	PK59	6.5
Pancreas	PL45	5.8
Pancreas	PSN1	7.7
Pancreas	QGP1	7.2
Pancreas	SNU213	7.6
Pancreas	SNU324	7.8
Pancreas	SNU410	6.5
Pancreas	SU8686	6.6
Pancreas	SUIT2	7.7
Pancreas	SW1990	6.9
Pancreas	T3M4	7.1
Pancreas	TCCPAN2	6.2
Pancreas	YAPC	7.5
Pleura	ACCMESO1	7.4
Pleura	DM3	7.6
Pleura	ISTMES1	6.9
Pleura	ISTMES2	6.3
Pleura	JL1	7.4
Pleura	MPP89	7
Pleura	MSTO211H	6.8
Pleura	NCIH2052	7.1
Pleura	NCIH2452	6.6
Pleura	NCIH28	7.5
Prostate	22RV1	8.1
Prostate	DU145	7.2
Prostate	LNCAPCLONEFGC	8.5
Prostate	MDAPCA2B	7.3
Prostate	NCIH660	8.5
Prostate	PC3	7.7
Prostate	VCAP	8.9
Salivary gland	A253	7.3
Salivary gland	YD15	7.2
Skin	A101D	6.9
Skin	A2058	7.3
Skin	A375	7.5
Skin	C32	7.4
Skin	CHL1	7.6
Skin	CJM	7.2
Skin	COLO679	7.4
Skin	COLO741	7.7
Skin	COLO783	8.1
Skin	COLO792	7.8
Skin	COLO800	7.5
Skin	COLO818	7.5
Skin	COLO829	7.9
Skin	COLO849	7.9
Skin	G361	7.9
Skin	GRM	7.1
Skin	HMCB	8
Skin	HS294T	7.3
Skin	HS600T	7.4
Skin	HS688AT	7.5
Skin	HS695T	6.6
Skin	HS839T	7.4
Skin	HS852T	7.6
Skin	HS895T	7.1
Skin	HS934T	8.2
Skin	HS936T	6.9
Skin	HS939T	7.2
Skin	HS940T	7.3
Skin	HS944T	7.7
Skin	HT144	7.5
Skin	IGR1	8.4
Skin	IGR37	8.9
Skin	IGR39	7.5
Skin	IPC298	7.5
Skin	K029AX	7.6
Skin	LOXIMVI	7.1
Skin	MALME3M	7.7
Skin	MDAMB435S	7.4
Skin	MELHO	8.3
Skin	MELJUSO	7.5
Skin	MEWO	8.4
Skin	RPMI7951	8.2
Skin	RVH421	7.1
Skin	SH4	7.4
Skin	SKMEL1	6.9
Skin	SKMEL24	6.7
Skin	SKMEL28	8.1
Skin	SKMEL2	7.7
Skin	SKMEL30	7.8
Skin	SKMEL31	7.2
Skin	SKMEL3	8.1
Skin	SKMEL5	7.4
Skin	UACC257	7.3
Skin	UACC62	6.8
Skin	WM115	7.5
Skin	WM1799	8.2
Skin	WM2664	7.7
Skin	WM793	7.6
Skin	WM88	7.4
Skin	WM983B	7.6
Small intestine	HUTU80	7.7
Soft tissue	A204	7.5
Soft tissue	G401	7.6
Soft tissue	G402	7.6
Soft tissue	GCT	7.6
Soft tissue	HS729	7.5
Soft tissue	HT1080	7.4
Soft tissue	KYM1	8
Soft tissue	MESSA	6.8
Soft tissue	RD	8.2
Soft tissue	RH30	8
Soft tissue	RH41	8
Soft tissue	RKN	7.4
Soft tissue	S117	7.7
Soft tissue	SJRH30	8.1
Soft tissue	SKLMS1	7.4
Soft tissue	SKUT1	7.7
Soft tissue	TE125T	7.7
Soft tissue	TE159T	7.3
Soft tissue	TE441T	8.4
Soft tissue	TE617T	7.3
Stomach	2313287	7.8
Stomach	AGS	8.1
Stomach	AZ521	8.1
Stomach	ECC10	8.9
Stomach	ECC12	8.2
Stomach	FU97	7.1
Stomach	GCIY	6.8
Stomach	GSS	8.4
Stomach	GSU	7.4
Stomach	HGC27	7.1
Stomach	HS746T	7.1
Stomach	HUG1N	7.6
Stomach	IM95	7.2
Stomach	KATOIII	7.4
Stomach	KE39	6.9
Stomach	LMSU	7.9
Stomach	MKN1	7.8
Stomach	MKN45	8.6
Stomach	MKN74	6.7
Stomach	MKN7	7.5
Stomach	NCCSTCK140	8
Stomach	NCIN87	6.6
Stomach	NUGC2	6.5
Stomach	NUGC3	6.7
Stomach	NUGC4	5.9
Stomach	OCUM1	7.8
Stomach	RERFGC1B	7.1
Stomach	SH10TC	7.4
Stomach	SNU16	8
Stomach	SNU1	6.9
Stomach	SNU216	7.4
Stomach	SNU520	7.6
Stomach	SNU5	7.2
Stomach	SNU601	8
Stomach	SNU620	7.7
Stomach	SNU668	7.2
Stomach	SNU719	7.3
Stomach	TGBC11TKB	7.7
Thyroid	8305C	7.6
Thyroid	8505C	8.8
Thyroid	BCPAP	7.4
Thyroid	BHT101	7.7
Thyroid	CAL62	7.2
Thyroid	CGTHW1	7.5
Thyroid	FTC133	7.5
Thyroid	FTC238	8.1
Thyroid	ML1	6.9
Thyroid	SW579	7.7
Thyroid	TT2609C02	7.9
Thyroid	TT	7.3
Upper aerodigestive tract	BHY	6.6
Upper aerodigestive tract	BICR16	6
Upper aerodigestive tract	BICR18	6.6
Upper aerodigestive tract	BICR22	6.4
Upper aerodigestive tract	BICR31	6.8
Upper aerodigestive tract	BICR56	6.5
Upper aerodigestive tract	BICR6	6.9
Upper aerodigestive tract	CAL27	6.4
Upper aerodigestive tract	CAL33	6.6
Upper aerodigestive tract	DETROIT562	7.6
Upper aerodigestive tract	FADU	7.3
Upper aerodigestive tract	HS840T	7.5
Upper aerodigestive tract	HSC2	7
Upper aerodigestive tract	HSC3	7.2
Upper aerodigestive tract	HSC4	7
Upper aerodigestive tract	PECAPJ15	6.8
Upper aerodigestive tract	PECAPJ34CLONEC12	6.9
Upper aerodigestive tract	PECAPJ41CLONED2	6.1
Upper aerodigestive tract	PECAPJ49	6.6
Upper aerodigestive tract	SCC15	7
Upper aerodigestive tract	SCC25	6.7
Upper aerodigestive tract	SCC4	6.8
Upper aerodigestive tract	SCC9	7
Upper aerodigestive tract	SNU1076	7
Upper aerodigestive tract	SNU1214	6.8
Upper aerodigestive tract	SNU46	7.1
Upper aerodigestive tract	SNU899	7
Upper aerodigestive tract	YD10B	6.6
Upper aerodigestive tract	YD38	6.6
Upper aerodigestive tract	YD8	7.3
Urinary tract	5637	7.1
Urinary tract	639V	8.5
Urinary tract	647V	8.1
Urinary tract	BC3C	7
Urinary tract	BFTC905	7
Urinary tract	CAL29	7.3
Urinary tract	HS172T	7.6
Urinary tract	HT1197	7
Urinary tract	HT1376	7.1
Urinary tract	J82	7.5
Urinary tract	JMSU1	8.2
Urinary tract	KMBC2	7.4
Urinary tract	KU1919	7.8
Urinary tract	RT11284	7.2
Urinary tract	RT112	6.8
Urinary tract	RT4	7.9
Urinary tract	SCABER	6.2
Urinary tract	SW1710	7.2
Urinary tract	SW780	6.7
Urinary tract	T24	7.8
Urinary tract	TCCSUP	7.7
Urinary tract	UMUC1	6.9
Urinary tract	UMUC3	7.5
Urinary tract	VMCUB1	7.1

> The Human Protein Atlas (HPA)

[ TOP ]

Tissue	Expression Level (TPM)
Adipose tissue	24
Adrenal gland	17.2
Appendix	29
Bone marrow	15.6
Breast	20.3
Cerebral cortex	19.3
Cervix, uterine	32.6
Colon	18.1
Duodenum	15.9
Endometrium	36.8
Epididymis	19.7
Esophagus	25.1
Fallopian tube	31.4
Gallbladder	26.8
Heart muscle	12.8
Kidney	12.1
Liver	9.4
Lung	26.4
Lymph node	26.4
Ovary	35.9
Pancreas	2.5
Parathyroid gland	27
Placenta	29.8
Prostate	29.1
Rectum	20.8
Salivary gland	5.5
Seminal vesicle	24.3
Skeletal muscle	5
Skin	20.6
Small intestine	16.1
Smooth muscle	37.1
Spleen	26.4
Stomach	15.2
Testis	26.5
Thyroid gland	44.5
Tonsil	21
Urinary bladder	24.8

> Text Mining based Expression

[ TOP ]

PMID	Expression	Cancer	Evidence
26464681	underexpression	Breast Carcinoma	The status of PBRM1 protein in breast cancer tissues is much lower than that in paracarcinoma tissues.
26452128	loss of expression	Clear Cell Renal Cell Carcinoma	Clear cell Renal Cell Carcinoma (ccRCC) is due to loss of von Hippel-Lindau (VHL) gene and at least one out of three chromatin regulating genes BRCA1-associated protein-1 (BAP1), Polybromo-1 (PBRM1) and Set domain-containing 2 (SETD2).
25997916	overexpression	Renal Cell Carcinoma	Overall 25 of 53 patients (47%) had high PBRM1 expression in the tumor.
25978027	underexpression	Bladder Carcinoma	Our results showed that PBRM1 expression was significantly reduced in bladder cancer cells and tissues compared to their normal counterparts.
25465300	loss of expression (mutation)	Renal Cell Carcinoma	Consistent with the mutation rate, loss of PBRM1 and BAP1 staining occurred in 43% (80/187) and 10% (18/187) of ccRCC cases, respectively. However, loss of PBRM1 staining occurred in only 3% (2/59), 6% (1/17), and 0% (0/34) of pRCC, chRCC, and RO tumors, respectively (P<0.0001).
25200863	loss of expression	Epithelioid Sarcoma	Of the 23 ES cases, 19 (82.6%) showed a loss of PBRM1, and 18 (78.3%), a loss of INI1. In most cases (17, 73.9%), loss of INI1 and PBRM1 expression was observed.
24063284	underexpression	Renal Cell Carcinoma	PBRM1 acts as tumor suppressor in RCC, and its downregulation is associated with increased proliferation and aggressive behavior in RCC.
24053427	overexpression	Clear Cell Renal Cell Carcinoma	The protein expression of PBRM1 was associated with tumour stage (P < 0.001), clinical stage (P < 0.001), pN stage (P = 0.035) and tumour size (P = 0.002).
22949125	loss of expression	Clear Cell Renal Cell Carcinoma	We found that a significant number of ccRCC cancer cell lines lack detectable PBRM1 expression.
25496315	loss of expression (mutation)	Rhabdoid Tumor of the Kidney	Complete loss of SMARCB1, SMARCA2 and PBRM1 expression and corresponding mutations in the same genes were observed in all cases.
27764136	loss of expression	Clear Cell Renal Cell Carcinoma	We found that 49/160 (31%), 81/160 (51%), 23/160 (14%), 24/160 (15%), and 61/160 (38%) of ccRCC showed loss of expression of PBRM1, ARID1A, SETD2, BRG1, and BRM, respectively, and that IHC could successfully detect a high prevalence of ITH.
28394406	Mutation; Loss of Expression	Cholangiocarcinoma	The aim of this study was to determine the timing of PBRM1 mutations in biliary carcinogenesis. We found that PBRM1 loss occurred in approximately 26% of invasive cancers, but PBRM1 expression was retained in all biliary intra-epithelial neoplasia (BilIN) specimens, including 25 intrahepatic BilINs and 19 gallbladder BilINs.
28327121	Loss of Expression	Clear Cell Renal Cell Carcinoma	Of the 97 patients evaluated, 20 and 57% showed loss of BAP1 and PBRM1 in their primary tumors, respectively.
27764136	Loss of Expression	Clear Cell Renal Cell Carcinoma	We found that 49/160 (31%), 81/160 (51%), 23/160 (14%), 24/160 (15%), and 61/160 (38%) of ccRCC showed loss of expression of PBRM1, ARID1A, SETD2, BRG1, and BRM, respectively, and that IHC could successfully detect a high prevalence of ITH.

Summary
Symbol	PBRM1
Name	polybromo 1
Aliases	BAF180; PB1; BRG1-associated factor 180; polybromo-1D; hPB1; Protein polybromo-1
Location	3p21.1
External Links	HGNC, NCBI, Ensembl, Uniprot, GeneCards
Cancer Gene Databases	ONGene (Oncogene) , TSGene (Tumor suppressor gene) , NCG (Network of Cancer Genes)
Content	> Somatic copy number alteration in primary tomur tissue

> The Cancer Genome Atlas (TCGA)

[ TOP ]

Correlation between expression and SCNA as well as percentage of patients in different status.

Cancer	Full Name	# Sample	R	P	% Loss	% Neutral	% Gain	Status
BLCA	Bladder urothelial carcinoma	404	0.526	3.88e-30	29.5	46.5	24	Neutral
BRCA	Breast invasive carcinoma	1075	0.365	3.74e-35	31.8	59.9	8.3	Neutral
CESC	Cervical and endocervical cancers	292	0.62	1.91e-32	41.8	48.6	9.6	Loss
COAD	Colon adenocarcinoma	449	0.367	9.54e-16	16.3	75.7	8	Neutral
ESCA	Esophageal carcinoma	183	0.487	2.6e-12	67.2	24.6	8.2	Loss
GBM	Glioblastoma multiforme	147	0.405	3.7e-07	8.8	77.6	13.6	Neutral
HNSC	Head and Neck squamous cell carcinoma	514	0.412	1.86e-22	72.4	25.9	1.8	Loss
KIRC	Kidney renal clear cell carcinoma	525	0.349	1.59e-16	87.8	11	1.1	Loss
KIRP	Kidney renal papillary cell carcinoma	288	0.408	5.37e-13	9.4	65.6	25	Neutral
LAML	Acute Myeloid Leukemia	166	0.361	1.75e-06	3.6	95.8	0.6	Neutral
LGG	Brain Lower Grade Glioma	513	0.32	1.11e-13	9.6	88.3	2.1	Neutral
LIHC	Liver hepatocellular carcinoma	364	0.423	3.3e-17	19	71.2	9.9	Neutral
LUAD	Lung adenocarcinoma	512	0.339	3.02e-15	45.7	47.5	6.8	Loss
LUSC	Lung squamous cell carcinoma	498	0.155	0.000511	86.9	12	1	Loss
OV	Ovarian serous cystadenocarcinoma	300	0.626	4.59e-34	35	46.7	18.3	Loss
PAAD	Pancreatic adenocarcinoma	177	0.52	1.16e-13	26.6	70.6	2.8	Neutral
PCPG	Pheochromocytoma and Paraganglioma	162	0.581	5.31e-16	38.9	59.9	1.2	Loss
PRAD	Prostate adenocarcinoma	491	0.128	0.00465	3.5	89	7.5	Neutral
READ	Rectum adenocarcinoma	164	0.387	3.06e-07	15.2	68.9	15.9	Neutral
SARC	Sarcoma	255	0.497	2.71e-17	25.1	56.9	18	Neutral
SKCM	Skin Cutaneous Melanoma	367	0.368	3.26e-13	19.6	62.4	18	Neutral
STAD	Stomach adenocarcinoma	413	0.405	9.7e-18	34.4	59.3	6.3	Loss
TGCT	Testicular Germ Cell Tumors	150	0.555	1.64e-13	20	60	20	Neutral
THCA	Thyroid carcinoma	497	0.06	0.184	0.6	98.8	0.6	Neutral
THYM	Thymoma	119	0.47	7.08e-08	11.8	88.2	0	Neutral
UCEC	Uterine Corpus Endometrial Carcinoma	537	0.331	3.39e-15	13.2	75.6	11.2	Neutral

Summary
Symbol	PBRM1
Name	polybromo 1
Aliases	BAF180; PB1; BRG1-associated factor 180; polybromo-1D; hPB1; Protein polybromo-1
Location	3p21.1
External Links	HGNC, NCBI, Ensembl, Uniprot, GeneCards
Cancer Gene Databases	ONGene (Oncogene) , TSGene (Tumor suppressor gene) , NCG (Network of Cancer Genes)
Content	> Methylation level in the promoter region of CR

> Methylation level in the promoter region of CR

[ TOP ]

Correlation between expression and methylation as well as differential methylation analysis.

Cancer	Full Name	R	P	# N	# T	Delta beta (T vs N)	P value (T vs N)	Status
BLCA	Bladder urothelial carcinoma	-0.371	2.61e-15	17	408	0.001	0.207	NS/NA
BRCA	Breast invasive carcinoma	-0.329	0	83	785	0.001	2.04e-09	NS/NA
CESC	Cervical and endocervical cancers	-0.476	0	3	306	NA	NA	NS/NA
COAD	Colon adenocarcinoma	-0.391	7.09e-13	19	297	0.004	0.0255	NS/NA
ESCA	Esophageal carcinoma	-0.363	2.51e-07	9	185	NA	NA	NS/NA
GBM	Glioblastoma multiforme	-0.341	0.00572	1	64	NA	NA	NS/NA
HNSC	Head and Neck squamous cell carcinoma	-0.304	6.75e-13	20	522	0.002	6.12e-05	NS/NA
KIRC	Kidney renal clear cell carcinoma	-0.21	9.11e-05	24	319	0.037	3.04e-22	NS/NA
KIRP	Kidney renal papillary cell carcinoma	-0.421	1.74e-14	23	275	0.004	0.427	NS/NA
LAML	Acute Myeloid Leukemia	-0.055	0.476	0	170	NA	NA	NS/NA
LGG	Brain Lower Grade Glioma	-0.202	3.07e-06	0	530	NA	NA	NS/NA
LIHC	Liver hepatocellular carcinoma	-0.218	7.9e-06	41	373	0.012	6.36e-10	NS/NA
LUAD	Lung adenocarcinoma	-0.082	0.0725	21	456	-0.003	0.785	NS/NA
LUSC	Lung squamous cell carcinoma	-0.082	0.113	8	370	NA	NA	NS/NA
OV	Ovarian serous cystadenocarcinoma	-0.8	0.0138	0	9	NA	NA	NS/NA
PAAD	Pancreatic adenocarcinoma	-0.388	7.62e-08	4	179	NA	NA	NS/NA
PCPG	Pheochromocytoma and Paraganglioma	-0.477	3.74e-12	3	184	NA	NA	NS/NA
PRAD	Prostate adenocarcinoma	-0.293	6.89e-12	35	498	0.005	3.24e-07	NS/NA
READ	Rectum adenocarcinoma	-0.213	0.0329	2	99	NA	NA	NS/NA
SARC	Sarcoma	-0.387	1.15e-10	0	263	NA	NA	NS/NA
SKCM	Skin Cutaneous Melanoma	-0.325	6.3e-13	1	471	NA	NA	NS/NA
STAD	Stomach adenocarcinoma	-0.342	1.67e-11	0	372	NA	NA	NS/NA
TGCT	Testicular Germ Cell Tumors	-0.344	1.26e-05	0	156	NA	NA	NS/NA
THCA	Thyroid carcinoma	-0.12	0.00439	50	509	0	0.581	NS/NA
THYM	Thymoma	-0.289	0.0013	2	120	NA	NA	NS/NA
UCEC	Uterine Corpus Endometrial Carcinoma	-0.151	0.00113	34	431	-0.005	0.807	NS/NA

Summary
Symbol	PBRM1
Name	polybromo 1
Aliases	BAF180; PB1; BRG1-associated factor 180; polybromo-1D; hPB1; Protein polybromo-1
Location	3p21.1
External Links	HGNC, NCBI, Ensembl, Uniprot, GeneCards
Cancer Gene Databases	ONGene (Oncogene) , TSGene (Tumor suppressor gene) , NCG (Network of Cancer Genes)
Content	> Primary tumor tissue from TCGA > Normal tumor tissue from HPA

>The Cancer Genome Atlas (TCGA) [ TOP ]
There is no record.

> The Human Protein Atlas (HPA)

[ TOP ]

Tissue	Level	Level Name
Adrenal gland	2	Medium
Appendix	1	Low
Bone marrow	2	Medium
Breast	1	Low
Bronchus	2	Medium
Caudate	2	Medium
Cerebellum	1	Low
Cerebral cortex	3	High
Cervix, uterine	3	High
Colon	3	High
Duodenum	3	High
Endometrium	3	High
Epididymis	1	Low
Esophagus	1	Low
Fallopian tube	2	Medium
Gallbladder	3	High
Heart muscle	2	Medium
Hippocampus	1	Low
Kidney	1	Low
Liver	0	Not detected
Lung	2	Medium
Lymph node	2	Medium
Nasopharynx	2	Medium
Oral mucosa	1	Low
Ovary	0	Not detected
Pancreas	2	Medium
Parathyroid gland	3	High
Placenta	3	High
Prostate	0	Not detected
Rectum	2	Medium
Salivary gland	2	Medium
Seminal vesicle	1	Low
Skeletal muscle	3	High
Skin	2	Medium
Small intestine	2	Medium
Smooth muscle	2	Medium
Soft tissue	2	Medium
Spleen	0	Not detected
Stomach	3	High
Testis	3	High
Thyroid gland	2	Medium
Tonsil	1	Low
Urinary bladder	2	Medium
Vagina	1	Low

Summary
Symbol	PBRM1
Name	polybromo 1
Aliases	BAF180; PB1; BRG1-associated factor 180; polybromo-1D; hPB1; Protein polybromo-1
Location	3p21.1
External Links	HGNC, NCBI, Ensembl, Uniprot, GeneCards
Cancer Gene Databases	ONGene (Oncogene) , TSGene (Tumor suppressor gene) , NCG (Network of Cancer Genes)
Content	> Association between expresson and subtype > Overall survival analysis based on expression > Association between expresson and stage > Association between expresson and grade

> Subtype

[ TOP ]

Association between expresson and subtype.

Cancer	Full Name	# Patients	P Value (Kruskal-Wallis)	Association	Source
BLCA	Bladder urothelial carcinoma	128	0.514	NS	24476821
BRCA	Breast invasive carcinoma	521	0.000349	Significant	23000897
COAD	Colon adenocarcinoma	149	0.578	NS	22810696
GBM	Glioblastoma multiforme	157	4.64e-06	Significant	26824661
HNSC	Head and Neck squamous cell carcinoma	279	1.02e-05	Significant	25631445
KIRP	Kidney renal papillary cell carcinoma	161	0.302	NS	26536169
LGG	Brain Lower Grade Glioma	513	1.53e-06	Significant	26824661
LUAD	Lung adenocarcinoma	230	0.0129	Significant	25079552
LUSC	Lung squamous cell carcinoma	178	0.00293	Significant	22960745
OV	Ovarian serous cystadenocarcinoma	287	1.55e-06	Significant	21720365
PRAD	Prostate adenocarcinoma	333	3.23e-05	Significant	26544944
READ	Rectum adenocarcinoma	67	0.278	NS	22810696
SKCM	Skin Cutaneous Melanoma	315	0.00186	Significant	26091043
STAD	Stomach adenocarcinoma	277	0.255	NS	25079317
THCA	Thyroid carcinoma	391	0.0663	NS	25417114
UCEC	Uterine Corpus Endometrial Carcinoma	232	0.0152	Significant	23636398

> Overall survival

[ TOP ]

Overall survival analysis based on expression.

Cancer	Full Name	# Patients	Hazard Ratio	P Value (Log Rank Test)	Association
BLCA	Bladder urothelial carcinoma	405	0.827	0.393	NS
BRCA	Breast invasive carcinoma	1079	0.97	0.895	NS
CESC	Cervical and endocervical cancers	291	1.287	0.436	NS
COAD	Colon adenocarcinoma	439	0.556	0.0351	Longer
ESCA	Esophageal carcinoma	184	1.116	0.73	NS
GBM	Glioblastoma multiforme	158	0.738	0.241	NS
HNSC	Head and Neck squamous cell carcinoma	518	0.675	0.0498	Longer
KIRC	Kidney renal clear cell carcinoma	531	0.703	0.1	NS
KIRP	Kidney renal papillary cell carcinoma	287	0.415	0.0655	NS
LAML	Acute Myeloid Leukemia	149	0.744	0.316	NS
LGG	Brain Lower Grade Glioma	511	0.933	0.785	NS
LIHC	Liver hepatocellular carcinoma	365	1.142	0.616	NS
LUAD	Lung adenocarcinoma	502	0.867	0.482	NS
LUSC	Lung squamous cell carcinoma	494	0.879	0.504	NS
OV	Ovarian serous cystadenocarcinoma	303	0.891	0.583	NS
PAAD	Pancreatic adenocarcinoma	177	1.536	0.128	NS
PCPG	Pheochromocytoma and Paraganglioma	179	939303425.902	0.225	NS
PRAD	Prostate adenocarcinoma	497	5.334	0.133	NS
READ	Rectum adenocarcinoma	159	0.445	0.181	NS
SARC	Sarcoma	259	1.441	0.22	NS
SKCM	Skin Cutaneous Melanoma	459	1.288	0.193	NS
STAD	Stomach adenocarcinoma	388	0.921	0.719	NS
TGCT	Testicular Germ Cell Tumors	134	594299983.737	0.317	NS
THCA	Thyroid carcinoma	500	2.632	0.219	NS
THYM	Thymoma	119	0	0.00834	Longer
UCEC	Uterine Corpus Endometrial Carcinoma	543	0.852	0.616	NS

> Stage

[ TOP ]

Association between expresson and stage.

Cancer	Full Name	# Patients	R Value (Spearman)	P Value (Spearman)	Association
BLCA	Bladder urothelial carcinoma	406	-0.079	0.113	NS
BRCA	Breast invasive carcinoma	1071	-0.016	0.599	NS
CESC	Cervical and endocervical cancers	167	-0.027	0.725	NS
COAD	Colon adenocarcinoma	445	-0.052	0.273	NS
ESCA	Esophageal carcinoma	162	-0.06	0.451	NS
HNSC	Head and Neck squamous cell carcinoma	448	-0.113	0.0171	Lower
KIRC	Kidney renal clear cell carcinoma	531	-0.152	0.000451	Lower
KIRP	Kidney renal papillary cell carcinoma	260	-0.141	0.0232	Lower
LIHC	Liver hepatocellular carcinoma	347	0.019	0.73	NS
LUAD	Lung adenocarcinoma	507	-0.01	0.818	NS
LUSC	Lung squamous cell carcinoma	497	-0.057	0.202	NS
OV	Ovarian serous cystadenocarcinoma	302	-0.157	0.00621	Lower
PAAD	Pancreatic adenocarcinoma	176	0.027	0.719	NS
READ	Rectum adenocarcinoma	156	0.035	0.663	NS
SKCM	Skin Cutaneous Melanoma	410	-0.062	0.207	NS
STAD	Stomach adenocarcinoma	392	0.015	0.768	NS
TGCT	Testicular Germ Cell Tumors	81	0.053	0.637	NS
THCA	Thyroid carcinoma	499	-0.03	0.502	NS
UCEC	Uterine Corpus Endometrial Carcinoma	501	-0.054	0.225	NS

> Grade

[ TOP ]

Association between expresson and grade.

Cancer	Full Name	# Patients	R Value (Spearman)	P Value (Spearman)	Association
CESC	Cervical and endocervical cancers	272	-0.041	0.499	NS
HNSC	Head and Neck squamous cell carcinoma	498	0.025	0.583	NS
KIRC	Kidney renal clear cell carcinoma	525	-0.127	0.00351	Lower
LGG	Brain Lower Grade Glioma	514	0.053	0.227	NS
LIHC	Liver hepatocellular carcinoma	366	0.121	0.0205	Higher
OV	Ovarian serous cystadenocarcinoma	296	-0.069	0.238	NS
PAAD	Pancreatic adenocarcinoma	176	-0.033	0.663	NS
STAD	Stomach adenocarcinoma	406	-0.029	0.561	NS
UCEC	Uterine Corpus Endometrial Carcinoma	534	0.087	0.0454	Higher

Summary
Symbol	PBRM1
Name	polybromo 1
Aliases	BAF180; PB1; BRG1-associated factor 180; polybromo-1D; hPB1; Protein polybromo-1
Location	3p21.1
External Links	HGNC, NCBI, Ensembl, Uniprot, GeneCards
Cancer Gene Databases	ONGene (Oncogene) , TSGene (Tumor suppressor gene) , NCG (Network of Cancer Genes)
Content	> Targets inferred by reverse engineering method > Targets identified by ChIP-seq data

> Targets inferred by reverse engineering method [ TOP ]

> Targets identified by ChIP-seq data [ TOP ]

Summary
Symbol	PBRM1
Name	polybromo 1
Aliases	BAF180; PB1; BRG1-associated factor 180; polybromo-1D; hPB1; Protein polybromo-1
Location	3p21.1
External Links	HGNC, NCBI, Ensembl, Uniprot, GeneCards
Cancer Gene Databases	ONGene (Oncogene) , TSGene (Tumor suppressor gene) , NCG (Network of Cancer Genes)
Content	> Drugs from DrugBank database

> Drugs from DrugBank database [ TOP ]
There is no record for PBRM1.

Summary
Symbol	PBRM1
Name	polybromo 1
Aliases	BAF180; PB1; BRG1-associated factor 180; polybromo-1D; hPB1; Protein polybromo-1
Location	3p21.1
External Links	HGNC, NCBI, Ensembl, Uniprot, GeneCards
Cancer Gene Databases	ONGene (Oncogene) , TSGene (Tumor suppressor gene) , NCG (Network of Cancer Genes)
Content	> Protein-Protein Interaction Network > miRNA Regulatory Relationship > Interactions from Text Mining

> Protein-Protein Interaction Network [ TOP ]

> miRNA Regulatory Relationship [ TOP ]

> Interactions from Text Mining

[ TOP ]

PMID	Cancer	Hierarchy	Gene	Relation to CR	Evidence
24063284	Renal Cell Carcinoma	upstream	miR-590-5p	negative regulation	We confirmed that PBRM1 was a direct target of miR-590-5p. miR-590-5p could regulate PBRM1 mRNA and protein expressions in clear cell renal carcinoma (ccRCC) ACHN and 786-O cells. Downregulation of miR-590-5p, which resulted in increased PBRM1, inhibited proliferation and invasion of ccRCC cells.
27764136	Clear Cell Renal Cell Carcinoma	partner	ARID1A; BRM	positive correlation	For instance, ARID1A loss almost always accompanied PBRM1 loss, whereas BRM loss accompanied loss of BRG1, PBRM1 or ARID1A.
28618948	Clear Cell Renal Cell Carcinoma	partner	BAP1	Mutual exclusive	While in clear cell renal cell carcinoma, BAP1 mutation was mutually exclusive with PBRM1 mutations, and BAP1-mutant clear cell renal cell carcinomas also showed significantly worse prognosis than PBRM1-mutant clear cell renal cell carcinomas ( p=0.001).
28092369	Clear Cell Renal Cell Carcinoma	partner	HIF-1; HIF2	Co-activitor	In addition, our data show that BAF180 functions as co-activator for HIF1- and HIF2-mediated transcriptional response, and BAF180's tumor-suppressive and -promoting activity in ccRCC cell lines depends on co-expression of HIF1 and HIF2, respectively.
27764136	Clear Cell Renal Cell Carcinoma	partner	ARID1A	Association	For instance, ARID1A loss almost always accompanied PBRM1 loss, whereas BRM loss accompanied loss of BRG1, PBRM1 or ARID1A.